run_metadata
75 rows where experiment.library_selection = "size fractionation", technology = "bulk" and tissue_curation = "Whole Organism"
This data as json, CSV (advanced)
| Link | rowid ▼ | run.accession | experiment.accession | sample.accession | study.accession | bioproject | study.title | study.alias | study.type | study.abstract | study.attributes | study.PMIDs | sample.description | sample.title | sample.alias | sample.centername | sample.attributes | GEOsample.title | GEOsample.dataprocessing | GEOsample.source | GEOsample.treatmentprotocol | GEOsample.extractprotocol | GEOsample.growthprotocol | GEOsample.characteristics | GEOsample.accession | experiment.title | experiment.alias | experiment.library_name | experiment.design_description | experiment.library_construction_protocol | experiment.attributes | experiment.library_strategy | experiment.library_source | experiment.library_selection | experiment.library_layout | experiment.platform | experiment.instrument_model | experiment.spot_descriptor | experiment.study_ref | run.title | run.attributes | run.filename | run.semantic_name | run.total_bases | run.total_spots | run.alias | run.read_lengths | run.base_counts | run.r1_length | run.r2_length | run.r3_length | run.r4_length | run.Acount | run.Ccount | run.Gcount | run.Tcount | run.Ncount | run.experiment | run.pool_member | submission.accession | submission.srasource | submission.bioprojectsource | seqdetective.n_mates | seqdetective.mapping_rate.mate1 | seqdetective.mapping_rate.mate2 | seqdetective.nofeature_rate.mate1 | seqdetective.nofeature_rate.mate2 | seqdetective.sparsity.mate1 | seqdetective.sparsity.mate2 | seqdetective.pos_strand_rate.mate1 | seqdetective.pos_strand_rate.mate2 | seqdetective.readlen.mate1 | seqdetective.readlen.mate2 | seqdetective.judgement.mate1 | seqdetective.judgement.mate2 | seqdetective.judgement.reason | platform_family | instrument_generation | read_bias | selection_class | prep_kit | sc_or_bulk | tech_class | technology | tech_variant | submission.bioprojectsource.country | earliest_date | devstage_curation | devstage_curation_coarse | tissue_curation | tissue_curation_coarse |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 53033 | 53033 | SRR9674344 | SRX6434730 | SRS5089289 | SRP214428 | PRJNA554249 | the role of SMN complex in tissue regeneration | GSE134187 | Transcriptome Analysis | we conducted RNA Seq and MiRNA Seq to screen the molecular targets and pathways involved in tissue regeneration of SMN complex members Overall design: we compared the 3 regeneration gene mutants to the 4 non regeneration gene mutants. | rnpc3 WT 1 [miRNA seq] | GSM3938561 | source name:Wildtype siblings of rnpc3 mutants repeat 1|strain background:TAB 5|genotype/variation:Wildtype siblings of rnpc3 mutants|Stage:7 dpf|tissue:whole fish embryos | rnpc3 WT 1 [miRNA seq] | Reads are trimmed using Trimmomatic v0.36 Trimmed reads are aligned using STAR 2.5.4a mRNA or "hisat2 2.2.1.0 no softclip no spliced alignment rna strandness R new summary" miRNA abundance is measured by RSEM "rsem calculate expression paired end forward prob 0.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output" for mRNA Seq "rsem calculate expression forward prob 1.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output fragment length mean 22 fragment length sd 10 seed length 15" for miRNA Seq Genome build: danRer10/Ensembl release 91 for mRNA Seq miRBase mature miRNA for microRNA Seq Supplementary files format and content: RSEM output gene abundance | Wildtype siblings of rnpc3 mutants repeat 1 | Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols | strain background:TAB 5|genotype/variation:Wildtype siblings of rnpc3 mutants|Stage:7 dpf|tissue:whole fish embryos | GSM3938561 | GSM3938561: rnpc3 WT 1 [miRNA seq]; Danio rerio; miRNA Seq | GSM3938561 | 1 | Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols | GEO Accession:GSM3938561 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP214428 | mir_Rpc3_1Ctrl.fastq.gz | fastq | 1129597674.0 | 22148974.0 | GSM3938561 r1 | 0:51 | A:255811479;C:280511308;G:313965625;T:279284342;N:24920 | 51 | 255811479 | 280511308 | 313965625 | 279284342 | 24920 | SRX6434730 | SRS5089289 | SRA920248 | GEO | Burgess, NHGRI, NIH | 1 | 0.00979 | 0.00166 | 0.99588 | 0.63728 | 51 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | unknown | bulk | bulk | bulk | United States | 2019-07-12 | Larval | Larval | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 53034 | 53034 | SRR9674343 | SRX6434729 | SRS5089288 | SRP214428 | PRJNA554249 | the role of SMN complex in tissue regeneration | GSE134187 | Transcriptome Analysis | we conducted RNA Seq and MiRNA Seq to screen the molecular targets and pathways involved in tissue regeneration of SMN complex members Overall design: we compared the 3 regeneration gene mutants to the 4 non regeneration gene mutants. | smn1 WT 1 [miRNA seq] | GSM3938560 | source name:Wildtype siblings of smn1 mutants repeat 1|strain background:TAB 5|genotype/variation:Wildtype siblings of smn1 mutants|Stage:7 dpf|tissue:whole fish embryos | smn1 WT 1 [miRNA seq] | Reads are trimmed using Trimmomatic v0.36 Trimmed reads are aligned using STAR 2.5.4a mRNA or "hisat2 2.2.1.0 no softclip no spliced alignment rna strandness R new summary" miRNA abundance is measured by RSEM "rsem calculate expression paired end forward prob 0.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output" for mRNA Seq "rsem calculate expression forward prob 1.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output fragment length mean 22 fragment length sd 10 seed length 15" for miRNA Seq Genome build: danRer10/Ensembl release 91 for mRNA Seq miRBase mature miRNA for microRNA Seq Supplementary files format and content: RSEM output gene abundance | Wildtype siblings of smn1 mutants repeat 1 | Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols | strain background:TAB 5|genotype/variation:Wildtype siblings of smn1 mutants|Stage:7 dpf|tissue:whole fish embryos | GSM3938560 | GSM3938560: smn1 WT 1 [miRNA seq]; Danio rerio; miRNA Seq | GSM3938560 | 1 | Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols | GEO Accession:GSM3938560 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP214428 | mir_Smn1_1Ctrl.fastq.gz | fastq | 1381751976.0 | 27093176.0 | GSM3938560 r1 | 0:51 | A:323091185;C:348663819;G:380517013;T:329446099;N:33860 | 51 | 323091185 | 348663819 | 380517013 | 329446099 | 33860 | SRX6434729 | SRS5089288 | SRA920248 | GEO | Burgess, NHGRI, NIH | 1 | 0.00712 | 0.00142 | 0.99642 | 0.66315 | 51 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | unknown | bulk | bulk | bulk | United States | 2019-07-12 | Larval | Larval | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 53035 | 53035 | SRR9674342 | SRX6434728 | SRS5089287 | SRP214428 | PRJNA554249 | the role of SMN complex in tissue regeneration | GSE134187 | Transcriptome Analysis | we conducted RNA Seq and MiRNA Seq to screen the molecular targets and pathways involved in tissue regeneration of SMN complex members Overall design: we compared the 3 regeneration gene mutants to the 4 non regeneration gene mutants. | gemin5 WT 1 [miRNA seq] | GSM3938559 | source name:Wildtype siblings of germin5 mutants repeat 1|strain background:TAB 5|genotype/variation:Wildtype siblings of germin5 mutants|Stage:7 dpf|tissue:whole fish embryos | gemin5 WT 1 [miRNA seq] | Reads are trimmed using Trimmomatic v0.36 Trimmed reads are aligned using STAR 2.5.4a mRNA or "hisat2 2.2.1.0 no softclip no spliced alignment rna strandness R new summary" miRNA abundance is measured by RSEM "rsem calculate expression paired end forward prob 0.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output" for mRNA Seq "rsem calculate expression forward prob 1.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output fragment length mean 22 fragment length sd 10 seed length 15" for miRNA Seq Genome build: danRer10/Ensembl release 91 for mRNA Seq miRBase mature miRNA for microRNA Seq Supplementary files format and content: RSEM output gene abundance | Wildtype siblings of germin5 mutants repeat 1 | Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols | strain background:TAB 5|genotype/variation:Wildtype siblings of germin5 mutants|Stage:7 dpf|tissue:whole fish embryos | GSM3938559 | GSM3938559: gemin5 WT 1 [miRNA seq]; Danio rerio; miRNA Seq | GSM3938559 | 1 | Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols | GEO Accession:GSM3938559 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP214428 | mir_Gmn5_1Ctrl.fastq.gz | fastq | 1347630171.0 | 26424121.0 | GSM3938559 r1 | 0:51 | A:307019777;C:335315873;G:378259746;T:327002846;N:31929 | 51 | 307019777 | 335315873 | 378259746 | 327002846 | 31929 | SRX6434728 | SRS5089287 | SRA920248 | GEO | Burgess, NHGRI, NIH | 1 | 0.00723 | 0.00127 | 0.99582 | 0.63934 | 51 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | unknown | bulk | bulk | bulk | United States | 2019-07-12 | Larval | Larval | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 53036 | 53036 | SRR9674341 | SRX6434727 | SRS5089286 | SRP214428 | PRJNA554249 | the role of SMN complex in tissue regeneration | GSE134187 | Transcriptome Analysis | we conducted RNA Seq and MiRNA Seq to screen the molecular targets and pathways involved in tissue regeneration of SMN complex members Overall design: we compared the 3 regeneration gene mutants to the 4 non regeneration gene mutants. | smn1 hom 3 [miRNA seq] | GSM3938558 | source name:Homozygous smn1 mutants repeat 3|strain background:TAB 5|genotype/variation:Homozygous smn1 mutants|Stage:7 dpf|tissue:whole fish embryos | smn1 hom 3 [miRNA seq] | Reads are trimmed using Trimmomatic v0.36 Trimmed reads are aligned using STAR 2.5.4a mRNA or "hisat2 2.2.1.0 no softclip no spliced alignment rna strandness R new summary" miRNA abundance is measured by RSEM "rsem calculate expression paired end forward prob 0.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output" for mRNA Seq "rsem calculate expression forward prob 1.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output fragment length mean 22 fragment length sd 10 seed length 15" for miRNA Seq Genome build: danRer10/Ensembl release 91 for mRNA Seq miRBase mature miRNA for microRNA Seq Supplementary files format and content: RSEM output gene abundance | Homozygous smn1 mutants repeat 3 | Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols | strain background:TAB 5|genotype/variation:Homozygous smn1 mutants|Stage:7 dpf|tissue:whole fish embryos | GSM3938558 | GSM3938558: smn1 hom 3 [miRNA seq]; Danio rerio; miRNA Seq | GSM3938558 | 1 | Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols | GEO Accession:GSM3938558 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP214428 | mir_Smn1_3hom.fastq.gz | fastq | 1269172638.0 | 24885738.0 | GSM3938558 r1 | 0:51 | A:290351922;C:320656517;G:354834895;T:303300306;N:28998 | 51 | 290351922 | 320656517 | 354834895 | 303300306 | 28998 | SRX6434727 | SRS5089286 | SRA920248 | GEO | Burgess, NHGRI, NIH | 1 | 0.0061 | 0.00111 | 0.9962 | 0.5917 | 51 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | unknown | bulk | bulk | bulk | United States | 2019-07-12 | Larval | Larval | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 53037 | 53037 | SRR9674340 | SRX6434726 | SRS5089285 | SRP214428 | PRJNA554249 | the role of SMN complex in tissue regeneration | GSE134187 | Transcriptome Analysis | we conducted RNA Seq and MiRNA Seq to screen the molecular targets and pathways involved in tissue regeneration of SMN complex members Overall design: we compared the 3 regeneration gene mutants to the 4 non regeneration gene mutants. | smn1 hom 2 [miRNA seq] | GSM3938557 | source name:Homozygous smn1 mutants repeat 2|strain background:TAB 5|genotype/variation:Homozygous smn1 mutants|Stage:7 dpf|tissue:whole fish embryos | smn1 hom 2 [miRNA seq] | Reads are trimmed using Trimmomatic v0.36 Trimmed reads are aligned using STAR 2.5.4a mRNA or "hisat2 2.2.1.0 no softclip no spliced alignment rna strandness R new summary" miRNA abundance is measured by RSEM "rsem calculate expression paired end forward prob 0.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output" for mRNA Seq "rsem calculate expression forward prob 1.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output fragment length mean 22 fragment length sd 10 seed length 15" for miRNA Seq Genome build: danRer10/Ensembl release 91 for mRNA Seq miRBase mature miRNA for microRNA Seq Supplementary files format and content: RSEM output gene abundance | Homozygous smn1 mutants repeat 2 | Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols | strain background:TAB 5|genotype/variation:Homozygous smn1 mutants|Stage:7 dpf|tissue:whole fish embryos | GSM3938557 | GSM3938557: smn1 hom 2 [miRNA seq]; Danio rerio; miRNA Seq | GSM3938557 | 1 | Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols | GEO Accession:GSM3938557 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP214428 | mir_Smn1_2hom.fastq.gz | fastq | 1625802786.0 | 31878486.0 | GSM3938557 r1 | 0:51 | A:376836190;C:399950981;G:453572869;T:395403783;N:38963 | 51 | 376836190 | 399950981 | 453572869 | 395403783 | 38963 | SRX6434726 | SRS5089285 | SRA920248 | GEO | Burgess, NHGRI, NIH | 1 | 0.00609 | 0.00111 | 0.99638 | 0.63347 | 51 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | unknown | bulk | bulk | bulk | United States | 2019-07-12 | Larval | Larval | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 53038 | 53038 | SRR9674339 | SRX6434725 | SRS5089284 | SRP214428 | PRJNA554249 | the role of SMN complex in tissue regeneration | GSE134187 | Transcriptome Analysis | we conducted RNA Seq and MiRNA Seq to screen the molecular targets and pathways involved in tissue regeneration of SMN complex members Overall design: we compared the 3 regeneration gene mutants to the 4 non regeneration gene mutants. | smn1 hom 1 [miRNA seq] | GSM3938556 | source name:Homozygous smn1 mutants repeat 1|strain background:TAB 5|genotype/variation:Homozygous smn1 mutants|Stage:7 dpf|tissue:whole fish embryos | smn1 hom 1 [miRNA seq] | Reads are trimmed using Trimmomatic v0.36 Trimmed reads are aligned using STAR 2.5.4a mRNA or "hisat2 2.2.1.0 no softclip no spliced alignment rna strandness R new summary" miRNA abundance is measured by RSEM "rsem calculate expression paired end forward prob 0.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output" for mRNA Seq "rsem calculate expression forward prob 1.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output fragment length mean 22 fragment length sd 10 seed length 15" for miRNA Seq Genome build: danRer10/Ensembl release 91 for mRNA Seq miRBase mature miRNA for microRNA Seq Supplementary files format and content: RSEM output gene abundance | Homozygous smn1 mutants repeat 1 | Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols | strain background:TAB 5|genotype/variation:Homozygous smn1 mutants|Stage:7 dpf|tissue:whole fish embryos | GSM3938556 | GSM3938556: smn1 hom 1 [miRNA seq]; Danio rerio; miRNA Seq | GSM3938556 | 1 | Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols | GEO Accession:GSM3938556 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP214428 | mir_Smn1_1hom.fastq.gz | fastq | 1553527320.0 | 30461320.0 | GSM3938556 r1 | 0:51 | A:360279409;C:388795394;G:432335873;T:372080058;N:36586 | 51 | 360279409 | 388795394 | 432335873 | 372080058 | 36586 | SRX6434725 | SRS5089284 | SRA920248 | GEO | Burgess, NHGRI, NIH | 1 | 0.00691 | 0.00137 | 0.99638 | 0.61909 | 51 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | unknown | bulk | bulk | bulk | United States | 2019-07-12 | Larval | Larval | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 53039 | 53039 | SRR9674338 | SRX6434724 | SRS5089283 | SRP214428 | PRJNA554249 | the role of SMN complex in tissue regeneration | GSE134187 | Transcriptome Analysis | we conducted RNA Seq and MiRNA Seq to screen the molecular targets and pathways involved in tissue regeneration of SMN complex members Overall design: we compared the 3 regeneration gene mutants to the 4 non regeneration gene mutants. | gemin5 hom 3 [miRNA seq] | GSM3938555 | source name:Homozygous gemin5 mutants repeat 3|strain background:TAB 5|genotype/variation:Homozygous gemin5 mutants|Stage:7 dpf|tissue:whole fish embryos | gemin5 hom 3 [miRNA seq] | Reads are trimmed using Trimmomatic v0.36 Trimmed reads are aligned using STAR 2.5.4a mRNA or "hisat2 2.2.1.0 no softclip no spliced alignment rna strandness R new summary" miRNA abundance is measured by RSEM "rsem calculate expression paired end forward prob 0.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output" for mRNA Seq "rsem calculate expression forward prob 1.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output fragment length mean 22 fragment length sd 10 seed length 15" for miRNA Seq Genome build: danRer10/Ensembl release 91 for mRNA Seq miRBase mature miRNA for microRNA Seq Supplementary files format and content: RSEM output gene abundance | Homozygous gemin5 mutants repeat 3 | Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols | strain background:TAB 5|genotype/variation:Homozygous gemin5 mutants|Stage:7 dpf|tissue:whole fish embryos | GSM3938555 | GSM3938555: gemin5 hom 3 [miRNA seq]; Danio rerio; miRNA Seq | GSM3938555 | 1 | Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols | GEO Accession:GSM3938555 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP214428 | mir_Gmn5_3hom.fastq.gz | fastq | 1162857936.0 | 22801136.0 | GSM3938555 r1 | 0:51 | A:267576310;C:282684680;G:327841913;T:284728561;N:26472 | 51 | 267576310 | 282684680 | 327841913 | 284728561 | 26472 | SRX6434724 | SRS5089283 | SRA920248 | GEO | Burgess, NHGRI, NIH | 1 | 0.00597 | 0.00114 | 0.99618 | 0.62386 | 51 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | unknown | bulk | bulk | bulk | United States | 2019-07-12 | Larval | Larval | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 53040 | 53040 | SRR9674337 | SRX6434723 | SRS5089282 | SRP214428 | PRJNA554249 | the role of SMN complex in tissue regeneration | GSE134187 | Transcriptome Analysis | we conducted RNA Seq and MiRNA Seq to screen the molecular targets and pathways involved in tissue regeneration of SMN complex members Overall design: we compared the 3 regeneration gene mutants to the 4 non regeneration gene mutants. | gemin5 hom 2 [miRNA seq] | GSM3938554 | source name:Homozygous gemin5 mutants repeat 2|strain background:TAB 5|genotype/variation:Homozygous gemin5 mutants|Stage:7 dpf|tissue:whole fish embryos | gemin5 hom 2 [miRNA seq] | Reads are trimmed using Trimmomatic v0.36 Trimmed reads are aligned using STAR 2.5.4a mRNA or "hisat2 2.2.1.0 no softclip no spliced alignment rna strandness R new summary" miRNA abundance is measured by RSEM "rsem calculate expression paired end forward prob 0.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output" for mRNA Seq "rsem calculate expression forward prob 1.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output fragment length mean 22 fragment length sd 10 seed length 15" for miRNA Seq Genome build: danRer10/Ensembl release 91 for mRNA Seq miRBase mature miRNA for microRNA Seq Supplementary files format and content: RSEM output gene abundance | Homozygous gemin5 mutants repeat 2 | Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols | strain background:TAB 5|genotype/variation:Homozygous gemin5 mutants|Stage:7 dpf|tissue:whole fish embryos | GSM3938554 | GSM3938554: gemin5 hom 2 [miRNA seq]; Danio rerio; miRNA Seq | GSM3938554 | 1 | Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols | GEO Accession:GSM3938554 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP214428 | mir_Gmn5_2hom.fastq.gz | fastq | 1612392846.0 | 31615546.0 | GSM3938554 r1 | 0:51 | A:360634123;C:389619637;G:457463377;T:404638471;N:37238 | 51 | 360634123 | 389619637 | 457463377 | 404638471 | 37238 | SRX6434723 | SRS5089282 | SRA920248 | GEO | Burgess, NHGRI, NIH | 1 | 0.00538 | 0.00085 | 0.99677 | 0.62726 | 51 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | unknown | bulk | bulk | bulk | United States | 2019-07-12 | Larval | Larval | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 53041 | 53041 | SRR9674336 | SRX6434722 | SRS5089281 | SRP214428 | PRJNA554249 | the role of SMN complex in tissue regeneration | GSE134187 | Transcriptome Analysis | we conducted RNA Seq and MiRNA Seq to screen the molecular targets and pathways involved in tissue regeneration of SMN complex members Overall design: we compared the 3 regeneration gene mutants to the 4 non regeneration gene mutants. | gemin5 hom 1 [miRNA seq] | GSM3938553 | source name:Homozygous gemin5 mutants repeat 1|strain background:TAB 5|genotype/variation:Homozygous gemin5 mutants|Stage:7 dpf|tissue:whole fish embryos | gemin5 hom 1 [miRNA seq] | Reads are trimmed using Trimmomatic v0.36 Trimmed reads are aligned using STAR 2.5.4a mRNA or "hisat2 2.2.1.0 no softclip no spliced alignment rna strandness R new summary" miRNA abundance is measured by RSEM "rsem calculate expression paired end forward prob 0.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output" for mRNA Seq "rsem calculate expression forward prob 1.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output fragment length mean 22 fragment length sd 10 seed length 15" for miRNA Seq Genome build: danRer10/Ensembl release 91 for mRNA Seq miRBase mature miRNA for microRNA Seq Supplementary files format and content: RSEM output gene abundance | Homozygous gemin5 mutants repeat 1 | Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols | strain background:TAB 5|genotype/variation:Homozygous gemin5 mutants|Stage:7 dpf|tissue:whole fish embryos | GSM3938553 | GSM3938553: gemin5 hom 1 [miRNA seq]; Danio rerio; miRNA Seq | GSM3938553 | 1 | Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols | GEO Accession:GSM3938553 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP214428 | mir_Gmn5_1hom.fastq.gz | fastq | 1734523362.0 | 34010262.0 | GSM3938553 r1 | 0:51 | A:400823854;C:428868747;G:484830308;T:419961177;N:39276 | 51 | 400823854 | 428868747 | 484830308 | 419961177 | 39276 | SRX6434722 | SRS5089281 | SRA920248 | GEO | Burgess, NHGRI, NIH | 1 | 0.00485 | 0.00098 | 0.99636 | 0.65384 | 51 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | unknown | bulk | bulk | bulk | United States | 2019-07-12 | Larval | Larval | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 53042 | 53042 | SRR9674335 | SRX6434721 | SRS5089280 | SRP214428 | PRJNA554249 | the role of SMN complex in tissue regeneration | GSE134187 | Transcriptome Analysis | we conducted RNA Seq and MiRNA Seq to screen the molecular targets and pathways involved in tissue regeneration of SMN complex members Overall design: we compared the 3 regeneration gene mutants to the 4 non regeneration gene mutants. | gemin6 hom 3 [miRNA seq] | GSM3938552 | source name:Homozygous gemin6 mutants repeat 3|strain background:TAB 5|genotype/variation:Homozygous gemin6 mutants|Stage:7 dpf|tissue:whole fish embryos | gemin6 hom 3 [miRNA seq] | Reads are trimmed using Trimmomatic v0.36 Trimmed reads are aligned using STAR 2.5.4a mRNA or "hisat2 2.2.1.0 no softclip no spliced alignment rna strandness R new summary" miRNA abundance is measured by RSEM "rsem calculate expression paired end forward prob 0.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output" for mRNA Seq "rsem calculate expression forward prob 1.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output fragment length mean 22 fragment length sd 10 seed length 15" for miRNA Seq Genome build: danRer10/Ensembl release 91 for mRNA Seq miRBase mature miRNA for microRNA Seq Supplementary files format and content: RSEM output gene abundance | Homozygous gemin6 mutants repeat 3 | Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols | strain background:TAB 5|genotype/variation:Homozygous gemin6 mutants|Stage:7 dpf|tissue:whole fish embryos | GSM3938552 | GSM3938552: gemin6 hom 3 [miRNA seq]; Danio rerio; miRNA Seq | GSM3938552 | 1 | Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols | GEO Accession:GSM3938552 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP214428 | mir_G6_3.fastq.gz | fastq | 3450343851.0 | 67653801.0 | GSM3938552 r1 | 0:51 | A:777873635;C:888116741;G:969513398;T:814785464;N:54613 | 51 | 777873635 | 888116741 | 969513398 | 814785464 | 54613 | SRX6434721 | SRS5089280 | SRA920248 | GEO | Burgess, NHGRI, NIH | 1 | 0.01435 | 0.00222 | 0.99486 | 0.71333 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | unknown | bulk | bulk | bulk | United States | 2019-07-12 | Larval | Larval | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 53043 | 53043 | SRR9674334 | SRX6434720 | SRS5089279 | SRP214428 | PRJNA554249 | the role of SMN complex in tissue regeneration | GSE134187 | Transcriptome Analysis | we conducted RNA Seq and MiRNA Seq to screen the molecular targets and pathways involved in tissue regeneration of SMN complex members Overall design: we compared the 3 regeneration gene mutants to the 4 non regeneration gene mutants. | gemin6 hom 2 [miRNA seq] | GSM3938551 | source name:Homozygous gemin6 mutants repeat 2|strain background:TAB 5|genotype/variation:Homozygous gemin6 mutants|Stage:7 dpf|tissue:whole fish embryos | gemin6 hom 2 [miRNA seq] | Reads are trimmed using Trimmomatic v0.36 Trimmed reads are aligned using STAR 2.5.4a mRNA or "hisat2 2.2.1.0 no softclip no spliced alignment rna strandness R new summary" miRNA abundance is measured by RSEM "rsem calculate expression paired end forward prob 0.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output" for mRNA Seq "rsem calculate expression forward prob 1.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output fragment length mean 22 fragment length sd 10 seed length 15" for miRNA Seq Genome build: danRer10/Ensembl release 91 for mRNA Seq miRBase mature miRNA for microRNA Seq Supplementary files format and content: RSEM output gene abundance | Homozygous gemin6 mutants repeat 2 | Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols | strain background:TAB 5|genotype/variation:Homozygous gemin6 mutants|Stage:7 dpf|tissue:whole fish embryos | GSM3938551 | GSM3938551: gemin6 hom 2 [miRNA seq]; Danio rerio; miRNA Seq | GSM3938551 | 1 | Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols | GEO Accession:GSM3938551 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP214428 | mir_G6_2.fastq.gz | fastq | 1586876781.0 | 31115231.0 | GSM3938551 r1 | 0:51 | A:373921059;C:393906222;G:435371208;T:383652895;N:25397 | 51 | 373921059 | 393906222 | 435371208 | 383652895 | 25397 | SRX6434720 | SRS5089279 | SRA920248 | GEO | Burgess, NHGRI, NIH | 1 | 0.01456 | 0.00199 | 0.99488 | 0.65884 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | unknown | bulk | bulk | bulk | United States | 2019-07-12 | Larval | Larval | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 53044 | 53044 | SRR9674333 | SRX6434719 | SRS5089278 | SRP214428 | PRJNA554249 | the role of SMN complex in tissue regeneration | GSE134187 | Transcriptome Analysis | we conducted RNA Seq and MiRNA Seq to screen the molecular targets and pathways involved in tissue regeneration of SMN complex members Overall design: we compared the 3 regeneration gene mutants to the 4 non regeneration gene mutants. | gemin6 hom 1 [miRNA seq] | GSM3938550 | source name:Homozygous gemin6 mutants repeat 1|strain background:TAB 5|genotype/variation:Homozygous gemin6 mutants|Stage:7 dpf|tissue:whole fish embryos | gemin6 hom 1 [miRNA seq] | Reads are trimmed using Trimmomatic v0.36 Trimmed reads are aligned using STAR 2.5.4a mRNA or "hisat2 2.2.1.0 no softclip no spliced alignment rna strandness R new summary" miRNA abundance is measured by RSEM "rsem calculate expression paired end forward prob 0.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output" for mRNA Seq "rsem calculate expression forward prob 1.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output fragment length mean 22 fragment length sd 10 seed length 15" for miRNA Seq Genome build: danRer10/Ensembl release 91 for mRNA Seq miRBase mature miRNA for microRNA Seq Supplementary files format and content: RSEM output gene abundance | Homozygous gemin6 mutants repeat 1 | Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols | strain background:TAB 5|genotype/variation:Homozygous gemin6 mutants|Stage:7 dpf|tissue:whole fish embryos | GSM3938550 | GSM3938550: gemin6 hom 1 [miRNA seq]; Danio rerio; miRNA Seq | GSM3938550 | 1 | Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols | GEO Accession:GSM3938550 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP214428 | mir_G6_1.fastq.gz | fastq | 1632291159.0 | 32005709.0 | GSM3938550 r1 | 0:51 | A:387703621;C:405051941;G:452019824;T:387489473;N:26300 | 51 | 387703621 | 405051941 | 452019824 | 387489473 | 26300 | SRX6434719 | SRS5089278 | SRA920248 | GEO | Burgess, NHGRI, NIH | 1 | 0.01378 | 0.00168 | 0.99482 | 0.66266 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | unknown | bulk | bulk | bulk | United States | 2019-07-12 | Larval | Larval | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 53045 | 53045 | SRR9674332 | SRX6434718 | SRS5089277 | SRP214428 | PRJNA554249 | the role of SMN complex in tissue regeneration | GSE134187 | Transcriptome Analysis | we conducted RNA Seq and MiRNA Seq to screen the molecular targets and pathways involved in tissue regeneration of SMN complex members Overall design: we compared the 3 regeneration gene mutants to the 4 non regeneration gene mutants. | gemin4 hom 3 [miRNA seq] | GSM3938549 | source name:Homozygous gemin4 mutants repeat 3|strain background:TAB 5|genotype/variation:Homozygous gemin4 mutants|Stage:7 dpf|tissue:whole fish embryos | gemin4 hom 3 [miRNA seq] | Reads are trimmed using Trimmomatic v0.36 Trimmed reads are aligned using STAR 2.5.4a mRNA or "hisat2 2.2.1.0 no softclip no spliced alignment rna strandness R new summary" miRNA abundance is measured by RSEM "rsem calculate expression paired end forward prob 0.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output" for mRNA Seq "rsem calculate expression forward prob 1.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output fragment length mean 22 fragment length sd 10 seed length 15" for miRNA Seq Genome build: danRer10/Ensembl release 91 for mRNA Seq miRBase mature miRNA for microRNA Seq Supplementary files format and content: RSEM output gene abundance | Homozygous gemin4 mutants repeat 3 | Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols | strain background:TAB 5|genotype/variation:Homozygous gemin4 mutants|Stage:7 dpf|tissue:whole fish embryos | GSM3938549 | GSM3938549: gemin4 hom 3 [miRNA seq]; Danio rerio; miRNA Seq | GSM3938549 | 1 | Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols | GEO Accession:GSM3938549 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP214428 | mir_G4_3.fastq.gz | fastq | 1079490837.0 | 21166487.0 | GSM3938549 r1 | 0:51 | A:247548301;C:266526237;G:295997407;T:269401582;N:17310 | 51 | 247548301 | 266526237 | 295997407 | 269401582 | 17310 | SRX6434718 | SRS5089277 | SRA920248 | GEO | Burgess, NHGRI, NIH | 1 | 0.01616 | 0.00211 | 0.99486 | 0.65494 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | size_fractionation | unknown | bulk | bulk | bulk | United States | 2019-07-12 | Larval | Larval | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 53046 | 53046 | SRR9674331 | SRX6434717 | SRS5089276 | SRP214428 | PRJNA554249 | the role of SMN complex in tissue regeneration | GSE134187 | Transcriptome Analysis | we conducted RNA Seq and MiRNA Seq to screen the molecular targets and pathways involved in tissue regeneration of SMN complex members Overall design: we compared the 3 regeneration gene mutants to the 4 non regeneration gene mutants. | gemin4 hom 2 [miRNA seq] | GSM3938548 | source name:Homozygous gemin4 mutants repeat 2|strain background:TAB 5|genotype/variation:Homozygous gemin4 mutants|Stage:7 dpf|tissue:whole fish embryos | gemin4 hom 2 [miRNA seq] | Reads are trimmed using Trimmomatic v0.36 Trimmed reads are aligned using STAR 2.5.4a mRNA or "hisat2 2.2.1.0 no softclip no spliced alignment rna strandness R new summary" miRNA abundance is measured by RSEM "rsem calculate expression paired end forward prob 0.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output" for mRNA Seq "rsem calculate expression forward prob 1.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output fragment length mean 22 fragment length sd 10 seed length 15" for miRNA Seq Genome build: danRer10/Ensembl release 91 for mRNA Seq miRBase mature miRNA for microRNA Seq Supplementary files format and content: RSEM output gene abundance | Homozygous gemin4 mutants repeat 2 | Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols | strain background:TAB 5|genotype/variation:Homozygous gemin4 mutants|Stage:7 dpf|tissue:whole fish embryos | GSM3938548 | GSM3938548: gemin4 hom 2 [miRNA seq]; Danio rerio; miRNA Seq | GSM3938548 | 1 | Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols | GEO Accession:GSM3938548 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP214428 | mir_G4_2.fastq.gz | fastq | 6427925862.0 | 126037762.0 | GSM3938548 r1 | 0:51 | A:1491339645;C:1560095279;G:1804953332;T:1571434430;N:103176 | 51 | 1491339645 | 1560095279 | 1804953332 | 1571434430 | 103176 | SRX6434717 | SRS5089276 | SRA920248 | GEO | Burgess, NHGRI, NIH | 1 | 0.01032 | 0.00157 | 0.99504 | 0.70577 | 51 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | unknown | bulk | bulk | bulk | United States | 2019-07-12 | Larval | Larval | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 53047 | 53047 | SRR9674330 | SRX6434716 | SRS5089275 | SRP214428 | PRJNA554249 | the role of SMN complex in tissue regeneration | GSE134187 | Transcriptome Analysis | we conducted RNA Seq and MiRNA Seq to screen the molecular targets and pathways involved in tissue regeneration of SMN complex members Overall design: we compared the 3 regeneration gene mutants to the 4 non regeneration gene mutants. | gemin4 hom 1 [miRNA seq] | GSM3938547 | source name:Homozygous gemin4 mutants repeat 1|strain background:TAB 5|genotype/variation:Homozygous gemin4 mutants|Stage:7 dpf|tissue:whole fish embryos | gemin4 hom 1 [miRNA seq] | Reads are trimmed using Trimmomatic v0.36 Trimmed reads are aligned using STAR 2.5.4a mRNA or "hisat2 2.2.1.0 no softclip no spliced alignment rna strandness R new summary" miRNA abundance is measured by RSEM "rsem calculate expression paired end forward prob 0.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output" for mRNA Seq "rsem calculate expression forward prob 1.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output fragment length mean 22 fragment length sd 10 seed length 15" for miRNA Seq Genome build: danRer10/Ensembl release 91 for mRNA Seq miRBase mature miRNA for microRNA Seq Supplementary files format and content: RSEM output gene abundance | Homozygous gemin4 mutants repeat 1 | Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols | strain background:TAB 5|genotype/variation:Homozygous gemin4 mutants|Stage:7 dpf|tissue:whole fish embryos | GSM3938547 | GSM3938547: gemin4 hom 1 [miRNA seq]; Danio rerio; miRNA Seq | GSM3938547 | 1 | Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols | GEO Accession:GSM3938547 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP214428 | mir_G4_1.fastq.gz | fastq | 3063591624.0 | 60070424.0 | GSM3938547 r1 | 0:51 | A:710248035;C:750319193;G:848095316;T:754879685;N:49395 | 51 | 710248035 | 750319193 | 848095316 | 754879685 | 49395 | SRX6434716 | SRS5089275 | SRA920248 | GEO | Burgess, NHGRI, NIH | 1 | 0.01137 | 0.00151 | 0.99527 | 0.69096 | 51 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | unknown | bulk | bulk | bulk | United States | 2019-07-12 | Larval | Larval | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 57067 | 57067 | SRR11214402 | SRX7826914 | SRS6238049 | SRP251256 | PRJNA609696 | Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq] | GSE146200 | Transcriptome Analysis | Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total. | parent bioproject:PRJNA609691 | pubmed:28962522 | JD18 [miRNA seq] | GSM4368082 | source name:30 pooled larvae 5dpf triptolide for 6 h|strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA | JD18 [miRNA seq] | The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence. | 30 pooled larvae 5dpf triptolide for 6 h | 5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | Zebrafish Danio rerio were maintained at 28.5 °C | strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA | GSM4368082 | GSM4368082: JD18 [miRNA seq]; Danio rerio; ncRNA Seq | GSM4368082 | 1 | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | GEO Accession:GSM4368082 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 550 | SRP251256 | small_JD18.combined.fastq.gz | fastq | 702201000.0 | 14044020.0 | GSM4368082 r1 | 0:50 1:0 | A:165610842;C:167169519;G:192886323;T:176528538;N:5778 | 50 | 0 | 165610842 | 167169519 | 192886323 | 176528538 | 5778 | SRX7826914 | SRS6238049 | SRA1049684 | GEO | Centre for Immunity, Infection and Evolution | 1 | 0.06331 | 0.00756 | 0.99153 | 0.5451 | 50 | B | usable mapping rate | illumina | nextseq | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2020-03-02 | Larval | Larval | Whole Organism | All anatomical structures | |||||||||||||||
| 57068 | 57068 | SRR11214401 | SRX7826913 | SRS6238048 | SRP251256 | PRJNA609696 | Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq] | GSE146200 | Transcriptome Analysis | Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total. | parent bioproject:PRJNA609691 | pubmed:28962522 | JD17 [miRNA seq] | GSM4368081 | source name:30 pooled larvae 5dpf triptolide for 6 h|strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA | JD17 [miRNA seq] | The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence. | 30 pooled larvae 5dpf triptolide for 6 h | 5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | Zebrafish Danio rerio were maintained at 28.5 °C | strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA | GSM4368081 | GSM4368081: JD17 [miRNA seq]; Danio rerio; ncRNA Seq | GSM4368081 | 1 | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | GEO Accession:GSM4368081 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 550 | SRP251256 | small_JD17.combined.fastq.gz | fastq | 429694400.0 | 8593888.0 | GSM4368081 r1 | 0:50 1:0 | A:105670449;C:101354858;G:115926173;T:106739304;N:3616 | 50 | 0 | 105670449 | 101354858 | 115926173 | 106739304 | 3616 | SRX7826913 | SRS6238048 | SRA1049684 | GEO | Centre for Immunity, Infection and Evolution | 1 | 0.04686 | 0.00437 | 0.99389 | 0.53154 | 50 | B | usable mapping rate | illumina | nextseq | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2020-03-02 | Larval | Larval | Whole Organism | All anatomical structures | |||||||||||||||
| 57069 | 57069 | SRR11214400 | SRX7826912 | SRS6238047 | SRP251256 | PRJNA609696 | Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq] | GSE146200 | Transcriptome Analysis | Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total. | parent bioproject:PRJNA609691 | pubmed:28962522 | JD16 [miRNA seq] | GSM4368080 | source name:30 pooled larvae 5dpf triptolide for 6 h|strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA | JD16 [miRNA seq] | The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence. | 30 pooled larvae 5dpf triptolide for 6 h | 5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | Zebrafish Danio rerio were maintained at 28.5 °C | strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA | GSM4368080 | GSM4368080: JD16 [miRNA seq]; Danio rerio; ncRNA Seq | GSM4368080 | 1 | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | GEO Accession:GSM4368080 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 550 | SRP251256 | small_JD16.combined.fastq.gz | fastq | 381826650.0 | 7636533.0 | GSM4368080 r1 | 0:50 1:0 | A:92578473;C:90665066;G:103254018;T:95325823;N:3270 | 50 | 0 | 92578473 | 90665066 | 103254018 | 95325823 | 3270 | SRX7826912 | SRS6238047 | SRA1049684 | GEO | Centre for Immunity, Infection and Evolution | 1 | 0.07185 | 0.00402 | 0.99419 | 0.49823 | 50 | B | usable mapping rate | illumina | nextseq | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2020-03-02 | Larval | Larval | Whole Organism | All anatomical structures | |||||||||||||||
| 57070 | 57070 | SRR11214399 | SRX7826911 | SRS6238046 | SRP251256 | PRJNA609696 | Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq] | GSE146200 | Transcriptome Analysis | Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total. | parent bioproject:PRJNA609691 | pubmed:28962522 | JD15 [miRNA seq] | GSM4368079 | source name:30 pooled larvae 5dpf triptolide for 6 h|strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA | JD15 [miRNA seq] | The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence. | 30 pooled larvae 5dpf triptolide for 6 h | 5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | Zebrafish Danio rerio were maintained at 28.5 °C | strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA | GSM4368079 | GSM4368079: JD15 [miRNA seq]; Danio rerio; ncRNA Seq | GSM4368079 | 1 | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | GEO Accession:GSM4368079 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 550 | SRP251256 | small_JD15.combined.fastq.gz | fastq | 285535900.0 | 5710718.0 | GSM4368079 r1 | 0:50 1:0 | A:68624024;C:67839672;G:77291276;T:71778522;N:2406 | 50 | 0 | 68624024 | 67839672 | 77291276 | 71778522 | 2406 | SRX7826911 | SRS6238046 | SRA1049684 | GEO | Centre for Immunity, Infection and Evolution | 1 | 0.07651 | 0.00425 | 0.99407 | 0.54635 | 50 | B | usable mapping rate | illumina | nextseq | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2020-03-02 | Larval | Larval | Whole Organism | All anatomical structures | |||||||||||||||
| 57071 | 57071 | SRR11214398 | SRX7826910 | SRS6238045 | SRP251256 | PRJNA609696 | Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq] | GSE146200 | Transcriptome Analysis | Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total. | parent bioproject:PRJNA609691 | pubmed:28962522 | JD14 [miRNA seq] | GSM4368078 | source name:30 pooled larvae 5dpf triptolide for 6 h|strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA | JD14 [miRNA seq] | The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence. | 30 pooled larvae 5dpf triptolide for 6 h | 5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | Zebrafish Danio rerio were maintained at 28.5 °C | strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA | GSM4368078 | GSM4368078: JD14 [miRNA seq]; Danio rerio; ncRNA Seq | GSM4368078 | 1 | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | GEO Accession:GSM4368078 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 550 | SRP251256 | small_JD14.combined.fastq.gz | fastq | 363231350.0 | 7264627.0 | GSM4368078 r1 | 0:50 1:0 | A:87298047;C:86511359;G:98123632;T:91295160;N:3152 | 50 | 0 | 87298047 | 86511359 | 98123632 | 91295160 | 3152 | SRX7826910 | SRS6238045 | SRA1049684 | GEO | Centre for Immunity, Infection and Evolution | 1 | 0.07156 | 0.00417 | 0.99314 | 0.49982 | 50 | B | usable mapping rate | illumina | nextseq | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2020-03-02 | Larval | Larval | Whole Organism | All anatomical structures | |||||||||||||||
| 57072 | 57072 | SRR11214397 | SRX7826909 | SRS6238044 | SRP251256 | PRJNA609696 | Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq] | GSE146200 | Transcriptome Analysis | Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total. | parent bioproject:PRJNA609691 | pubmed:28962522 | JD13 [miRNA seq] | GSM4368077 | source name:30 pooled larvae 5dpf triptolide for 6 h|strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA | JD13 [miRNA seq] | The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence. | 30 pooled larvae 5dpf triptolide for 6 h | 5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | Zebrafish Danio rerio were maintained at 28.5 °C | strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA | GSM4368077 | GSM4368077: JD13 [miRNA seq]; Danio rerio; ncRNA Seq | GSM4368077 | 1 | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | GEO Accession:GSM4368077 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 550 | SRP251256 | small_JD13.combined.fastq.gz | fastq | 280852650.0 | 5617053.0 | GSM4368077 r1 | 0:50 1:0 | A:66976453;C:66985314;G:76111707;T:70776819;N:2357 | 50 | 0 | 66976453 | 66985314 | 76111707 | 70776819 | 2357 | SRX7826909 | SRS6238044 | SRA1049684 | GEO | Centre for Immunity, Infection and Evolution | 1 | 0.0785 | 0.00403 | 0.99454 | 0.53818 | 50 | B | usable mapping rate | illumina | nextseq | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2020-03-02 | Larval | Larval | Whole Organism | All anatomical structures | |||||||||||||||
| 57073 | 57073 | SRR11214396 | SRX7826908 | SRS6238043 | SRP251256 | PRJNA609696 | Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq] | GSE146200 | Transcriptome Analysis | Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total. | parent bioproject:PRJNA609691 | pubmed:28962522 | JD12 [miRNA seq] | GSM4368076 | source name:30 pooled larvae 5dpf triptolide for 6 h|strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA | JD12 [miRNA seq] | The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence. | 30 pooled larvae 5dpf triptolide for 6 h | 5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | Zebrafish Danio rerio were maintained at 28.5 °C | strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA | GSM4368076 | GSM4368076: JD12 [miRNA seq]; Danio rerio; ncRNA Seq | GSM4368076 | 1 | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | GEO Accession:GSM4368076 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 550 | SRP251256 | small_JD12.combined.fastq.gz | fastq | 267278950.0 | 5345579.0 | GSM4368076 r1 | 0:50 1:0 | A:63524573;C:63700392;G:72574389;T:67477407;N:2189 | 50 | 0 | 63524573 | 63700392 | 72574389 | 67477407 | 2189 | SRX7826908 | SRS6238043 | SRA1049684 | GEO | Centre for Immunity, Infection and Evolution | 1 | 0.0867 | 0.00429 | 0.99403 | 0.53048 | 50 | B | usable mapping rate | illumina | nextseq | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2020-03-02 | Larval | Larval | Whole Organism | All anatomical structures | |||||||||||||||
| 57074 | 57074 | SRR11214395 | SRX7826907 | SRS6238042 | SRP251256 | PRJNA609696 | Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq] | GSE146200 | Transcriptome Analysis | Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total. | parent bioproject:PRJNA609691 | pubmed:28962522 | JD11 [miRNA seq] | GSM4368075 | source name:30 pooled larvae 5dpf triptolide for 6 h|strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA | JD11 [miRNA seq] | The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence. | 30 pooled larvae 5dpf triptolide for 6 h | 5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | Zebrafish Danio rerio were maintained at 28.5 °C | strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA | GSM4368075 | GSM4368075: JD11 [miRNA seq]; Danio rerio; ncRNA Seq | GSM4368075 | 1 | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | GEO Accession:GSM4368075 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 550 | SRP251256 | small_JD11.combined.fastq.gz | fastq | 323802250.0 | 6476045.0 | GSM4368075 r1 | 0:50 1:0 | A:78153815;C:77052322;G:87557986;T:81035226;N:2901 | 50 | 0 | 78153815 | 77052322 | 87557986 | 81035226 | 2901 | SRX7826907 | SRS6238042 | SRA1049684 | GEO | Centre for Immunity, Infection and Evolution | 1 | 0.06809 | 0.00424 | 0.99368 | 0.52229 | 50 | B | usable mapping rate | illumina | nextseq | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2020-03-02 | Larval | Larval | Whole Organism | All anatomical structures | |||||||||||||||
| 57075 | 57075 | SRR11214394 | SRX7826906 | SRS6238041 | SRP251256 | PRJNA609696 | Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq] | GSE146200 | Transcriptome Analysis | Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total. | parent bioproject:PRJNA609691 | pubmed:28962522 | JD08 [miRNA seq] | GSM4368074 | source name:30 pooled larvae 5dpf vehicle|strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA | JD08 [miRNA seq] | The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence. | 30 pooled larvae 5dpf vehicle | 5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | Zebrafish Danio rerio were maintained at 28.5 °C | strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA | GSM4368074 | GSM4368074: JD08 [miRNA seq]; Danio rerio; ncRNA Seq | GSM4368074 | 1 | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | GEO Accession:GSM4368074 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 550 | SRP251256 | small_JD08.combined.fastq.gz | fastq | 375132100.0 | 7502642.0 | GSM4368074 r1 | 0:50 1:0 | A:89764502;C:89300619;G:101501695;T:94562105;N:3179 | 50 | 0 | 89764502 | 89300619 | 101501695 | 94562105 | 3179 | SRX7826906 | SRS6238041 | SRA1049684 | GEO | Centre for Immunity, Infection and Evolution | 1 | 0.07787 | 0.0042 | 0.99338 | 0.52599 | 50 | B | usable mapping rate | illumina | nextseq | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2020-03-02 | Larval | Larval | Whole Organism | All anatomical structures | |||||||||||||||
| 57076 | 57076 | SRR11214393 | SRX7826905 | SRS6238040 | SRP251256 | PRJNA609696 | Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq] | GSE146200 | Transcriptome Analysis | Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total. | parent bioproject:PRJNA609691 | pubmed:28962522 | JD07 [miRNA seq] | GSM4368073 | source name:30 pooled larvae 5dpf vehicle|strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA | JD07 [miRNA seq] | The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence. | 30 pooled larvae 5dpf vehicle | 5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | Zebrafish Danio rerio were maintained at 28.5 °C | strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA | GSM4368073 | GSM4368073: JD07 [miRNA seq]; Danio rerio; ncRNA Seq | GSM4368073 | 1 | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | GEO Accession:GSM4368073 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 550 | SRP251256 | small_JD07.combined.fastq.gz | fastq | 317528050.0 | 6350561.0 | GSM4368073 r1 | 0:50 1:0 | A:75643339;C:75642242;G:86133220;T:80106532;N:2717 | 50 | 0 | 75643339 | 75642242 | 86133220 | 80106532 | 2717 | SRX7826905 | SRS6238040 | SRA1049684 | GEO | Centre for Immunity, Infection and Evolution | 1 | 0.07711 | 0.00424 | 0.9934 | 0.53196 | 50 | B | usable mapping rate | illumina | nextseq | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2020-03-02 | Larval | Larval | Whole Organism | All anatomical structures | |||||||||||||||
| 57077 | 57077 | SRR11214392 | SRX7826904 | SRS6238039 | SRP251256 | PRJNA609696 | Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq] | GSE146200 | Transcriptome Analysis | Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total. | parent bioproject:PRJNA609691 | pubmed:28962522 | JD06 [miRNA seq] | GSM4368072 | source name:30 pooled larvae 5dpf vehicle|strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA | JD06 [miRNA seq] | The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence. | 30 pooled larvae 5dpf vehicle | 5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | Zebrafish Danio rerio were maintained at 28.5 °C | strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA | GSM4368072 | GSM4368072: JD06 [miRNA seq]; Danio rerio; ncRNA Seq | GSM4368072 | 1 | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | GEO Accession:GSM4368072 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 550 | SRP251256 | small_JD06.combined.fastq.gz | fastq | 313235150.0 | 6264703.0 | GSM4368072 r1 | 0:50 1:0 | A:74970317;C:74745173;G:84767516;T:78749342;N:2802 | 50 | 0 | 74970317 | 74745173 | 84767516 | 78749342 | 2802 | SRX7826904 | SRS6238039 | SRA1049684 | GEO | Centre for Immunity, Infection and Evolution | 1 | 0.07206 | 0.00403 | 0.99312 | 0.52846 | 50 | B | usable mapping rate | illumina | nextseq | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2020-03-02 | Larval | Larval | Whole Organism | All anatomical structures | |||||||||||||||
| 57078 | 57078 | SRR11214391 | SRX7826903 | SRS6238038 | SRP251256 | PRJNA609696 | Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq] | GSE146200 | Transcriptome Analysis | Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total. | parent bioproject:PRJNA609691 | pubmed:28962522 | JD05 [miRNA seq] | GSM4368071 | source name:30 pooled larvae 5dpf vehicle|strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA | JD05 [miRNA seq] | The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence. | 30 pooled larvae 5dpf vehicle | 5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | Zebrafish Danio rerio were maintained at 28.5 °C | strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA | GSM4368071 | GSM4368071: JD05 [miRNA seq]; Danio rerio; ncRNA Seq | GSM4368071 | 1 | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | GEO Accession:GSM4368071 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 550 | SRP251256 | small_JD05.combined.fastq.gz | fastq | 282608400.0 | 5652168.0 | GSM4368071 r1 | 0:50 1:0 | A:67639670;C:67139768;G:76678815;T:71147790;N:2357 | 50 | 0 | 67639670 | 67139768 | 76678815 | 71147790 | 2357 | SRX7826903 | SRS6238038 | SRA1049684 | GEO | Centre for Immunity, Infection and Evolution | 1 | 0.07587 | 0.00384 | 0.99299 | 0.5434 | 50 | B | usable mapping rate | illumina | nextseq | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2020-03-02 | Larval | Larval | Whole Organism | All anatomical structures | |||||||||||||||
| 57079 | 57079 | SRR11214390 | SRX7826902 | SRS6238037 | SRP251256 | PRJNA609696 | Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq] | GSE146200 | Transcriptome Analysis | Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total. | parent bioproject:PRJNA609691 | pubmed:28962522 | JD04 [miRNA seq] | GSM4368070 | source name:30 pooled larvae 5dpf vehicle|strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA | JD04 [miRNA seq] | The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence. | 30 pooled larvae 5dpf vehicle | 5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | Zebrafish Danio rerio were maintained at 28.5 °C | strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA | GSM4368070 | GSM4368070: JD04 [miRNA seq]; Danio rerio; ncRNA Seq | GSM4368070 | 1 | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | GEO Accession:GSM4368070 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 550 | SRP251256 | small_JD04.combined.fastq.gz | fastq | 289767100.0 | 5795342.0 | GSM4368070 r1 | 0:50 1:0 | A:69580978;C:68900579;G:78340509;T:72942639;N:2395 | 50 | 0 | 69580978 | 68900579 | 78340509 | 72942639 | 2395 | SRX7826902 | SRS6238037 | SRA1049684 | GEO | Centre for Immunity, Infection and Evolution | 1 | 0.07492 | 0.00373 | 0.99295 | 0.52294 | 50 | B | usable mapping rate | illumina | nextseq | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2020-03-02 | Larval | Larval | Whole Organism | All anatomical structures | |||||||||||||||
| 57080 | 57080 | SRR11214389 | SRX7826901 | SRS6238036 | SRP251256 | PRJNA609696 | Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq] | GSE146200 | Transcriptome Analysis | Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total. | parent bioproject:PRJNA609691 | pubmed:28962522 | JD03 [miRNA seq] | GSM4368069 | source name:30 pooled larvae 5dpf vehicle|strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA | JD03 [miRNA seq] | The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence. | 30 pooled larvae 5dpf vehicle | 5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | Zebrafish Danio rerio were maintained at 28.5 °C | strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA | GSM4368069 | GSM4368069: JD03 [miRNA seq]; Danio rerio; ncRNA Seq | GSM4368069 | 1 | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | GEO Accession:GSM4368069 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 550 | SRP251256 | small_JD03.combined.fastq.gz | fastq | 230982600.0 | 4619652.0 | GSM4368069 r1 | 0:50 1:0 | A:55200177;C:55003182;G:62615802;T:58161510;N:1929 | 50 | 0 | 55200177 | 55003182 | 62615802 | 58161510 | 1929 | SRX7826901 | SRS6238036 | SRA1049684 | GEO | Centre for Immunity, Infection and Evolution | 1 | 0.07179 | 0.00361 | 0.99336 | 0.47352 | 50 | B | usable mapping rate | illumina | nextseq | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2020-03-02 | Larval | Larval | Whole Organism | All anatomical structures | |||||||||||||||
| 57081 | 57081 | SRR11214388 | SRX7826900 | SRS6238035 | SRP251256 | PRJNA609696 | Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq] | GSE146200 | Transcriptome Analysis | Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total. | parent bioproject:PRJNA609691 | pubmed:28962522 | JD02 [miRNA seq] | GSM4368068 | source name:30 pooled larvae 5dpf vehicle|strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA | JD02 [miRNA seq] | The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence. | 30 pooled larvae 5dpf vehicle | 5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | Zebrafish Danio rerio were maintained at 28.5 °C | strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA | GSM4368068 | GSM4368068: JD02 [miRNA seq]; Danio rerio; ncRNA Seq | GSM4368068 | 1 | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | GEO Accession:GSM4368068 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 550 | SRP251256 | small_JD02.combined.fastq.gz | fastq | 367984500.0 | 7359690.0 | GSM4368068 r1 | 0:50 1:0 | A:87859797;C:87548819;G:99752643;T:92820007;N:3234 | 50 | 0 | 87859797 | 87548819 | 99752643 | 92820007 | 3234 | SRX7826900 | SRS6238035 | SRA1049684 | GEO | Centre for Immunity, Infection and Evolution | 1 | 0.07619 | 0.00398 | 0.99403 | 0.53717 | 50 | B | usable mapping rate | illumina | nextseq | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2020-03-02 | Larval | Larval | Whole Organism | All anatomical structures | |||||||||||||||
| 57082 | 57082 | SRR11214387 | SRX7826899 | SRS6238034 | SRP251256 | PRJNA609696 | Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq] | GSE146200 | Transcriptome Analysis | Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total. | parent bioproject:PRJNA609691 | pubmed:28962522 | JD01 [miRNA seq] | GSM4368067 | source name:30 pooled larvae 5dpf vehicle|strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA | JD01 [miRNA seq] | The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence. | 30 pooled larvae 5dpf vehicle | 5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | Zebrafish Danio rerio were maintained at 28.5 °C | strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA | GSM4368067 | GSM4368067: JD01 [miRNA seq]; Danio rerio; ncRNA Seq | GSM4368067 | 1 | Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer. | GEO Accession:GSM4368067 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 550 | SRP251256 | small_JD01.combined.fastq.gz | fastq | 374941900.0 | 7498838.0 | GSM4368067 r1 | 0:50 1:0 | A:90013932;C:89307034;G:101275933;T:94341753;N:3248 | 50 | 0 | 90013932 | 89307034 | 101275933 | 94341753 | 3248 | SRX7826899 | SRS6238034 | SRA1049684 | GEO | Centre for Immunity, Infection and Evolution | 1 | 0.07456 | 0.00386 | 0.99399 | 0.52664 | 50 | B | usable mapping rate | illumina | nextseq | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2020-03-02 | Larval | Larval | Whole Organism | All anatomical structures | |||||||||||||||
| 63643 | 63643 | SRR13979112 | SRX10356673 | SRS8474629 | SRP310924 | PRJNA714931 | Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks | GSE169013 | Transcriptome Analysis | Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con… | pubmed:33898466 | miRNA TiBP rep4 | GSM5174052 | tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf | miRNA TiBP rep4 | For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample | zebrafish whole embryos | Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf. | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | strain:5D|developmental stage:48 hpf | GSM5174052 | GSM5174052: miRNA TiBP rep4; Danio rerio; miRNA Seq | GSM5174052 | 1 | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | GEO Accession:GSM5174052 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP310924 | miRNA_lane1-s028-indexRPI28-CAAAAG-52_S28_L001_R1_001.fastq.gz | fastq | 910334614.0 | 9013214.0 | GSM5174052 r1 | 0:101 1:0 | A:290447743;C:219962173;G:188092578;T:211816048;N:16072 | 101 | 0 | 290447743 | 219962173 | 188092578 | 211816048 | 16072 | SRX10356673 | SRS8474629 | SRA1207022 | GEO | Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University | 1 | 0.00011 | 0.0 | 0.99967 | 0.75 | 101 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2021-03-16 | Hatching | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 63644 | 63644 | SRR13979111 | SRX10356672 | SRS8474628 | SRP310924 | PRJNA714931 | Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks | GSE169013 | Transcriptome Analysis | Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con… | pubmed:33898466 | miRNA TiBP rep3 | GSM5174051 | tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf | miRNA TiBP rep3 | For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample | zebrafish whole embryos | Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf. | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | strain:5D|developmental stage:48 hpf | GSM5174051 | GSM5174051: miRNA TiBP rep3; Danio rerio; miRNA Seq | GSM5174051 | 1 | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | GEO Accession:GSM5174051 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP310924 | miRNA_lane1-s027-indexRPI27-ATTCCT-51_S27_L001_R1_001.fastq.gz | fastq | 1206610034.0 | 11946634.0 | GSM5174051 r1 | 0:101 1:0 | A:350061820;C:302802434;G:235521116;T:318199102;N:25562 | 101 | 0 | 350061820 | 302802434 | 235521116 | 318199102 | 25562 | SRX10356672 | SRS8474628 | SRA1207022 | GEO | Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University | 1 | 0.00013 | 0.0 | 0.99965 | 0.79166 | 101 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2021-03-16 | Hatching | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 63645 | 63645 | SRR13979110 | SRX10356671 | SRS8474626 | SRP310924 | PRJNA714931 | Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks | GSE169013 | Transcriptome Analysis | Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con… | pubmed:33898466 | miRNA TiBP rep2 | GSM5174050 | tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf | miRNA TiBP rep2 | For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample | zebrafish whole embryos | Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf. | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | strain:5D|developmental stage:48 hpf | GSM5174050 | GSM5174050: miRNA TiBP rep2; Danio rerio; miRNA Seq | GSM5174050 | 1 | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | GEO Accession:GSM5174050 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP310924 | miRNA_lane1-s026-indexRPI26-ATGAGC-50_S26_L001_R1_001.fastq.gz | fastq | 464537279.0 | 4599379.0 | GSM5174050 r1 | 0:101 1:0 | A:139497834;C:112216637;G:99887123;T:112926329;N:9356 | 101 | 0 | 139497834 | 112216637 | 99887123 | 112926329 | 9356 | SRX10356671 | SRS8474626 | SRA1207022 | GEO | Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University | 1 | 0.00022 | 1e-05 | 0.99955 | 0.61538 | 101 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2021-03-16 | Hatching | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 63646 | 63646 | SRR13979109 | SRX10356670 | SRS8474627 | SRP310924 | PRJNA714931 | Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks | GSE169013 | Transcriptome Analysis | Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con… | pubmed:33898466 | miRNA TiBP rep1 | GSM5174049 | tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf | miRNA TiBP rep1 | For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample | zebrafish whole embryos | Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf. | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | strain:5D|developmental stage:48 hpf | GSM5174049 | GSM5174049: miRNA TiBP rep1; Danio rerio; miRNA Seq | GSM5174049 | 1 | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | GEO Accession:GSM5174049 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP310924 | miRNA_lane1-s025-indexRPI25-ACTGAT-49_S25_L001_R1_001.fastq.gz | fastq | 1146926508.0 | 11355708.0 | GSM5174049 r1 | 0:101 1:0 | A:344954395;C:275566512;G:235491109;T:290891698;N:22794 | 101 | 0 | 344954395 | 275566512 | 235491109 | 290891698 | 22794 | SRX10356670 | SRS8474627 | SRA1207022 | GEO | Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University | 1 | 0.00019 | 1e-05 | 0.99965 | 0.71875 | 101 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2021-03-16 | Hatching | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 63647 | 63647 | SRR13979108 | SRX10356669 | SRS8474625 | SRP310924 | PRJNA714931 | Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks | GSE169013 | Transcriptome Analysis | Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con… | pubmed:33898466 | miRNA TPP rep4 | GSM5174048 | tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf | miRNA TPP rep4 | For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample | zebrafish whole embryos | Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf. | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | strain:5D|developmental stage:48 hpf | GSM5174048 | GSM5174048: miRNA TPP rep4; Danio rerio; miRNA Seq | GSM5174048 | 1 | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | GEO Accession:GSM5174048 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP310924 | miRNA_lane1-s036-indexRPI36-CCAACA-60_S36_L001_R1_001.fastq.gz | fastq | 927517340.0 | 9183340.0 | GSM5174048 r1 | 0:101 1:0 | A:288988916;C:242744912;G:181427113;T:214337769;N:18630 | 101 | 0 | 288988916 | 242744912 | 181427113 | 214337769 | 18630 | SRX10356669 | SRS8474625 | SRA1207022 | GEO | Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University | 1 | 0.00023 | 1e-05 | 0.99955 | 0.70731 | 101 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2021-03-16 | Hatching | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 63648 | 63648 | SRR13979107 | SRX10356668 | SRS8474624 | SRP310924 | PRJNA714931 | Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks | GSE169013 | Transcriptome Analysis | Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con… | pubmed:33898466 | miRNA TPP rep3 | GSM5174047 | tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf | miRNA TPP rep3 | For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample | zebrafish whole embryos | Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf. | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | strain:5D|developmental stage:48 hpf | GSM5174047 | GSM5174047: miRNA TPP rep3; Danio rerio; miRNA Seq | GSM5174047 | 1 | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | GEO Accession:GSM5174047 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP310924 | miRNA_lane1-s035-indexRPI35-CATTTT-59_S35_L001_R1_001.fastq.gz | fastq | 1013252907.0 | 10032207.0 | GSM5174047 r1 | 0:101 1:0 | A:295518831;C:243561888;G:197719671;T:276430583;N:21934 | 101 | 0 | 295518831 | 243561888 | 197719671 | 276430583 | 21934 | SRX10356668 | SRS8474624 | SRA1207022 | GEO | Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University | 1 | 0.00013 | 0.0 | 0.99973 | 0.48 | 101 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2021-03-16 | Hatching | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 63649 | 63649 | SRR13979106 | SRX10356667 | SRS8474623 | SRP310924 | PRJNA714931 | Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks | GSE169013 | Transcriptome Analysis | Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con… | pubmed:33898466 | miRNA TPP rep2 | GSM5174046 | tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf | miRNA TPP rep2 | For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample | zebrafish whole embryos | Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf. | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | strain:5D|developmental stage:48 hpf | GSM5174046 | GSM5174046: miRNA TPP rep2; Danio rerio; miRNA Seq | GSM5174046 | 1 | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | GEO Accession:GSM5174046 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP310924 | miRNA_lane1-s034-indexRPI34-CATGGC-58_S34_L001_R1_001.fastq.gz | fastq | 907210381.0 | 8982281.0 | GSM5174046 r1 | 0:101 1:0 | A:265012714;C:227793861;G:194928689;T:219454152;N:20965 | 101 | 0 | 265012714 | 227793861 | 194928689 | 219454152 | 20965 | SRX10356667 | SRS8474623 | SRA1207022 | GEO | Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University | 1 | 0.00013 | 0.0 | 0.99965 | 0.875 | 101 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2021-03-16 | Hatching | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 63650 | 63650 | SRR13979105 | SRX10356666 | SRS8474622 | SRP310924 | PRJNA714931 | Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks | GSE169013 | Transcriptome Analysis | Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con… | pubmed:33898466 | miRNA TPP rep1 | GSM5174045 | tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf | miRNA TPP rep1 | For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample | zebrafish whole embryos | Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf. | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | strain:5D|developmental stage:48 hpf | GSM5174045 | GSM5174045: miRNA TPP rep1; Danio rerio; miRNA Seq | GSM5174045 | 1 | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | GEO Accession:GSM5174045 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP310924 | miRNA_lane1-s033-indexRPI33-CAGGCG-57_S33_L001_R1_001.fastq.gz | fastq | 980681013.0 | 9709713.0 | GSM5174045 r1 | 0:101 1:0 | A:286952877;C:245397809;G:220787030;T:227522023;N:21274 | 101 | 0 | 286952877 | 245397809 | 220787030 | 227522023 | 21274 | SRX10356666 | SRS8474622 | SRA1207022 | GEO | Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University | 1 | 0.00021 | 1e-05 | 0.99961 | 0.72222 | 101 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2021-03-16 | Hatching | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 63651 | 63651 | SRR13979104 | SRX10356665 | SRS8474621 | SRP310924 | PRJNA714931 | Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks | GSE169013 | Transcriptome Analysis | Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con… | pubmed:33898466 | miRNA TBPH rep4 | GSM5174044 | tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf | miRNA TBPH rep4 | For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample | zebrafish whole embryos | Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf. | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | strain:5D|developmental stage:48 hpf | GSM5174044 | GSM5174044: miRNA TBPH rep4; Danio rerio; miRNA Seq | GSM5174044 | 1 | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | GEO Accession:GSM5174044 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP310924 | miRNA_lane1-s012-indexRPI12-CTTGTA-24_S12_L001_R1_001.fastq.gz | fastq | 879997850.0 | 8712850.0 | GSM5174044 r1 | 0:101 1:0 | A:257202916;C:211754629;G:179803383;T:231218549;N:18373 | 101 | 0 | 257202916 | 211754629 | 179803383 | 231218549 | 18373 | SRX10356665 | SRS8474621 | SRA1207022 | GEO | Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University | 1 | 0.00022 | 0.0 | 0.99961 | 0.55 | 101 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2021-03-16 | Hatching | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 63652 | 63652 | SRR13979103 | SRX10356664 | SRS8474620 | SRP310924 | PRJNA714931 | Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks | GSE169013 | Transcriptome Analysis | Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con… | pubmed:33898466 | miRNA TBPH rep3 | GSM5174043 | tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf | miRNA TBPH rep3 | For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample | zebrafish whole embryos | Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf. | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | strain:5D|developmental stage:48 hpf | GSM5174043 | GSM5174043: miRNA TBPH rep3; Danio rerio; miRNA Seq | GSM5174043 | 1 | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | GEO Accession:GSM5174043 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP310924 | miRNA_lane1-s011-indexRPI11-GGCTAC-23_S11_L001_R1_001.fastq.gz | fastq | 883707883.0 | 8749583.0 | GSM5174043 r1 | 0:101 1:0 | A:256575313;C:222504855;G:189827000;T:214781797;N:18918 | 101 | 0 | 256575313 | 222504855 | 189827000 | 214781797 | 18918 | SRX10356664 | SRS8474620 | SRA1207022 | GEO | Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University | 1 | 0.00021 | 0.0 | 0.99961 | 0.725 | 101 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2021-03-16 | Hatching | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 63653 | 63653 | SRR13979102 | SRX10356663 | SRS8474619 | SRP310924 | PRJNA714931 | Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks | GSE169013 | Transcriptome Analysis | Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con… | pubmed:33898466 | miRNA TBPH rep2 | GSM5174042 | tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf | miRNA TBPH rep2 | For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample | zebrafish whole embryos | Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf. | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | strain:5D|developmental stage:48 hpf | GSM5174042 | GSM5174042: miRNA TBPH rep2; Danio rerio; miRNA Seq | GSM5174042 | 1 | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | GEO Accession:GSM5174042 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP310924 | miRNA_lane1-s010-indexRPI10-TAGCTT-22_S10_L001_R1_001.fastq.gz | fastq | 727499667.0 | 7202967.0 | GSM5174042 r1 | 0:101 1:0 | A:212029291;C:175832603;G:148851978;T:190770471;N:15324 | 101 | 0 | 212029291 | 175832603 | 148851978 | 190770471 | 15324 | SRX10356663 | SRS8474619 | SRA1207022 | GEO | Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University | 1 | 0.00025 | 1e-05 | 0.99951 | 0.68181 | 101 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2021-03-16 | Hatching | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 63654 | 63654 | SRR13979101 | SRX10356662 | SRS8474618 | SRP310924 | PRJNA714931 | Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks | GSE169013 | Transcriptome Analysis | Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con… | pubmed:33898466 | miRNA TBPH rep1 | GSM5174041 | tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf | miRNA TBPH rep1 | For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample | zebrafish whole embryos | Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf. | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | strain:5D|developmental stage:48 hpf | GSM5174041 | GSM5174041: miRNA TBPH rep1; Danio rerio; miRNA Seq | GSM5174041 | 1 | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | GEO Accession:GSM5174041 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP310924 | miRNA_lane1-s009-indexRPI9-GATCAG-21_S9_L001_R1_001.fastq.gz | fastq | 351322743.0 | 3478443.0 | GSM5174041 r1 | 0:101 1:0 | A:105338110;C:85172820;G:75749691;T:85054964;N:7158 | 101 | 0 | 105338110 | 85172820 | 75749691 | 85054964 | 7158 | SRX10356662 | SRS8474618 | SRA1207022 | GEO | Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University | 1 | 0.00036 | 1e-05 | 0.99953 | 0.52238 | 101 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2021-03-16 | Hatching | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 63655 | 63655 | SRR13979100 | SRX10356661 | SRS8474616 | SRP310924 | PRJNA714931 | Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks | GSE169013 | Transcriptome Analysis | Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con… | pubmed:33898466 | miRNA TCEP rep4 | GSM5174040 | tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf | miRNA TCEP rep4 | For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample | zebrafish whole embryos | Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf. | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | strain:5D|developmental stage:48 hpf | GSM5174040 | GSM5174040: miRNA TCEP rep4; Danio rerio; miRNA Seq | GSM5174040 | 1 | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | GEO Accession:GSM5174040 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP310924 | miRNA_lane1-s044-indexRPI44-TATAAT-72_S44_L001_R1_001.fastq.gz | fastq | 904258656.0 | 8953056.0 | GSM5174040 r1 | 0:101 1:0 | A:282578101;C:207780974;G:175938229;T:237943510;N:17842 | 101 | 0 | 282578101 | 207780974 | 175938229 | 237943510 | 17842 | SRX10356661 | SRS8474616 | SRA1207022 | GEO | Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University | 1 | 0.0002 | 0.0 | 0.99951 | 0.72972 | 101 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2021-03-16 | Hatching | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 63656 | 63656 | SRR13979099 | SRX10356660 | SRS8474615 | SRP310924 | PRJNA714931 | Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks | GSE169013 | Transcriptome Analysis | Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con… | pubmed:33898466 | miRNA TCEP rep3 | GSM5174039 | tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf | miRNA TCEP rep3 | For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample | zebrafish whole embryos | Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf. | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | strain:5D|developmental stage:48 hpf | GSM5174039 | GSM5174039: miRNA TCEP rep3; Danio rerio; miRNA Seq | GSM5174039 | 1 | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | GEO Accession:GSM5174039 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP310924 | miRNA_lane1-s043-indexRPI43-TACAGC-71_S43_L001_R1_001.fastq.gz | fastq | 908098777.0 | 8991077.0 | GSM5174039 r1 | 0:101 1:0 | A:274350569;C:227463819;G:185316266;T:220948697;N:19426 | 101 | 0 | 274350569 | 227463819 | 185316266 | 220948697 | 19426 | SRX10356660 | SRS8474615 | SRA1207022 | GEO | Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University | 1 | 0.00015 | 0.0 | 0.99965 | 0.57142 | 101 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2021-03-16 | Hatching | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 63657 | 63657 | SRR13979098 | SRX10356659 | SRS8474617 | SRP310924 | PRJNA714931 | Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks | GSE169013 | Transcriptome Analysis | Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con… | pubmed:33898466 | miRNA TCEP rep2 | GSM5174038 | tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf | miRNA TCEP rep2 | For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample | zebrafish whole embryos | Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf. | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | strain:5D|developmental stage:48 hpf | GSM5174038 | GSM5174038: miRNA TCEP rep2; Danio rerio; miRNA Seq | GSM5174038 | 1 | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | GEO Accession:GSM5174038 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP310924 | miRNA_lane1-s042-indexRPI42-TAATCG-70_S42_L001_R1_001.fastq.gz | fastq | 738320403.0 | 7310103.0 | GSM5174038 r1 | 0:101 1:0 | A:221107544;C:178181142;G:152128298;T:186889068;N:14351 | 101 | 0 | 221107544 | 178181142 | 152128298 | 186889068 | 14351 | SRX10356659 | SRS8474617 | SRA1207022 | GEO | Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University | 1 | 0.00017 | 0.0 | 0.99965 | 0.59375 | 101 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2021-03-16 | Hatching | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 63658 | 63658 | SRR13979097 | SRX10356658 | SRS8474612 | SRP310924 | PRJNA714931 | Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks | GSE169013 | Transcriptome Analysis | Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con… | pubmed:33898466 | miRNA TCEP rep1 | GSM5174037 | tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf | miRNA TCEP rep1 | For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample | zebrafish whole embryos | Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf. | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | strain:5D|developmental stage:48 hpf | GSM5174037 | GSM5174037: miRNA TCEP rep1; Danio rerio; miRNA Seq | GSM5174037 | 1 | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | GEO Accession:GSM5174037 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP310924 | miRNA_lane1-s041-indexRPI41-GACGAC-69_S41_L001_R1_001.fastq.gz | fastq | 470221761.0 | 4655661.0 | GSM5174037 r1 | 0:101 1:0 | A:142688200;C:117856681;G:100380615;T:109286679;N:9586 | 101 | 0 | 142688200 | 117856681 | 100380615 | 109286679 | 9586 | SRX10356658 | SRS8474612 | SRA1207022 | GEO | Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University | 1 | 0.00028 | 1e-05 | 0.99951 | 0.66666 | 101 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2021-03-16 | Hatching | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 63659 | 63659 | SRR13979096 | SRX10356657 | SRS8474613 | SRP310924 | PRJNA714931 | Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks | GSE169013 | Transcriptome Analysis | Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con… | pubmed:33898466 | miRNA TDBPP rep4 | GSM5174036 | tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf | miRNA TDBPP rep4 | For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample | zebrafish whole embryos | Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf. | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | strain:5D|developmental stage:48 hpf | GSM5174036 | GSM5174036: miRNA TDBPP rep4; Danio rerio; miRNA Seq | GSM5174036 | 1 | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | GEO Accession:GSM5174036 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP310924 | miRNA_lane1-s024-indexRPI24-GGTAGC-48_S24_L001_R1_001.fastq.gz | fastq | 889897668.0 | 8810868.0 | GSM5174036 r1 | 0:101 1:0 | A:253810688;C:216798740;G:203615337;T:215653771;N:19132 | 101 | 0 | 253810688 | 216798740 | 203615337 | 215653771 | 19132 | SRX10356657 | SRS8474613 | SRA1207022 | GEO | Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University | 1 | 0.00019 | 0.0 | 0.99963 | 0.41176 | 101 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2021-03-16 | Hatching | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 63660 | 63660 | SRR13979095 | SRX10356656 | SRS8474614 | SRP310924 | PRJNA714931 | Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks | GSE169013 | Transcriptome Analysis | Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con… | pubmed:33898466 | miRNA TDBPP rep3 | GSM5174035 | tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf | miRNA TDBPP rep3 | For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample | zebrafish whole embryos | Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf. | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | strain:5D|developmental stage:48 hpf | GSM5174035 | GSM5174035: miRNA TDBPP rep3; Danio rerio; miRNA Seq | GSM5174035 | 1 | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | GEO Accession:GSM5174035 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP310924 | miRNA_lane1-s023-indexRPI23-GAGTGG-47_S23_L001_R1_001.fastq.gz | fastq | 528666623.0 | 5234323.0 | GSM5174035 r1 | 0:101 1:0 | A:145917522;C:125201606;G:128827845;T:128709318;N:10332 | 101 | 0 | 145917522 | 125201606 | 128827845 | 128709318 | 10332 | SRX10356656 | SRS8474614 | SRA1207022 | GEO | Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University | 1 | 0.00024 | 0.0 | 0.99961 | 0.56818 | 101 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2021-03-16 | Hatching | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 63661 | 63661 | SRR13979094 | SRX10356655 | SRS8474609 | SRP310924 | PRJNA714931 | Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks | GSE169013 | Transcriptome Analysis | Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con… | pubmed:33898466 | miRNA TDBPP rep2 | GSM5174034 | tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf | miRNA TDBPP rep2 | For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample | zebrafish whole embryos | Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf. | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | strain:5D|developmental stage:48 hpf | GSM5174034 | GSM5174034: miRNA TDBPP rep2; Danio rerio; miRNA Seq | GSM5174034 | 1 | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | GEO Accession:GSM5174034 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP310924 | miRNA_lane1-s022-indexRPI22-CGTACG-46_S22_L001_R1_001.fastq.gz | fastq | 906963537.0 | 8979837.0 | GSM5174034 r1 | 0:101 1:0 | A:246251307;C:236436405;G:206539134;T:217717657;N:19034 | 101 | 0 | 246251307 | 236436405 | 206539134 | 217717657 | 19034 | SRX10356655 | SRS8474609 | SRA1207022 | GEO | Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University | 1 | 0.00015 | 0.0 | 0.99967 | 0.65384 | 101 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2021-03-16 | Hatching | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 63662 | 63662 | SRR13979093 | SRX10356654 | SRS8474611 | SRP310924 | PRJNA714931 | Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks | GSE169013 | Transcriptome Analysis | Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con… | pubmed:33898466 | miRNA TDBPP rep1 | GSM5174033 | tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf | miRNA TDBPP rep1 | For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample | zebrafish whole embryos | Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf. | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | strain:5D|developmental stage:48 hpf | GSM5174033 | GSM5174033: miRNA TDBPP rep1; Danio rerio; miRNA Seq | GSM5174033 | 1 | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | GEO Accession:GSM5174033 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP310924 | miRNA_lane1-s021-indexRPI21-GTTTCG-45_S21_L001_R1_001.fastq.gz | fastq | 556898547.0 | 5513847.0 | GSM5174033 r1 | 0:101 1:0 | A:149304325;C:137357612;G:124103413;T:146121425;N:11772 | 101 | 0 | 149304325 | 137357612 | 124103413 | 146121425 | 11772 | SRX10356654 | SRS8474611 | SRA1207022 | GEO | Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University | 1 | 0.00021 | 0.0 | 0.99957 | 0.7027 | 101 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2021-03-16 | Hatching | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 63663 | 63663 | SRR13979092 | SRX10356653 | SRS8474610 | SRP310924 | PRJNA714931 | Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks | GSE169013 | Transcriptome Analysis | Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con… | pubmed:33898466 | miRNA TCPP rep4 | GSM5174032 | tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf | miRNA TCPP rep4 | For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample | zebrafish whole embryos | Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf. | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | strain:5D|developmental stage:48 hpf | GSM5174032 | GSM5174032: miRNA TCPP rep4; Danio rerio; miRNA Seq | GSM5174032 | 1 | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | GEO Accession:GSM5174032 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP310924 | miRNA_lane1-s016-indexRPI16-CCGTCC-28_S16_L001_R1_001.fastq.gz | fastq | 885697179.0 | 8769279.0 | GSM5174032 r1 | 0:101 1:0 | A:247836719;C:241737695;G:181087463;T:215012979;N:22323 | 101 | 0 | 247836719 | 241737695 | 181087463 | 215012979 | 22323 | SRX10356653 | SRS8474610 | SRA1207022 | GEO | Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University | 1 | 0.00019 | 0.0 | 0.99967 | 0.68571 | 101 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2021-03-16 | Hatching | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 63664 | 63664 | SRR13979091 | SRX10356652 | SRS8474608 | SRP310924 | PRJNA714931 | Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks | GSE169013 | Transcriptome Analysis | Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con… | pubmed:33898466 | miRNA TCPP rep3 | GSM5174031 | tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf | miRNA TCPP rep3 | For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample | zebrafish whole embryos | Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf. | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | strain:5D|developmental stage:48 hpf | GSM5174031 | GSM5174031: miRNA TCPP rep3; Danio rerio; miRNA Seq | GSM5174031 | 1 | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | GEO Accession:GSM5174031 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP310924 | miRNA_lane1-s015-indexRPI15-ATGTCA-27_S15_L001_R1_001.fastq.gz | fastq | 566510010.0 | 5609010.0 | GSM5174031 r1 | 0:101 1:0 | A:170383116;C:137048514;G:115945259;T:143122249;N:10872 | 101 | 0 | 170383116 | 137048514 | 115945259 | 143122249 | 10872 | SRX10356652 | SRS8474608 | SRA1207022 | GEO | Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University | 1 | 0.00025 | 0.0 | 0.99967 | 0.54347 | 101 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2021-03-16 | Hatching | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 63665 | 63665 | SRR13979090 | SRX10356651 | SRS8474607 | SRP310924 | PRJNA714931 | Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks | GSE169013 | Transcriptome Analysis | Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con… | pubmed:33898466 | miRNA TCPP rep2 | GSM5174030 | tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf | miRNA TCPP rep2 | For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample | zebrafish whole embryos | Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf. | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | strain:5D|developmental stage:48 hpf | GSM5174030 | GSM5174030: miRNA TCPP rep2; Danio rerio; miRNA Seq | GSM5174030 | 1 | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | GEO Accession:GSM5174030 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP310924 | miRNA_lane1-s014-indexRPI14-AGTTCC-26_S14_L001_R1_001.fastq.gz | fastq | 892405902.0 | 8835702.0 | GSM5174030 r1 | 0:101 1:0 | A:259754435;C:224608997;G:182748088;T:225275385;N:18997 | 101 | 0 | 259754435 | 224608997 | 182748088 | 225275385 | 18997 | SRX10356651 | SRS8474607 | SRA1207022 | GEO | Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University | 1 | 0.00022 | 0.0 | 0.99951 | 0.64285 | 101 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2021-03-16 | Hatching | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 63666 | 63666 | SRR13979089 | SRX10356650 | SRS8474606 | SRP310924 | PRJNA714931 | Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks | GSE169013 | Transcriptome Analysis | Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con… | pubmed:33898466 | miRNA TCPP rep1 | GSM5174029 | tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf | miRNA TCPP rep1 | For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample | zebrafish whole embryos | Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf. | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | strain:5D|developmental stage:48 hpf | GSM5174029 | GSM5174029: miRNA TCPP rep1; Danio rerio; miRNA Seq | GSM5174029 | 1 | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | GEO Accession:GSM5174029 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP310924 | miRNA_lane1-s013-indexRPI13-AGTCAA-25_S13_L001_R1_001.fastq.gz | fastq | 1059166295.0 | 10486795.0 | GSM5174029 r1 | 0:101 1:0 | A:329962449;C:255719926;G:216763563;T:256700660;N:19697 | 101 | 0 | 329962449 | 255719926 | 216763563 | 256700660 | 19697 | SRX10356650 | SRS8474606 | SRA1207022 | GEO | Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University | 1 | 0.00013 | 1e-05 | 0.99969 | 0.63636 | 101 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2021-03-16 | Hatching | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 63667 | 63667 | SRR13979088 | SRX10356649 | SRS8474605 | SRP310924 | PRJNA714931 | Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks | GSE169013 | Transcriptome Analysis | Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con… | pubmed:33898466 | miRNA TBBPA rep4 | GSM5174028 | tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf | miRNA TBBPA rep4 | For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample | zebrafish whole embryos | Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf. | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | strain:5D|developmental stage:48 hpf | GSM5174028 | GSM5174028: miRNA TBBPA rep4; Danio rerio; miRNA Seq | GSM5174028 | 1 | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | GEO Accession:GSM5174028 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP310924 | miRNA_lane1-s008-indexRPI8-ACTTGA-20_S8_L001_R1_001.fastq.gz | fastq | 868526270.0 | 8599270.0 | GSM5174028 r1 | 0:101 1:0 | A:259616680;C:210636450;G:178110756;T:220145615;N:16769 | 101 | 0 | 259616680 | 210636450 | 178110756 | 220145615 | 16769 | SRX10356649 | SRS8474605 | SRA1207022 | GEO | Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University | 1 | 0.00023 | 0.0 | 0.99961 | 0.67441 | 101 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2021-03-16 | Hatching | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 63668 | 63668 | SRR13979087 | SRX10356648 | SRS8474604 | SRP310924 | PRJNA714931 | Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks | GSE169013 | Transcriptome Analysis | Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con… | pubmed:33898466 | miRNA TBBPA rep3 | GSM5174027 | tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf | miRNA TBBPA rep3 | For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample | zebrafish whole embryos | Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf. | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | strain:5D|developmental stage:48 hpf | GSM5174027 | GSM5174027: miRNA TBBPA rep3; Danio rerio; miRNA Seq | GSM5174027 | 1 | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | GEO Accession:GSM5174027 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP310924 | miRNA_lane1-s007-indexRPI7-CAGATC-19_S7_L001_R1_001.fastq.gz | fastq | 493578011.0 | 4886911.0 | GSM5174027 r1 | 0:101 1:0 | A:147046152;C:124953541;G:102431606;T:119137120;N:9592 | 101 | 0 | 147046152 | 124953541 | 102431606 | 119137120 | 9592 | SRX10356648 | SRS8474604 | SRA1207022 | GEO | Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University | 1 | 0.00024 | 1e-05 | 0.99947 | 0.76744 | 101 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2021-03-16 | Hatching | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 63669 | 63669 | SRR13979086 | SRX10356647 | SRS8474603 | SRP310924 | PRJNA714931 | Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks | GSE169013 | Transcriptome Analysis | Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con… | pubmed:33898466 | miRNA TBBPA rep2 | GSM5174026 | tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf | miRNA TBBPA rep2 | For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample | zebrafish whole embryos | Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf. | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | strain:5D|developmental stage:48 hpf | GSM5174026 | GSM5174026: miRNA TBBPA rep2; Danio rerio; miRNA Seq | GSM5174026 | 1 | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | GEO Accession:GSM5174026 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP310924 | miRNA_lane1-s006-indexRPI6-GCCAAT-18_S6_L001_R1_001.fastq.gz | fastq | 910368853.0 | 9013553.0 | GSM5174026 r1 | 0:101 1:0 | A:270122236;C:230334670;G:190520709;T:219373774;N:17464 | 101 | 0 | 270122236 | 230334670 | 190520709 | 219373774 | 17464 | SRX10356647 | SRS8474603 | SRA1207022 | GEO | Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University | 1 | 0.00023 | 0.0 | 0.99949 | 0.72727 | 101 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2021-03-16 | Hatching | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 63670 | 63670 | SRR13979085 | SRX10356646 | SRS8474602 | SRP310924 | PRJNA714931 | Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks | GSE169013 | Transcriptome Analysis | Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con… | pubmed:33898466 | miRNA TBBPA rep1 | GSM5174025 | tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf | miRNA TBBPA rep1 | For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample | zebrafish whole embryos | Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf. | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | strain:5D|developmental stage:48 hpf | GSM5174025 | GSM5174025: miRNA TBBPA rep1; Danio rerio; miRNA Seq | GSM5174025 | 1 | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | GEO Accession:GSM5174025 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP310924 | miRNA_lane1-s005-indexRPI5-ACAGTG-17_S5_L001_R1_001.fastq.gz | fastq | 894131992.0 | 8852792.0 | GSM5174025 r1 | 0:101 1:0 | A:261443048;C:220215927;G:200185007;T:212270956;N:17054 | 101 | 0 | 261443048 | 220215927 | 200185007 | 212270956 | 17054 | SRX10356646 | SRS8474602 | SRA1207022 | GEO | Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University | 1 | 0.00021 | 1e-05 | 0.99953 | 0.7027 | 101 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2021-03-16 | Hatching | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 63671 | 63671 | SRR13979084 | SRX10356645 | SRS8474601 | SRP310924 | PRJNA714931 | Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks | GSE169013 | Transcriptome Analysis | Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con… | pubmed:33898466 | miRNA TBBPA DBPE rep4 | GSM5174024 | tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf DBPE | miRNA TBBPA DBPE rep4 | For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample | zebrafish whole embryos | Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf. | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | strain:5D|developmental stage:48 hpf DBPE | GSM5174024 | GSM5174024: miRNA TBBPA DBPE rep4; Danio rerio; miRNA Seq | GSM5174024 | 1 | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | GEO Accession:GSM5174024 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP310924 | miRNA_lane1-s040-indexRPI40-CTCAGA-68_S40_L001_R1_001.fastq.gz | fastq | 567614950.0 | 5619950.0 | GSM5174024 r1 | 0:101 1:0 | A:171789620;C:142600627;G:115292068;T:137921194;N:11441 | 101 | 0 | 171789620 | 142600627 | 115292068 | 137921194 | 11441 | SRX10356645 | SRS8474601 | SRA1207022 | GEO | Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University | 1 | 0.00014 | 0.0 | 0.99965 | 0.55555 | 101 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2021-03-16 | Hatching | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 63672 | 63672 | SRR13979083 | SRX10356644 | SRS8474600 | SRP310924 | PRJNA714931 | Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks | GSE169013 | Transcriptome Analysis | Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con… | pubmed:33898466 | miRNA TBBPA DBPE rep3 | GSM5174023 | tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf DBPE | miRNA TBBPA DBPE rep3 | For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample | zebrafish whole embryos | Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf. | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | strain:5D|developmental stage:48 hpf DBPE | GSM5174023 | GSM5174023: miRNA TBBPA DBPE rep3; Danio rerio; miRNA Seq | GSM5174023 | 1 | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | GEO Accession:GSM5174023 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP310924 | miRNA_lane1-s039-indexRPI39-CTATAC-67_S39_L001_R1_001.fastq.gz | fastq | 883651020.0 | 8749020.0 | GSM5174023 r1 | 0:101 1:0 | A:267266527;C:221471697;G:172032269;T:222861646;N:18881 | 101 | 0 | 267266527 | 221471697 | 172032269 | 222861646 | 18881 | SRX10356644 | SRS8474600 | SRA1207022 | GEO | Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University | 1 | 0.00024 | 1e-05 | 0.99959 | 0.65116 | 101 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2021-03-16 | Hatching | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 63673 | 63673 | SRR13979082 | SRX10356643 | SRS8474599 | SRP310924 | PRJNA714931 | Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks | GSE169013 | Transcriptome Analysis | Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con… | pubmed:33898466 | miRNA TBBPA DBPE rep2 | GSM5174022 | tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf DBPE | miRNA TBBPA DBPE rep2 | For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample | zebrafish whole embryos | Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf. | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | strain:5D|developmental stage:48 hpf DBPE | GSM5174022 | GSM5174022: miRNA TBBPA DBPE rep2; Danio rerio; miRNA Seq | GSM5174022 | 1 | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | GEO Accession:GSM5174022 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP310924 | miRNA_lane1-s038-indexRPI38-CTAGCT-66_S38_L001_R1_001.fastq.gz | fastq | 311086666.0 | 3080066.0 | GSM5174022 r1 | 0:101 1:0 | A:90852851;C:77957592;G:63570096;T:78699630;N:6497 | 101 | 0 | 90852851 | 77957592 | 63570096 | 78699630 | 6497 | SRX10356643 | SRS8474599 | SRA1207022 | GEO | Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University | 1 | 0.00036 | 1e-05 | 0.99947 | 0.6875 | 101 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2021-03-16 | Hatching | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 63674 | 63674 | SRR13979081 | SRX10356642 | SRS8474598 | SRP310924 | PRJNA714931 | Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks | GSE169013 | Transcriptome Analysis | Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con… | pubmed:33898466 | miRNA TBBPA DBPE rep1 | GSM5174021 | tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf DBPE | miRNA TBBPA DBPE rep1 | For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample | zebrafish whole embryos | Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf. | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | strain:5D|developmental stage:48 hpf DBPE | GSM5174021 | GSM5174021: miRNA TBBPA DBPE rep1; Danio rerio; miRNA Seq | GSM5174021 | 1 | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | GEO Accession:GSM5174021 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP310924 | miRNA_lane1-s037-indexRPI37-CGGAAT-65_S37_L001_R1_001.fastq.gz | fastq | 1002314506.0 | 9923906.0 | GSM5174021 r1 | 0:101 1:0 | A:303735625;C:240217618;G:214324562;T:244016797;N:19904 | 101 | 0 | 303735625 | 240217618 | 214324562 | 244016797 | 19904 | SRX10356642 | SRS8474598 | SRA1207022 | GEO | Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University | 1 | 0.00024 | 1e-05 | 0.99953 | 0.66666 | 101 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2021-03-16 | Hatching | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 63675 | 63675 | SRR13979080 | SRX10356641 | SRS8474597 | SRP310924 | PRJNA714931 | Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks | GSE169013 | Transcriptome Analysis | Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con… | pubmed:33898466 | miRNA IPP rep4 | GSM5174020 | tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf | miRNA IPP rep4 | For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample | zebrafish whole embryos | Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf. | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | strain:5D|developmental stage:48 hpf | GSM5174020 | GSM5174020: miRNA IPP rep4; Danio rerio; miRNA Seq | GSM5174020 | 1 | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | GEO Accession:GSM5174020 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP310924 | miRNA_lane1-s032-indexRPI32-CACTCA-56_S32_L001_R1_001.fastq.gz | fastq | 1129258881.0 | 11180781.0 | GSM5174020 r1 | 0:101 1:0 | A:335239774;C:296599595;G:223965990;T:273431685;N:21837 | 101 | 0 | 335239774 | 296599595 | 223965990 | 273431685 | 21837 | SRX10356641 | SRS8474597 | SRA1207022 | GEO | Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University | 1 | 0.00013 | 0.0 | 0.99959 | 0.75 | 101 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2021-03-16 | Hatching | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 63676 | 63676 | SRR13979079 | SRX10356640 | SRS8474596 | SRP310924 | PRJNA714931 | Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks | GSE169013 | Transcriptome Analysis | Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con… | pubmed:33898466 | miRNA IPP rep3 | GSM5174019 | tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf | miRNA IPP rep3 | For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample | zebrafish whole embryos | Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf. | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | strain:5D|developmental stage:48 hpf | GSM5174019 | GSM5174019: miRNA IPP rep3; Danio rerio; miRNA Seq | GSM5174019 | 1 | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | GEO Accession:GSM5174019 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP310924 | miRNA_lane1-s031-indexRPI31-CACGAT-55_S31_L001_R1_001.fastq.gz | fastq | 1364695941.0 | 13511841.0 | GSM5174019 r1 | 0:101 1:0 | A:408343873;C:341704999;G:281119661;T:333499060;N:28348 | 101 | 0 | 408343873 | 341704999 | 281119661 | 333499060 | 28348 | SRX10356640 | SRS8474596 | SRA1207022 | GEO | Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University | 1 | 0.00016 | 0.0 | 0.99961 | 0.68965 | 101 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2021-03-16 | Hatching | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 63677 | 63677 | SRR13979078 | SRX10356639 | SRS8474595 | SRP310924 | PRJNA714931 | Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks | GSE169013 | Transcriptome Analysis | Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con… | pubmed:33898466 | miRNA IPP rep2 | GSM5174018 | tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf | miRNA IPP rep2 | For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample | zebrafish whole embryos | Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf. | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | strain:5D|developmental stage:48 hpf | GSM5174018 | GSM5174018: miRNA IPP rep2; Danio rerio; miRNA Seq | GSM5174018 | 1 | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | GEO Accession:GSM5174018 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP310924 | miRNA_lane1-s030-indexRPI30-CACCGG-54_S30_L001_R1_001.fastq.gz | fastq | 1118435923.0 | 11073623.0 | GSM5174018 r1 | 0:101 1:0 | A:322914077;C:292720303;G:241919484;T:260855307;N:26752 | 101 | 0 | 322914077 | 292720303 | 241919484 | 260855307 | 26752 | SRX10356639 | SRS8474595 | SRA1207022 | GEO | Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University | 1 | 0.0002 | 1e-05 | 0.99959 | 0.74285 | 101 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2021-03-16 | Hatching | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 63678 | 63678 | SRR13979077 | SRX10356638 | SRS8474594 | SRP310924 | PRJNA714931 | Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks | GSE169013 | Transcriptome Analysis | Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con… | pubmed:33898466 | miRNA IPP rep1 | GSM5174017 | tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf | miRNA IPP rep1 | For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample | zebrafish whole embryos | Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf. | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | strain:5D|developmental stage:48 hpf | GSM5174017 | GSM5174017: miRNA IPP rep1; Danio rerio; miRNA Seq | GSM5174017 | 1 | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | GEO Accession:GSM5174017 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP310924 | miRNA_lane1-s029-indexRPI29-CAACTA-53_S29_L001_R1_001.fastq.gz | fastq | 965915217.0 | 9563517.0 | GSM5174017 r1 | 0:101 1:0 | A:298517953;C:241792467;G:190277966;T:235308237;N:18594 | 101 | 0 | 298517953 | 241792467 | 190277966 | 235308237 | 18594 | SRX10356638 | SRS8474594 | SRA1207022 | GEO | Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University | 1 | 0.00011 | 0.0 | 0.99973 | 0.55 | 101 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2021-03-16 | Hatching | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 63679 | 63679 | SRR13979076 | SRX10356637 | SRS8474593 | SRP310924 | PRJNA714931 | Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks | GSE169013 | Transcriptome Analysis | Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con… | pubmed:33898466 | miRNA BDE 47 rep4 | GSM5174016 | tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf | miRNA BDE 47 rep4 | For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample | zebrafish whole embryos | Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf. | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | strain:5D|developmental stage:48 hpf | GSM5174016 | GSM5174016: miRNA BDE 47 rep4; Danio rerio; miRNA Seq | GSM5174016 | 1 | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | GEO Accession:GSM5174016 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP310924 | miRNA_lane1-s020-indexRPI20-GTGGCC-44_S20_L001_R1_001.fastq.gz | fastq | 990919989.0 | 9811089.0 | GSM5174016 r1 | 0:101 1:0 | A:281268229;C:247800394;G:221010761;T:240816791;N:23814 | 101 | 0 | 281268229 | 247800394 | 221010761 | 240816791 | 23814 | SRX10356637 | SRS8474593 | SRA1207022 | GEO | Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University | 1 | 0.00016 | 0.0 | 0.99965 | 0.7 | 101 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2021-03-16 | Hatching | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 63680 | 63680 | SRR13979075 | SRX10356636 | SRS8474592 | SRP310924 | PRJNA714931 | Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks | GSE169013 | Transcriptome Analysis | Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con… | pubmed:33898466 | miRNA BDE 47 rep3 | GSM5174015 | tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf | miRNA BDE 47 rep3 | For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample | zebrafish whole embryos | Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf. | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | strain:5D|developmental stage:48 hpf | GSM5174015 | GSM5174015: miRNA BDE 47 rep3; Danio rerio; miRNA Seq | GSM5174015 | 1 | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | GEO Accession:GSM5174015 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP310924 | miRNA_lane1-s019-indexRPI19-GTGAAA-43_S19_L001_R1_001.fastq.gz | fastq | 936520278.0 | 9272478.0 | GSM5174015 r1 | 0:101 1:0 | A:292610982;C:215924738;G:200657250;T:227310895;N:16413 | 101 | 0 | 292610982 | 215924738 | 200657250 | 227310895 | 16413 | SRX10356636 | SRS8474592 | SRA1207022 | GEO | Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University | 1 | 0.00017 | 0.0 | 0.99961 | 0.6 | 101 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2021-03-16 | Hatching | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 63681 | 63681 | SRR13979074 | SRX10356635 | SRS8474591 | SRP310924 | PRJNA714931 | Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks | GSE169013 | Transcriptome Analysis | Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con… | pubmed:33898466 | miRNA BDE 47 rep2 | GSM5174014 | tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf | miRNA BDE 47 rep2 | For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample | zebrafish whole embryos | Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf. | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | strain:5D|developmental stage:48 hpf | GSM5174014 | GSM5174014: miRNA BDE 47 rep2; Danio rerio; miRNA Seq | GSM5174014 | 1 | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | GEO Accession:GSM5174014 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP310924 | miRNA_lane1-s018-indexRPI18-GTCCGC-42_S18_L001_R1_001.fastq.gz | fastq | 923871038.0 | 9147238.0 | GSM5174014 r1 | 0:101 1:0 | A:261826604;C:240583077;G:197471686;T:223966265;N:23406 | 101 | 0 | 261826604 | 240583077 | 197471686 | 223966265 | 23406 | SRX10356635 | SRS8474591 | SRA1207022 | GEO | Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University | 1 | 0.00019 | 0.0 | 0.99963 | 0.70588 | 101 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2021-03-16 | Hatching | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 63682 | 63682 | SRR13979073 | SRX10356634 | SRS8474588 | SRP310924 | PRJNA714931 | Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks | GSE169013 | Transcriptome Analysis | Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con… | pubmed:33898466 | miRNA BDE 47 rep1 | GSM5174013 | tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf | miRNA BDE 47 rep1 | For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample | zebrafish whole embryos | Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf. | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | strain:5D|developmental stage:48 hpf | GSM5174013 | GSM5174013: miRNA BDE 47 rep1; Danio rerio; miRNA Seq | GSM5174013 | 1 | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | GEO Accession:GSM5174013 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP310924 | miRNA_lane1-s017-indexRPI17-GTAGAG-41_S17_L001_R1_001.fastq.gz | fastq | 963214780.0 | 9536780.0 | GSM5174013 r1 | 0:101 1:0 | A:290268878;C:222146596;G:216903245;T:233878186;N:17875 | 101 | 0 | 290268878 | 222146596 | 216903245 | 233878186 | 17875 | SRX10356634 | SRS8474588 | SRA1207022 | GEO | Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University | 1 | 0.00013 | 0.0 | 0.99971 | 0.58333 | 101 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2021-03-16 | Hatching | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 63683 | 63683 | SRR13979072 | SRX10356633 | SRS8474589 | SRP310924 | PRJNA714931 | Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks | GSE169013 | Transcriptome Analysis | Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con… | pubmed:33898466 | miRNA Control rep4 | GSM5174012 | tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf | miRNA Control rep4 | For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample | zebrafish whole embryos | Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf. | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | strain:5D|developmental stage:48 hpf | GSM5174012 | GSM5174012: miRNA Control rep4; Danio rerio; miRNA Seq | GSM5174012 | 1 | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | GEO Accession:GSM5174012 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP310924 | miRNA_lane1-s004-indexRPI4-TGACCA-4_S4_L001_R1_001.fastq.gz | fastq | 776677274.0 | 7689874.0 | GSM5174012 r1 | 0:101 1:0 | A:233505881;C:196049592;G:158864473;T:188241779;N:15549 | 101 | 0 | 233505881 | 196049592 | 158864473 | 188241779 | 15549 | SRX10356633 | SRS8474589 | SRA1207022 | GEO | Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University | 1 | 0.00024 | 0.0 | 0.99949 | 0.76086 | 101 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2021-03-16 | Hatching | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 63684 | 63684 | SRR13979071 | SRX10356632 | SRS8474590 | SRP310924 | PRJNA714931 | Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks | GSE169013 | Transcriptome Analysis | Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con… | pubmed:33898466 | miRNA Control rep3 | GSM5174011 | tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf | miRNA Control rep3 | For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample | zebrafish whole embryos | Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf. | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | strain:5D|developmental stage:48 hpf | GSM5174011 | GSM5174011: miRNA Control rep3; Danio rerio; miRNA Seq | GSM5174011 | 1 | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | GEO Accession:GSM5174011 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP310924 | miRNA_lane1-s003-indexRPI3-TTAGGC-3_S3_L001_R1_001.fastq.gz | fastq | 489457615.0 | 4846115.0 | GSM5174011 r1 | 0:101 1:0 | A:141598763;C:118796680;G:105152559;T:123899061;N:10552 | 101 | 0 | 141598763 | 118796680 | 105152559 | 123899061 | 10552 | SRX10356632 | SRS8474590 | SRA1207022 | GEO | Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University | 1 | 0.00037 | 0.0 | 0.99947 | 0.66666 | 101 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2021-03-16 | Hatching | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 63685 | 63685 | SRR13979070 | SRX10356631 | SRS8474586 | SRP310924 | PRJNA714931 | Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks | GSE169013 | Transcriptome Analysis | Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con… | pubmed:33898466 | miRNA Control rep2 | GSM5174010 | tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf | miRNA Control rep2 | For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample | zebrafish whole embryos | Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf. | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | strain:5D|developmental stage:48 hpf | GSM5174010 | GSM5174010: miRNA Control rep2; Danio rerio; miRNA Seq | GSM5174010 | 1 | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | GEO Accession:GSM5174010 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP310924 | miRNA_lane1-s002-indexRPI2-CGATGT-2_S2_L001_R1_001.fastq.gz | fastq | 777242066.0 | 7695466.0 | GSM5174010 r1 | 0:101 1:0 | A:226389551;C:187485077;G:166405949;T:196945091;N:16398 | 101 | 0 | 226389551 | 187485077 | 166405949 | 196945091 | 16398 | SRX10356631 | SRS8474586 | SRA1207022 | GEO | Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University | 1 | 0.00026 | 0.0 | 0.99957 | 0.62 | 101 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2021-03-16 | Hatching | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 63686 | 63686 | SRR13979069 | SRX10356630 | SRS8474585 | SRP310924 | PRJNA714931 | Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks | GSE169013 | Transcriptome Analysis | Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con… | pubmed:33898466 | miRNA Control rep1 | GSM5174009 | tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf | miRNA Control rep1 | For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample | zebrafish whole embryos | Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf. | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | strain:5D|developmental stage:48 hpf | GSM5174009 | GSM5174009: miRNA Control rep1; Danio rerio; miRNA Seq | GSM5174009 | 1 | FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA | GEO Accession:GSM5174009 | miRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP310924 | miRNA_lane1-s001-indexRPI1-ATCACG-1_S1_L001_R1_001.fastq.gz | fastq | 370858163.0 | 3671863.0 | GSM5174009 r1 | 0:101 1:0 | A:112058381;C:93306905;G:75506546;T:89979021;N:7310 | 101 | 0 | 112058381 | 93306905 | 75506546 | 89979021 | 7310 | SRX10356630 | SRS8474585 | SRA1207022 | GEO | Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University | 1 | 0.00033 | 1e-05 | 0.99949 | 0.64516 | 101 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | trueseq | bulk | bulk | bulk | United States | 2021-03-16 | Hatching | Embryo | Whole Organism | All anatomical structures |
Advanced export
JSON shape: default, array, newline-delimited
CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;