metadata: run_metadata: 83 rows where experiment.library_selection = "size fractionation", experiment.library_source = "TRANSCRIPTOMIC" and technology = "bulk"

83 rows where experiment.library_selection = "size fractionation", experiment.library_source = "TRANSCRIPTOMIC" and technology = "bulk"

descending

Link	rowid ▼	run.accession	experiment.accession	sample.accession	study.accession	bioproject	study.title	study.alias	study.type	study.abstract	study.attributes	study.PMIDs	sample.title	sample.alias	sample.attributes	GEOsample.title	GEOsample.dataprocessing	GEOsample.source	GEOsample.treatmentprotocol	GEOsample.extractprotocol	GEOsample.growthprotocol	GEOsample.characteristics	GEOsample.accession	experiment.title	experiment.alias	experiment.design_description	experiment.library_construction_protocol	experiment.attributes	experiment.library_strategy	experiment.library_source	experiment.library_selection	experiment.library_layout	experiment.platform	experiment.instrument_model	experiment.study_ref	run.filename	run.semantic_name	run.total_bases	run.total_spots	run.alias	run.read_lengths	run.base_counts	run.r1_length	run.r2_length	run.Acount	run.Ccount	run.Gcount	run.Tcount	run.Ncount	run.experiment	run.pool_member	submission.accession	submission.srasource	submission.bioprojectsource	seqdetective.n_mates	seqdetective.mapping_rate.mate1	seqdetective.nofeature_rate.mate1	seqdetective.sparsity.mate1	seqdetective.pos_strand_rate.mate1	seqdetective.readlen.mate1	seqdetective.judgement.mate1	seqdetective.judgement.reason	platform_family	instrument_generation	read_bias	selection_class	prep_kit	sc_or_bulk	tech_class	technology	submission.bioprojectsource.country	earliest_date	devstage_curation	devstage_curation_coarse	tissue_curation	tissue_curation_coarse
37134	37134	SRR997335	SRX355601	SRS483796	SRP030036	PRJNA219641	Comparative transcriptome profiling of the injured zebrafish and mouse hearts identifies miRNA dependent repair pathways	GSE51018	Transcriptome Analysis	The mammalian heart has poor regenerative capacity following injury. In contrast certain lower vertebrates such as zebrafish retain a robust capacity for regeneration into adult life. Here we use an integrated approach to identify evolutionary conserved regenerative miRNA dependant regulatory circuits in the heart. We identified novel miRNA dependant networks involved in critical biological pathways which are differentially utilized between the infarcted mouse heart and the regenerating zebrafish heart. Overall design: 2 conditions 4 biological replicates per condition	parent bioproject:PRJNA219631	pubmed:26857418	Heart Control rep4	GSM1234963	source name:Heart Control\|tissue:heart	Heart Control rep4	Base calling was with Illumina GAP Pipeline Software v1.70 Sequence reads were processed to remove the adaptor sequences and reformatted to FASTA files using the FASTX Toolkit Sequences were aligned to mouse mature microRNA sequences from miRBase Version 17 and non coding RNA sequences Rfam Version 10 using MEGABLAST with a word size of 8 nucleotides. The criteria for counting a sequence match were if the % query was >=90% of the target sequence and if there were <= 2 mismatches over the alignment. The % query was calculated as a/q x p where a= alignment length q= query length and p= percent identity over aligned region. The matches against miRBase were parsed and the top matches based on % query were selected. If a sequence had more than one top match against different database sequences it was excluded from the subsequent analysis. Matches to Rfam were only taken into account for sequences not matching miRBase. Genome build: miRBase17 Supplementary files format and content: Raw count data for microRNAs were normalized to the relative size of each library using R/Bioconductor package DESeq estimateSizeFactors function. Count data are provided in tab delimited format	Heart Control		Total RNA was isolated using Trizol Invitrogen. RNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 BioanalyzerRNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 Bioanalyzer. Libraries of small RNAs for sequencing were prepared using the DGE Small RNA Sample Kit Alternative v1.5 Protocol Illumina; San Diego California according to the protocol supplied with the reagents Protocol Rev. A published February 2009 and using 1ug of total RNA. One lane of each library was sequenced on the Genome Analyzer IIx Illumina using the 36 Cycle Sequencing Kit v5 and v4 flowcell and cluster reagents Catalog FC 104 5020 and GD 300 1001		tissue:heart	GSM1234963	GSM1234963: Heart Control rep4; Danio rerio; RNA Seq	GSM1234963	1	Total RNA was isolated using Trizol Invitrogen. RNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 BioanalyzerRNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 Bioanalyzer. Libraries of small RNAs for sequencing were prepared using the DGE Small RNA Sample Kit Alternative v1.5 Protocol Illumina; San Diego California according to the protocol supplied with the reagents Protocol Rev. A published February 2009 and using 1ug of total RNA. One lane of each library was sequenced on the Genome Analyzer IIx Illumina using the 36 Cycle Sequencing Kit v5 and v4 flowcell and cluster reagents Catalog FC 104 5020 and GD 300 1001	GEO Accession:GSM1234963	RNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina Genome Analyzer II	SRP030036	C3PO_0053_s_7_sequence.txt.gz	fastq	1111882122.0	28509798.0	GSM1234963 r1	0:39	A:239964076;C:229590501;G:337557042;T:303257677;N:1512826	39		239964076	229590501	337557042	303257677	1512826	SRX355601	SRS483796	SRA101779	GEO	Vital-IT, SIB Swiss Institute of Bioinformatics	1	0.11195	0.03776	0.98871	0.16576	39	B	usable mapping rate	illumina	early_illumina	unknown	size_fractionation	unknown	bulk	bulk	bulk	Switzerland	2013-09-19	Undetermined	Undetermined	Heart	Cardiovascular System
37135	37135	SRR997334	SRX355600	SRS483795	SRP030036	PRJNA219641	Comparative transcriptome profiling of the injured zebrafish and mouse hearts identifies miRNA dependent repair pathways	GSE51018	Transcriptome Analysis	The mammalian heart has poor regenerative capacity following injury. In contrast certain lower vertebrates such as zebrafish retain a robust capacity for regeneration into adult life. Here we use an integrated approach to identify evolutionary conserved regenerative miRNA dependant regulatory circuits in the heart. We identified novel miRNA dependant networks involved in critical biological pathways which are differentially utilized between the infarcted mouse heart and the regenerating zebrafish heart. Overall design: 2 conditions 4 biological replicates per condition	parent bioproject:PRJNA219631	pubmed:26857418	Heart Control rep3	GSM1234962	source name:Heart Control\|tissue:heart	Heart Control rep3	Base calling was with Illumina GAP Pipeline Software v1.70 Sequence reads were processed to remove the adaptor sequences and reformatted to FASTA files using the FASTX Toolkit Sequences were aligned to mouse mature microRNA sequences from miRBase Version 17 and non coding RNA sequences Rfam Version 10 using MEGABLAST with a word size of 8 nucleotides. The criteria for counting a sequence match were if the % query was >=90% of the target sequence and if there were <= 2 mismatches over the alignment. The % query was calculated as a/q x p where a= alignment length q= query length and p= percent identity over aligned region. The matches against miRBase were parsed and the top matches based on % query were selected. If a sequence had more than one top match against different database sequences it was excluded from the subsequent analysis. Matches to Rfam were only taken into account for sequences not matching miRBase. Genome build: miRBase17 Supplementary files format and content: Raw count data for microRNAs were normalized to the relative size of each library using R/Bioconductor package DESeq estimateSizeFactors function. Count data are provided in tab delimited format	Heart Control		Total RNA was isolated using Trizol Invitrogen. RNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 BioanalyzerRNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 Bioanalyzer. Libraries of small RNAs for sequencing were prepared using the DGE Small RNA Sample Kit Alternative v1.5 Protocol Illumina; San Diego California according to the protocol supplied with the reagents Protocol Rev. A published February 2009 and using 1ug of total RNA. One lane of each library was sequenced on the Genome Analyzer IIx Illumina using the 36 Cycle Sequencing Kit v5 and v4 flowcell and cluster reagents Catalog FC 104 5020 and GD 300 1001		tissue:heart	GSM1234962	GSM1234962: Heart Control rep3; Danio rerio; RNA Seq	GSM1234962	1	Total RNA was isolated using Trizol Invitrogen. RNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 BioanalyzerRNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 Bioanalyzer. Libraries of small RNAs for sequencing were prepared using the DGE Small RNA Sample Kit Alternative v1.5 Protocol Illumina; San Diego California according to the protocol supplied with the reagents Protocol Rev. A published February 2009 and using 1ug of total RNA. One lane of each library was sequenced on the Genome Analyzer IIx Illumina using the 36 Cycle Sequencing Kit v5 and v4 flowcell and cluster reagents Catalog FC 104 5020 and GD 300 1001	GEO Accession:GSM1234962	RNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina Genome Analyzer II	SRP030036	C3PO_0053_s_6_sequence.txt.gz	fastq	1221305046.0	31315514.0	GSM1234962 r1	0:39	A:263520584;C:251263128;G:372262308;T:332218529;N:2040497	39		263520584	251263128	372262308	332218529	2040497	SRX355600	SRS483795	SRA101779	GEO	Vital-IT, SIB Swiss Institute of Bioinformatics	1	0.11552	0.03865	0.98679	0.1927	39	B	usable mapping rate	illumina	early_illumina	unknown	size_fractionation	unknown	bulk	bulk	bulk	Switzerland	2013-09-19	Undetermined	Undetermined	Heart	Cardiovascular System
37136	37136	SRR997333	SRX355599	SRS483794	SRP030036	PRJNA219641	Comparative transcriptome profiling of the injured zebrafish and mouse hearts identifies miRNA dependent repair pathways	GSE51018	Transcriptome Analysis	The mammalian heart has poor regenerative capacity following injury. In contrast certain lower vertebrates such as zebrafish retain a robust capacity for regeneration into adult life. Here we use an integrated approach to identify evolutionary conserved regenerative miRNA dependant regulatory circuits in the heart. We identified novel miRNA dependant networks involved in critical biological pathways which are differentially utilized between the infarcted mouse heart and the regenerating zebrafish heart. Overall design: 2 conditions 4 biological replicates per condition	parent bioproject:PRJNA219631	pubmed:26857418	Heart Control rep2	GSM1234961	source name:Heart Control\|tissue:heart	Heart Control rep2	Base calling was with Illumina GAP Pipeline Software v1.70 Sequence reads were processed to remove the adaptor sequences and reformatted to FASTA files using the FASTX Toolkit Sequences were aligned to mouse mature microRNA sequences from miRBase Version 17 and non coding RNA sequences Rfam Version 10 using MEGABLAST with a word size of 8 nucleotides. The criteria for counting a sequence match were if the % query was >=90% of the target sequence and if there were <= 2 mismatches over the alignment. The % query was calculated as a/q x p where a= alignment length q= query length and p= percent identity over aligned region. The matches against miRBase were parsed and the top matches based on % query were selected. If a sequence had more than one top match against different database sequences it was excluded from the subsequent analysis. Matches to Rfam were only taken into account for sequences not matching miRBase. Genome build: miRBase17 Supplementary files format and content: Raw count data for microRNAs were normalized to the relative size of each library using R/Bioconductor package DESeq estimateSizeFactors function. Count data are provided in tab delimited format	Heart Control		Total RNA was isolated using Trizol Invitrogen. RNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 BioanalyzerRNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 Bioanalyzer. Libraries of small RNAs for sequencing were prepared using the DGE Small RNA Sample Kit Alternative v1.5 Protocol Illumina; San Diego California according to the protocol supplied with the reagents Protocol Rev. A published February 2009 and using 1ug of total RNA. One lane of each library was sequenced on the Genome Analyzer IIx Illumina using the 36 Cycle Sequencing Kit v5 and v4 flowcell and cluster reagents Catalog FC 104 5020 and GD 300 1001		tissue:heart	GSM1234961	GSM1234961: Heart Control rep2; Danio rerio; RNA Seq	GSM1234961	1	Total RNA was isolated using Trizol Invitrogen. RNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 BioanalyzerRNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 Bioanalyzer. Libraries of small RNAs for sequencing were prepared using the DGE Small RNA Sample Kit Alternative v1.5 Protocol Illumina; San Diego California according to the protocol supplied with the reagents Protocol Rev. A published February 2009 and using 1ug of total RNA. One lane of each library was sequenced on the Genome Analyzer IIx Illumina using the 36 Cycle Sequencing Kit v5 and v4 flowcell and cluster reagents Catalog FC 104 5020 and GD 300 1001	GEO Accession:GSM1234961	RNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina Genome Analyzer II	SRP030036	R2D2_0122_s_7_sequence.txt.gz	fastq	1462542939.0	37501101.0	GSM1234961 r1	0:39	A:313173840;C:298865755;G:440814004;T:409066990;N:622350	39		313173840	298865755	440814004	409066990	622350	SRX355599	SRS483794	SRA101779	GEO	Vital-IT, SIB Swiss Institute of Bioinformatics	1	0.01745	0.00554	0.99101	0.42928	39	B	usable mapping rate	illumina	early_illumina	unknown	size_fractionation	unknown	bulk	bulk	bulk	Switzerland	2013-09-19	Undetermined	Undetermined	Heart	Cardiovascular System
37137	37137	SRR997332	SRX355598	SRS483793	SRP030036	PRJNA219641	Comparative transcriptome profiling of the injured zebrafish and mouse hearts identifies miRNA dependent repair pathways	GSE51018	Transcriptome Analysis	The mammalian heart has poor regenerative capacity following injury. In contrast certain lower vertebrates such as zebrafish retain a robust capacity for regeneration into adult life. Here we use an integrated approach to identify evolutionary conserved regenerative miRNA dependant regulatory circuits in the heart. We identified novel miRNA dependant networks involved in critical biological pathways which are differentially utilized between the infarcted mouse heart and the regenerating zebrafish heart. Overall design: 2 conditions 4 biological replicates per condition	parent bioproject:PRJNA219631	pubmed:26857418	Heart Control rep1	GSM1234960	source name:Heart Control\|tissue:heart	Heart Control rep1	Base calling was with Illumina GAP Pipeline Software v1.70 Sequence reads were processed to remove the adaptor sequences and reformatted to FASTA files using the FASTX Toolkit Sequences were aligned to mouse mature microRNA sequences from miRBase Version 17 and non coding RNA sequences Rfam Version 10 using MEGABLAST with a word size of 8 nucleotides. The criteria for counting a sequence match were if the % query was >=90% of the target sequence and if there were <= 2 mismatches over the alignment. The % query was calculated as a/q x p where a= alignment length q= query length and p= percent identity over aligned region. The matches against miRBase were parsed and the top matches based on % query were selected. If a sequence had more than one top match against different database sequences it was excluded from the subsequent analysis. Matches to Rfam were only taken into account for sequences not matching miRBase. Genome build: miRBase17 Supplementary files format and content: Raw count data for microRNAs were normalized to the relative size of each library using R/Bioconductor package DESeq estimateSizeFactors function. Count data are provided in tab delimited format	Heart Control		Total RNA was isolated using Trizol Invitrogen. RNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 BioanalyzerRNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 Bioanalyzer. Libraries of small RNAs for sequencing were prepared using the DGE Small RNA Sample Kit Alternative v1.5 Protocol Illumina; San Diego California according to the protocol supplied with the reagents Protocol Rev. A published February 2009 and using 1ug of total RNA. One lane of each library was sequenced on the Genome Analyzer IIx Illumina using the 36 Cycle Sequencing Kit v5 and v4 flowcell and cluster reagents Catalog FC 104 5020 and GD 300 1001		tissue:heart	GSM1234960	GSM1234960: Heart Control rep1; Danio rerio; RNA Seq	GSM1234960	1	Total RNA was isolated using Trizol Invitrogen. RNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 BioanalyzerRNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 Bioanalyzer. Libraries of small RNAs for sequencing were prepared using the DGE Small RNA Sample Kit Alternative v1.5 Protocol Illumina; San Diego California according to the protocol supplied with the reagents Protocol Rev. A published February 2009 and using 1ug of total RNA. One lane of each library was sequenced on the Genome Analyzer IIx Illumina using the 36 Cycle Sequencing Kit v5 and v4 flowcell and cluster reagents Catalog FC 104 5020 and GD 300 1001	GEO Accession:GSM1234960	RNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina Genome Analyzer II	SRP030036	R2D2_0122_s_6_sequence.txt.gz	fastq	1447346355.0	37111445.0	GSM1234960 r1	0:39	A:311132663;C:297266985;G:441400778;T:396960907;N:585022	39		311132663	297266985	441400778	396960907	585022	SRX355598	SRS483793	SRA101779	GEO	Vital-IT, SIB Swiss Institute of Bioinformatics	1	0.06118	0.01997	0.98752	0.43741	39	B	usable mapping rate	illumina	early_illumina	unknown	size_fractionation	unknown	bulk	bulk	bulk	Switzerland	2013-09-19	Undetermined	Undetermined	Heart	Cardiovascular System
37138	37138	SRR997331	SRX355597	SRS483792	SRP030036	PRJNA219641	Comparative transcriptome profiling of the injured zebrafish and mouse hearts identifies miRNA dependent repair pathways	GSE51018	Transcriptome Analysis	The mammalian heart has poor regenerative capacity following injury. In contrast certain lower vertebrates such as zebrafish retain a robust capacity for regeneration into adult life. Here we use an integrated approach to identify evolutionary conserved regenerative miRNA dependant regulatory circuits in the heart. We identified novel miRNA dependant networks involved in critical biological pathways which are differentially utilized between the infarcted mouse heart and the regenerating zebrafish heart. Overall design: 2 conditions 4 biological replicates per condition	parent bioproject:PRJNA219631	pubmed:26857418	Heart Resected rep4	GSM1234959	source name:Heart Resected\|tissue:heart	Heart Resected rep4	Base calling was with Illumina GAP Pipeline Software v1.70 Sequence reads were processed to remove the adaptor sequences and reformatted to FASTA files using the FASTX Toolkit Sequences were aligned to mouse mature microRNA sequences from miRBase Version 17 and non coding RNA sequences Rfam Version 10 using MEGABLAST with a word size of 8 nucleotides. The criteria for counting a sequence match were if the % query was >=90% of the target sequence and if there were <= 2 mismatches over the alignment. The % query was calculated as a/q x p where a= alignment length q= query length and p= percent identity over aligned region. The matches against miRBase were parsed and the top matches based on % query were selected. If a sequence had more than one top match against different database sequences it was excluded from the subsequent analysis. Matches to Rfam were only taken into account for sequences not matching miRBase. Genome build: miRBase17 Supplementary files format and content: Raw count data for microRNAs were normalized to the relative size of each library using R/Bioconductor package DESeq estimateSizeFactors function. Count data are provided in tab delimited format	Heart Resected		Total RNA was isolated using Trizol Invitrogen. RNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 BioanalyzerRNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 Bioanalyzer. Libraries of small RNAs for sequencing were prepared using the DGE Small RNA Sample Kit Alternative v1.5 Protocol Illumina; San Diego California according to the protocol supplied with the reagents Protocol Rev. A published February 2009 and using 1ug of total RNA. One lane of each library was sequenced on the Genome Analyzer IIx Illumina using the 36 Cycle Sequencing Kit v5 and v4 flowcell and cluster reagents Catalog FC 104 5020 and GD 300 1001		tissue:heart	GSM1234959	GSM1234959: Heart Resected rep4; Danio rerio; RNA Seq	GSM1234959	1	Total RNA was isolated using Trizol Invitrogen. RNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 BioanalyzerRNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 Bioanalyzer. Libraries of small RNAs for sequencing were prepared using the DGE Small RNA Sample Kit Alternative v1.5 Protocol Illumina; San Diego California according to the protocol supplied with the reagents Protocol Rev. A published February 2009 and using 1ug of total RNA. One lane of each library was sequenced on the Genome Analyzer IIx Illumina using the 36 Cycle Sequencing Kit v5 and v4 flowcell and cluster reagents Catalog FC 104 5020 and GD 300 1001	GEO Accession:GSM1234959	RNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina Genome Analyzer II	SRP030036	C3PO_0053_s_5_sequence.txt.gz	fastq	703519557.0	18038963.0	GSM1234959 r1	0:39	A:142685665;C:144259439;G:215526965;T:199924689;N:1122799	39		142685665	144259439	215526965	199924689	1122799	SRX355597	SRS483792	SRA101779	GEO	Vital-IT, SIB Swiss Institute of Bioinformatics	1	0.00172	0.00045	0.99738	0.34873	39	T	under 1.2% mapping rate	illumina	early_illumina	unknown	size_fractionation	unknown	bulk	bulk	bulk	Switzerland	2013-09-19	Undetermined	Undetermined	Heart	Cardiovascular System
37139	37139	SRR997330	SRX355596	SRS483791	SRP030036	PRJNA219641	Comparative transcriptome profiling of the injured zebrafish and mouse hearts identifies miRNA dependent repair pathways	GSE51018	Transcriptome Analysis	The mammalian heart has poor regenerative capacity following injury. In contrast certain lower vertebrates such as zebrafish retain a robust capacity for regeneration into adult life. Here we use an integrated approach to identify evolutionary conserved regenerative miRNA dependant regulatory circuits in the heart. We identified novel miRNA dependant networks involved in critical biological pathways which are differentially utilized between the infarcted mouse heart and the regenerating zebrafish heart. Overall design: 2 conditions 4 biological replicates per condition	parent bioproject:PRJNA219631	pubmed:26857418	Heart Resected rep3	GSM1234958	source name:Heart Resected\|tissue:heart	Heart Resected rep3	Base calling was with Illumina GAP Pipeline Software v1.70 Sequence reads were processed to remove the adaptor sequences and reformatted to FASTA files using the FASTX Toolkit Sequences were aligned to mouse mature microRNA sequences from miRBase Version 17 and non coding RNA sequences Rfam Version 10 using MEGABLAST with a word size of 8 nucleotides. The criteria for counting a sequence match were if the % query was >=90% of the target sequence and if there were <= 2 mismatches over the alignment. The % query was calculated as a/q x p where a= alignment length q= query length and p= percent identity over aligned region. The matches against miRBase were parsed and the top matches based on % query were selected. If a sequence had more than one top match against different database sequences it was excluded from the subsequent analysis. Matches to Rfam were only taken into account for sequences not matching miRBase. Genome build: miRBase17 Supplementary files format and content: Raw count data for microRNAs were normalized to the relative size of each library using R/Bioconductor package DESeq estimateSizeFactors function. Count data are provided in tab delimited format	Heart Resected		Total RNA was isolated using Trizol Invitrogen. RNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 BioanalyzerRNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 Bioanalyzer. Libraries of small RNAs for sequencing were prepared using the DGE Small RNA Sample Kit Alternative v1.5 Protocol Illumina; San Diego California according to the protocol supplied with the reagents Protocol Rev. A published February 2009 and using 1ug of total RNA. One lane of each library was sequenced on the Genome Analyzer IIx Illumina using the 36 Cycle Sequencing Kit v5 and v4 flowcell and cluster reagents Catalog FC 104 5020 and GD 300 1001		tissue:heart	GSM1234958	GSM1234958: Heart Resected rep3; Danio rerio; RNA Seq	GSM1234958	1	Total RNA was isolated using Trizol Invitrogen. RNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 BioanalyzerRNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 Bioanalyzer. Libraries of small RNAs for sequencing were prepared using the DGE Small RNA Sample Kit Alternative v1.5 Protocol Illumina; San Diego California according to the protocol supplied with the reagents Protocol Rev. A published February 2009 and using 1ug of total RNA. One lane of each library was sequenced on the Genome Analyzer IIx Illumina using the 36 Cycle Sequencing Kit v5 and v4 flowcell and cluster reagents Catalog FC 104 5020 and GD 300 1001	GEO Accession:GSM1234958	RNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina Genome Analyzer II	SRP030036	C3PO_0053_s_4_sequence.txt.gz	fastq	918978177.0	23563543.0	GSM1234958 r1	0:39	A:188056254;C:191217660;G:283318445;T:255042736;N:1343082	39		188056254	191217660	283318445	255042736	1343082	SRX355596	SRS483791	SRA101779	GEO	Vital-IT, SIB Swiss Institute of Bioinformatics	1	0.09453	0.03085	0.98559	0.18337	39	B	usable mapping rate	illumina	early_illumina	unknown	size_fractionation	unknown	bulk	bulk	bulk	Switzerland	2013-09-19	Undetermined	Undetermined	Heart	Cardiovascular System
37140	37140	SRR997329	SRX355595	SRS483789	SRP030036	PRJNA219641	Comparative transcriptome profiling of the injured zebrafish and mouse hearts identifies miRNA dependent repair pathways	GSE51018	Transcriptome Analysis	The mammalian heart has poor regenerative capacity following injury. In contrast certain lower vertebrates such as zebrafish retain a robust capacity for regeneration into adult life. Here we use an integrated approach to identify evolutionary conserved regenerative miRNA dependant regulatory circuits in the heart. We identified novel miRNA dependant networks involved in critical biological pathways which are differentially utilized between the infarcted mouse heart and the regenerating zebrafish heart. Overall design: 2 conditions 4 biological replicates per condition	parent bioproject:PRJNA219631	pubmed:26857418	Heart Resected rep2	GSM1234957	source name:Heart Resected\|tissue:heart	Heart Resected rep2	Base calling was with Illumina GAP Pipeline Software v1.70 Sequence reads were processed to remove the adaptor sequences and reformatted to FASTA files using the FASTX Toolkit Sequences were aligned to mouse mature microRNA sequences from miRBase Version 17 and non coding RNA sequences Rfam Version 10 using MEGABLAST with a word size of 8 nucleotides. The criteria for counting a sequence match were if the % query was >=90% of the target sequence and if there were <= 2 mismatches over the alignment. The % query was calculated as a/q x p where a= alignment length q= query length and p= percent identity over aligned region. The matches against miRBase were parsed and the top matches based on % query were selected. If a sequence had more than one top match against different database sequences it was excluded from the subsequent analysis. Matches to Rfam were only taken into account for sequences not matching miRBase. Genome build: miRBase17 Supplementary files format and content: Raw count data for microRNAs were normalized to the relative size of each library using R/Bioconductor package DESeq estimateSizeFactors function. Count data are provided in tab delimited format	Heart Resected		Total RNA was isolated using Trizol Invitrogen. RNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 BioanalyzerRNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 Bioanalyzer. Libraries of small RNAs for sequencing were prepared using the DGE Small RNA Sample Kit Alternative v1.5 Protocol Illumina; San Diego California according to the protocol supplied with the reagents Protocol Rev. A published February 2009 and using 1ug of total RNA. One lane of each library was sequenced on the Genome Analyzer IIx Illumina using the 36 Cycle Sequencing Kit v5 and v4 flowcell and cluster reagents Catalog FC 104 5020 and GD 300 1001		tissue:heart	GSM1234957	GSM1234957: Heart Resected rep2; Danio rerio; RNA Seq	GSM1234957	1	Total RNA was isolated using Trizol Invitrogen. RNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 BioanalyzerRNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 Bioanalyzer. Libraries of small RNAs for sequencing were prepared using the DGE Small RNA Sample Kit Alternative v1.5 Protocol Illumina; San Diego California according to the protocol supplied with the reagents Protocol Rev. A published February 2009 and using 1ug of total RNA. One lane of each library was sequenced on the Genome Analyzer IIx Illumina using the 36 Cycle Sequencing Kit v5 and v4 flowcell and cluster reagents Catalog FC 104 5020 and GD 300 1001	GEO Accession:GSM1234957	RNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina Genome Analyzer II	SRP030036	R2D2_0122_s_5_sequence.txt.gz	fastq	1420874247.0	36432673.0	GSM1234957 r1	0:39	A:290914118;C:295973738;G:440368910;T:393019696;N:597785	39		290914118	295973738	440368910	393019696	597785	SRX355595	SRS483789	SRA101779	GEO	Vital-IT, SIB Swiss Institute of Bioinformatics	1	0.00472	0.00131	0.99431	0.42832	39	T	under 1.2% mapping rate	illumina	early_illumina	unknown	size_fractionation	unknown	bulk	bulk	bulk	Switzerland	2013-09-19	Undetermined	Undetermined	Heart	Cardiovascular System
37141	37141	SRR997328	SRX355594	SRS483790	SRP030036	PRJNA219641	Comparative transcriptome profiling of the injured zebrafish and mouse hearts identifies miRNA dependent repair pathways	GSE51018	Transcriptome Analysis	The mammalian heart has poor regenerative capacity following injury. In contrast certain lower vertebrates such as zebrafish retain a robust capacity for regeneration into adult life. Here we use an integrated approach to identify evolutionary conserved regenerative miRNA dependant regulatory circuits in the heart. We identified novel miRNA dependant networks involved in critical biological pathways which are differentially utilized between the infarcted mouse heart and the regenerating zebrafish heart. Overall design: 2 conditions 4 biological replicates per condition	parent bioproject:PRJNA219631	pubmed:26857418	Heart Resected rep1	GSM1234956	source name:Heart Resected\|tissue:heart	Heart Resected rep1	Base calling was with Illumina GAP Pipeline Software v1.70 Sequence reads were processed to remove the adaptor sequences and reformatted to FASTA files using the FASTX Toolkit Sequences were aligned to mouse mature microRNA sequences from miRBase Version 17 and non coding RNA sequences Rfam Version 10 using MEGABLAST with a word size of 8 nucleotides. The criteria for counting a sequence match were if the % query was >=90% of the target sequence and if there were <= 2 mismatches over the alignment. The % query was calculated as a/q x p where a= alignment length q= query length and p= percent identity over aligned region. The matches against miRBase were parsed and the top matches based on % query were selected. If a sequence had more than one top match against different database sequences it was excluded from the subsequent analysis. Matches to Rfam were only taken into account for sequences not matching miRBase. Genome build: miRBase17 Supplementary files format and content: Raw count data for microRNAs were normalized to the relative size of each library using R/Bioconductor package DESeq estimateSizeFactors function. Count data are provided in tab delimited format	Heart Resected		Total RNA was isolated using Trizol Invitrogen. RNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 BioanalyzerRNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 Bioanalyzer. Libraries of small RNAs for sequencing were prepared using the DGE Small RNA Sample Kit Alternative v1.5 Protocol Illumina; San Diego California according to the protocol supplied with the reagents Protocol Rev. A published February 2009 and using 1ug of total RNA. One lane of each library was sequenced on the Genome Analyzer IIx Illumina using the 36 Cycle Sequencing Kit v5 and v4 flowcell and cluster reagents Catalog FC 104 5020 and GD 300 1001		tissue:heart	GSM1234956	GSM1234956: Heart Resected rep1; Danio rerio; RNA Seq	GSM1234956	1	Total RNA was isolated using Trizol Invitrogen. RNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 BioanalyzerRNA quantities and quality were assessed using a NanoDrop ND 1000 spectrophotometer or an Agilent 2100 Bioanalyzer. Libraries of small RNAs for sequencing were prepared using the DGE Small RNA Sample Kit Alternative v1.5 Protocol Illumina; San Diego California according to the protocol supplied with the reagents Protocol Rev. A published February 2009 and using 1ug of total RNA. One lane of each library was sequenced on the Genome Analyzer IIx Illumina using the 36 Cycle Sequencing Kit v5 and v4 flowcell and cluster reagents Catalog FC 104 5020 and GD 300 1001	GEO Accession:GSM1234956	RNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina Genome Analyzer II	SRP030036	C3PO_0054_s_8_sequence.txt.gz	fastq	1073339514.0	27521526.0	GSM1234956 r1	0:39	A:223670054;C:219603945;G:328718329;T:300891777;N:455409	39		223670054	219603945	328718329	300891777	455409	SRX355594	SRS483790	SRA101779	GEO	Vital-IT, SIB Swiss Institute of Bioinformatics	1	0.05133	0.01643	0.9893	0.25792	39	B	usable mapping rate	illumina	early_illumina	unknown	size_fractionation	unknown	bulk	bulk	bulk	Switzerland	2013-09-19	Undetermined	Undetermined	Heart	Cardiovascular System
53033	53033	SRR9674344	SRX6434730	SRS5089289	SRP214428	PRJNA554249	the role of SMN complex in tissue regeneration	GSE134187	Transcriptome Analysis	we conducted RNA Seq and MiRNA Seq to screen the molecular targets and pathways involved in tissue regeneration of SMN complex members Overall design: we compared the 3 regeneration gene mutants to the 4 non regeneration gene mutants.			rnpc3 WT 1 [miRNA seq]	GSM3938561	source name:Wildtype siblings of rnpc3 mutants repeat 1\|strain background:TAB 5\|genotype/variation:Wildtype siblings of rnpc3 mutants\|Stage:7 dpf\|tissue:whole fish embryos	rnpc3 WT 1 [miRNA seq]	Reads are trimmed using Trimmomatic v0.36 Trimmed reads are aligned using STAR 2.5.4a mRNA or "hisat2 2.2.1.0 no softclip no spliced alignment rna strandness R new summary" miRNA abundance is measured by RSEM "rsem calculate expression paired end forward prob 0.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output" for mRNA Seq "rsem calculate expression forward prob 1.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output fragment length mean 22 fragment length sd 10 seed length 15" for miRNA Seq Genome build: danRer10/Ensembl release 91 for mRNA Seq miRBase mature miRNA for microRNA Seq Supplementary files format and content: RSEM output gene abundance	Wildtype siblings of rnpc3 mutants repeat 1		Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols		strain background:TAB 5\|genotype/variation:Wildtype siblings of rnpc3 mutants\|Stage:7 dpf\|tissue:whole fish embryos	GSM3938561	GSM3938561: rnpc3 WT 1 [miRNA seq]; Danio rerio; miRNA Seq	GSM3938561	1	Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols	GEO Accession:GSM3938561	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP214428	mir_Rpc3_1Ctrl.fastq.gz	fastq	1129597674.0	22148974.0	GSM3938561 r1	0:51	A:255811479;C:280511308;G:313965625;T:279284342;N:24920	51		255811479	280511308	313965625	279284342	24920	SRX6434730	SRS5089289	SRA920248	GEO	Burgess, NHGRI, NIH	1	0.00979	0.00166	0.99588	0.63728	51	T	under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	unknown	bulk	bulk	bulk	United States	2019-07-12	Larval	Larval	Whole Organism	All anatomical structures
53034	53034	SRR9674343	SRX6434729	SRS5089288	SRP214428	PRJNA554249	the role of SMN complex in tissue regeneration	GSE134187	Transcriptome Analysis	we conducted RNA Seq and MiRNA Seq to screen the molecular targets and pathways involved in tissue regeneration of SMN complex members Overall design: we compared the 3 regeneration gene mutants to the 4 non regeneration gene mutants.			smn1 WT 1 [miRNA seq]	GSM3938560	source name:Wildtype siblings of smn1 mutants repeat 1\|strain background:TAB 5\|genotype/variation:Wildtype siblings of smn1 mutants\|Stage:7 dpf\|tissue:whole fish embryos	smn1 WT 1 [miRNA seq]	Reads are trimmed using Trimmomatic v0.36 Trimmed reads are aligned using STAR 2.5.4a mRNA or "hisat2 2.2.1.0 no softclip no spliced alignment rna strandness R new summary" miRNA abundance is measured by RSEM "rsem calculate expression paired end forward prob 0.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output" for mRNA Seq "rsem calculate expression forward prob 1.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output fragment length mean 22 fragment length sd 10 seed length 15" for miRNA Seq Genome build: danRer10/Ensembl release 91 for mRNA Seq miRBase mature miRNA for microRNA Seq Supplementary files format and content: RSEM output gene abundance	Wildtype siblings of smn1 mutants repeat 1		Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols		strain background:TAB 5\|genotype/variation:Wildtype siblings of smn1 mutants\|Stage:7 dpf\|tissue:whole fish embryos	GSM3938560	GSM3938560: smn1 WT 1 [miRNA seq]; Danio rerio; miRNA Seq	GSM3938560	1	Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols	GEO Accession:GSM3938560	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP214428	mir_Smn1_1Ctrl.fastq.gz	fastq	1381751976.0	27093176.0	GSM3938560 r1	0:51	A:323091185;C:348663819;G:380517013;T:329446099;N:33860	51		323091185	348663819	380517013	329446099	33860	SRX6434729	SRS5089288	SRA920248	GEO	Burgess, NHGRI, NIH	1	0.00712	0.00142	0.99642	0.66315	51	T	under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	unknown	bulk	bulk	bulk	United States	2019-07-12	Larval	Larval	Whole Organism	All anatomical structures
53035	53035	SRR9674342	SRX6434728	SRS5089287	SRP214428	PRJNA554249	the role of SMN complex in tissue regeneration	GSE134187	Transcriptome Analysis	we conducted RNA Seq and MiRNA Seq to screen the molecular targets and pathways involved in tissue regeneration of SMN complex members Overall design: we compared the 3 regeneration gene mutants to the 4 non regeneration gene mutants.			gemin5 WT 1 [miRNA seq]	GSM3938559	source name:Wildtype siblings of germin5 mutants repeat 1\|strain background:TAB 5\|genotype/variation:Wildtype siblings of germin5 mutants\|Stage:7 dpf\|tissue:whole fish embryos	gemin5 WT 1 [miRNA seq]	Reads are trimmed using Trimmomatic v0.36 Trimmed reads are aligned using STAR 2.5.4a mRNA or "hisat2 2.2.1.0 no softclip no spliced alignment rna strandness R new summary" miRNA abundance is measured by RSEM "rsem calculate expression paired end forward prob 0.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output" for mRNA Seq "rsem calculate expression forward prob 1.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output fragment length mean 22 fragment length sd 10 seed length 15" for miRNA Seq Genome build: danRer10/Ensembl release 91 for mRNA Seq miRBase mature miRNA for microRNA Seq Supplementary files format and content: RSEM output gene abundance	Wildtype siblings of germin5 mutants repeat 1		Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols		strain background:TAB 5\|genotype/variation:Wildtype siblings of germin5 mutants\|Stage:7 dpf\|tissue:whole fish embryos	GSM3938559	GSM3938559: gemin5 WT 1 [miRNA seq]; Danio rerio; miRNA Seq	GSM3938559	1	Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols	GEO Accession:GSM3938559	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP214428	mir_Gmn5_1Ctrl.fastq.gz	fastq	1347630171.0	26424121.0	GSM3938559 r1	0:51	A:307019777;C:335315873;G:378259746;T:327002846;N:31929	51		307019777	335315873	378259746	327002846	31929	SRX6434728	SRS5089287	SRA920248	GEO	Burgess, NHGRI, NIH	1	0.00723	0.00127	0.99582	0.63934	51	T	under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	unknown	bulk	bulk	bulk	United States	2019-07-12	Larval	Larval	Whole Organism	All anatomical structures
53036	53036	SRR9674341	SRX6434727	SRS5089286	SRP214428	PRJNA554249	the role of SMN complex in tissue regeneration	GSE134187	Transcriptome Analysis	we conducted RNA Seq and MiRNA Seq to screen the molecular targets and pathways involved in tissue regeneration of SMN complex members Overall design: we compared the 3 regeneration gene mutants to the 4 non regeneration gene mutants.			smn1 hom 3 [miRNA seq]	GSM3938558	source name:Homozygous smn1 mutants repeat 3\|strain background:TAB 5\|genotype/variation:Homozygous smn1 mutants\|Stage:7 dpf\|tissue:whole fish embryos	smn1 hom 3 [miRNA seq]	Reads are trimmed using Trimmomatic v0.36 Trimmed reads are aligned using STAR 2.5.4a mRNA or "hisat2 2.2.1.0 no softclip no spliced alignment rna strandness R new summary" miRNA abundance is measured by RSEM "rsem calculate expression paired end forward prob 0.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output" for mRNA Seq "rsem calculate expression forward prob 1.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output fragment length mean 22 fragment length sd 10 seed length 15" for miRNA Seq Genome build: danRer10/Ensembl release 91 for mRNA Seq miRBase mature miRNA for microRNA Seq Supplementary files format and content: RSEM output gene abundance	Homozygous smn1 mutants repeat 3		Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols		strain background:TAB 5\|genotype/variation:Homozygous smn1 mutants\|Stage:7 dpf\|tissue:whole fish embryos	GSM3938558	GSM3938558: smn1 hom 3 [miRNA seq]; Danio rerio; miRNA Seq	GSM3938558	1	Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols	GEO Accession:GSM3938558	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP214428	mir_Smn1_3hom.fastq.gz	fastq	1269172638.0	24885738.0	GSM3938558 r1	0:51	A:290351922;C:320656517;G:354834895;T:303300306;N:28998	51		290351922	320656517	354834895	303300306	28998	SRX6434727	SRS5089286	SRA920248	GEO	Burgess, NHGRI, NIH	1	0.0061	0.00111	0.9962	0.5917	51	T	under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	unknown	bulk	bulk	bulk	United States	2019-07-12	Larval	Larval	Whole Organism	All anatomical structures
53037	53037	SRR9674340	SRX6434726	SRS5089285	SRP214428	PRJNA554249	the role of SMN complex in tissue regeneration	GSE134187	Transcriptome Analysis	we conducted RNA Seq and MiRNA Seq to screen the molecular targets and pathways involved in tissue regeneration of SMN complex members Overall design: we compared the 3 regeneration gene mutants to the 4 non regeneration gene mutants.			smn1 hom 2 [miRNA seq]	GSM3938557	source name:Homozygous smn1 mutants repeat 2\|strain background:TAB 5\|genotype/variation:Homozygous smn1 mutants\|Stage:7 dpf\|tissue:whole fish embryos	smn1 hom 2 [miRNA seq]	Reads are trimmed using Trimmomatic v0.36 Trimmed reads are aligned using STAR 2.5.4a mRNA or "hisat2 2.2.1.0 no softclip no spliced alignment rna strandness R new summary" miRNA abundance is measured by RSEM "rsem calculate expression paired end forward prob 0.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output" for mRNA Seq "rsem calculate expression forward prob 1.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output fragment length mean 22 fragment length sd 10 seed length 15" for miRNA Seq Genome build: danRer10/Ensembl release 91 for mRNA Seq miRBase mature miRNA for microRNA Seq Supplementary files format and content: RSEM output gene abundance	Homozygous smn1 mutants repeat 2		Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols		strain background:TAB 5\|genotype/variation:Homozygous smn1 mutants\|Stage:7 dpf\|tissue:whole fish embryos	GSM3938557	GSM3938557: smn1 hom 2 [miRNA seq]; Danio rerio; miRNA Seq	GSM3938557	1	Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols	GEO Accession:GSM3938557	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP214428	mir_Smn1_2hom.fastq.gz	fastq	1625802786.0	31878486.0	GSM3938557 r1	0:51	A:376836190;C:399950981;G:453572869;T:395403783;N:38963	51		376836190	399950981	453572869	395403783	38963	SRX6434726	SRS5089285	SRA920248	GEO	Burgess, NHGRI, NIH	1	0.00609	0.00111	0.99638	0.63347	51	T	under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	unknown	bulk	bulk	bulk	United States	2019-07-12	Larval	Larval	Whole Organism	All anatomical structures
53038	53038	SRR9674339	SRX6434725	SRS5089284	SRP214428	PRJNA554249	the role of SMN complex in tissue regeneration	GSE134187	Transcriptome Analysis	we conducted RNA Seq and MiRNA Seq to screen the molecular targets and pathways involved in tissue regeneration of SMN complex members Overall design: we compared the 3 regeneration gene mutants to the 4 non regeneration gene mutants.			smn1 hom 1 [miRNA seq]	GSM3938556	source name:Homozygous smn1 mutants repeat 1\|strain background:TAB 5\|genotype/variation:Homozygous smn1 mutants\|Stage:7 dpf\|tissue:whole fish embryos	smn1 hom 1 [miRNA seq]	Reads are trimmed using Trimmomatic v0.36 Trimmed reads are aligned using STAR 2.5.4a mRNA or "hisat2 2.2.1.0 no softclip no spliced alignment rna strandness R new summary" miRNA abundance is measured by RSEM "rsem calculate expression paired end forward prob 0.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output" for mRNA Seq "rsem calculate expression forward prob 1.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output fragment length mean 22 fragment length sd 10 seed length 15" for miRNA Seq Genome build: danRer10/Ensembl release 91 for mRNA Seq miRBase mature miRNA for microRNA Seq Supplementary files format and content: RSEM output gene abundance	Homozygous smn1 mutants repeat 1		Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols		strain background:TAB 5\|genotype/variation:Homozygous smn1 mutants\|Stage:7 dpf\|tissue:whole fish embryos	GSM3938556	GSM3938556: smn1 hom 1 [miRNA seq]; Danio rerio; miRNA Seq	GSM3938556	1	Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols	GEO Accession:GSM3938556	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP214428	mir_Smn1_1hom.fastq.gz	fastq	1553527320.0	30461320.0	GSM3938556 r1	0:51	A:360279409;C:388795394;G:432335873;T:372080058;N:36586	51		360279409	388795394	432335873	372080058	36586	SRX6434725	SRS5089284	SRA920248	GEO	Burgess, NHGRI, NIH	1	0.00691	0.00137	0.99638	0.61909	51	T	under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	unknown	bulk	bulk	bulk	United States	2019-07-12	Larval	Larval	Whole Organism	All anatomical structures
53039	53039	SRR9674338	SRX6434724	SRS5089283	SRP214428	PRJNA554249	the role of SMN complex in tissue regeneration	GSE134187	Transcriptome Analysis	we conducted RNA Seq and MiRNA Seq to screen the molecular targets and pathways involved in tissue regeneration of SMN complex members Overall design: we compared the 3 regeneration gene mutants to the 4 non regeneration gene mutants.			gemin5 hom 3 [miRNA seq]	GSM3938555	source name:Homozygous gemin5 mutants repeat 3\|strain background:TAB 5\|genotype/variation:Homozygous gemin5 mutants\|Stage:7 dpf\|tissue:whole fish embryos	gemin5 hom 3 [miRNA seq]	Reads are trimmed using Trimmomatic v0.36 Trimmed reads are aligned using STAR 2.5.4a mRNA or "hisat2 2.2.1.0 no softclip no spliced alignment rna strandness R new summary" miRNA abundance is measured by RSEM "rsem calculate expression paired end forward prob 0.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output" for mRNA Seq "rsem calculate expression forward prob 1.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output fragment length mean 22 fragment length sd 10 seed length 15" for miRNA Seq Genome build: danRer10/Ensembl release 91 for mRNA Seq miRBase mature miRNA for microRNA Seq Supplementary files format and content: RSEM output gene abundance	Homozygous gemin5 mutants repeat 3		Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols		strain background:TAB 5\|genotype/variation:Homozygous gemin5 mutants\|Stage:7 dpf\|tissue:whole fish embryos	GSM3938555	GSM3938555: gemin5 hom 3 [miRNA seq]; Danio rerio; miRNA Seq	GSM3938555	1	Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols	GEO Accession:GSM3938555	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP214428	mir_Gmn5_3hom.fastq.gz	fastq	1162857936.0	22801136.0	GSM3938555 r1	0:51	A:267576310;C:282684680;G:327841913;T:284728561;N:26472	51		267576310	282684680	327841913	284728561	26472	SRX6434724	SRS5089283	SRA920248	GEO	Burgess, NHGRI, NIH	1	0.00597	0.00114	0.99618	0.62386	51	T	under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	unknown	bulk	bulk	bulk	United States	2019-07-12	Larval	Larval	Whole Organism	All anatomical structures
53040	53040	SRR9674337	SRX6434723	SRS5089282	SRP214428	PRJNA554249	the role of SMN complex in tissue regeneration	GSE134187	Transcriptome Analysis	we conducted RNA Seq and MiRNA Seq to screen the molecular targets and pathways involved in tissue regeneration of SMN complex members Overall design: we compared the 3 regeneration gene mutants to the 4 non regeneration gene mutants.			gemin5 hom 2 [miRNA seq]	GSM3938554	source name:Homozygous gemin5 mutants repeat 2\|strain background:TAB 5\|genotype/variation:Homozygous gemin5 mutants\|Stage:7 dpf\|tissue:whole fish embryos	gemin5 hom 2 [miRNA seq]	Reads are trimmed using Trimmomatic v0.36 Trimmed reads are aligned using STAR 2.5.4a mRNA or "hisat2 2.2.1.0 no softclip no spliced alignment rna strandness R new summary" miRNA abundance is measured by RSEM "rsem calculate expression paired end forward prob 0.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output" for mRNA Seq "rsem calculate expression forward prob 1.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output fragment length mean 22 fragment length sd 10 seed length 15" for miRNA Seq Genome build: danRer10/Ensembl release 91 for mRNA Seq miRBase mature miRNA for microRNA Seq Supplementary files format and content: RSEM output gene abundance	Homozygous gemin5 mutants repeat 2		Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols		strain background:TAB 5\|genotype/variation:Homozygous gemin5 mutants\|Stage:7 dpf\|tissue:whole fish embryos	GSM3938554	GSM3938554: gemin5 hom 2 [miRNA seq]; Danio rerio; miRNA Seq	GSM3938554	1	Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols	GEO Accession:GSM3938554	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP214428	mir_Gmn5_2hom.fastq.gz	fastq	1612392846.0	31615546.0	GSM3938554 r1	0:51	A:360634123;C:389619637;G:457463377;T:404638471;N:37238	51		360634123	389619637	457463377	404638471	37238	SRX6434723	SRS5089282	SRA920248	GEO	Burgess, NHGRI, NIH	1	0.00538	0.00085	0.99677	0.62726	51	T	under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	unknown	bulk	bulk	bulk	United States	2019-07-12	Larval	Larval	Whole Organism	All anatomical structures
53041	53041	SRR9674336	SRX6434722	SRS5089281	SRP214428	PRJNA554249	the role of SMN complex in tissue regeneration	GSE134187	Transcriptome Analysis	we conducted RNA Seq and MiRNA Seq to screen the molecular targets and pathways involved in tissue regeneration of SMN complex members Overall design: we compared the 3 regeneration gene mutants to the 4 non regeneration gene mutants.			gemin5 hom 1 [miRNA seq]	GSM3938553	source name:Homozygous gemin5 mutants repeat 1\|strain background:TAB 5\|genotype/variation:Homozygous gemin5 mutants\|Stage:7 dpf\|tissue:whole fish embryos	gemin5 hom 1 [miRNA seq]	Reads are trimmed using Trimmomatic v0.36 Trimmed reads are aligned using STAR 2.5.4a mRNA or "hisat2 2.2.1.0 no softclip no spliced alignment rna strandness R new summary" miRNA abundance is measured by RSEM "rsem calculate expression paired end forward prob 0.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output" for mRNA Seq "rsem calculate expression forward prob 1.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output fragment length mean 22 fragment length sd 10 seed length 15" for miRNA Seq Genome build: danRer10/Ensembl release 91 for mRNA Seq miRBase mature miRNA for microRNA Seq Supplementary files format and content: RSEM output gene abundance	Homozygous gemin5 mutants repeat 1		Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols		strain background:TAB 5\|genotype/variation:Homozygous gemin5 mutants\|Stage:7 dpf\|tissue:whole fish embryos	GSM3938553	GSM3938553: gemin5 hom 1 [miRNA seq]; Danio rerio; miRNA Seq	GSM3938553	1	Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols	GEO Accession:GSM3938553	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP214428	mir_Gmn5_1hom.fastq.gz	fastq	1734523362.0	34010262.0	GSM3938553 r1	0:51	A:400823854;C:428868747;G:484830308;T:419961177;N:39276	51		400823854	428868747	484830308	419961177	39276	SRX6434722	SRS5089281	SRA920248	GEO	Burgess, NHGRI, NIH	1	0.00485	0.00098	0.99636	0.65384	51	T	under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	unknown	bulk	bulk	bulk	United States	2019-07-12	Larval	Larval	Whole Organism	All anatomical structures
53042	53042	SRR9674335	SRX6434721	SRS5089280	SRP214428	PRJNA554249	the role of SMN complex in tissue regeneration	GSE134187	Transcriptome Analysis	we conducted RNA Seq and MiRNA Seq to screen the molecular targets and pathways involved in tissue regeneration of SMN complex members Overall design: we compared the 3 regeneration gene mutants to the 4 non regeneration gene mutants.			gemin6 hom 3 [miRNA seq]	GSM3938552	source name:Homozygous gemin6 mutants repeat 3\|strain background:TAB 5\|genotype/variation:Homozygous gemin6 mutants\|Stage:7 dpf\|tissue:whole fish embryos	gemin6 hom 3 [miRNA seq]	Reads are trimmed using Trimmomatic v0.36 Trimmed reads are aligned using STAR 2.5.4a mRNA or "hisat2 2.2.1.0 no softclip no spliced alignment rna strandness R new summary" miRNA abundance is measured by RSEM "rsem calculate expression paired end forward prob 0.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output" for mRNA Seq "rsem calculate expression forward prob 1.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output fragment length mean 22 fragment length sd 10 seed length 15" for miRNA Seq Genome build: danRer10/Ensembl release 91 for mRNA Seq miRBase mature miRNA for microRNA Seq Supplementary files format and content: RSEM output gene abundance	Homozygous gemin6 mutants repeat 3		Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols		strain background:TAB 5\|genotype/variation:Homozygous gemin6 mutants\|Stage:7 dpf\|tissue:whole fish embryos	GSM3938552	GSM3938552: gemin6 hom 3 [miRNA seq]; Danio rerio; miRNA Seq	GSM3938552	1	Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols	GEO Accession:GSM3938552	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP214428	mir_G6_3.fastq.gz	fastq	3450343851.0	67653801.0	GSM3938552 r1	0:51	A:777873635;C:888116741;G:969513398;T:814785464;N:54613	51		777873635	888116741	969513398	814785464	54613	SRX6434721	SRS5089280	SRA920248	GEO	Burgess, NHGRI, NIH	1	0.01435	0.00222	0.99486	0.71333	51	B	usable mapping rate	illumina	hiseq_era	unknown	size_fractionation	unknown	bulk	bulk	bulk	United States	2019-07-12	Larval	Larval	Whole Organism	All anatomical structures
53043	53043	SRR9674334	SRX6434720	SRS5089279	SRP214428	PRJNA554249	the role of SMN complex in tissue regeneration	GSE134187	Transcriptome Analysis	we conducted RNA Seq and MiRNA Seq to screen the molecular targets and pathways involved in tissue regeneration of SMN complex members Overall design: we compared the 3 regeneration gene mutants to the 4 non regeneration gene mutants.			gemin6 hom 2 [miRNA seq]	GSM3938551	source name:Homozygous gemin6 mutants repeat 2\|strain background:TAB 5\|genotype/variation:Homozygous gemin6 mutants\|Stage:7 dpf\|tissue:whole fish embryos	gemin6 hom 2 [miRNA seq]	Reads are trimmed using Trimmomatic v0.36 Trimmed reads are aligned using STAR 2.5.4a mRNA or "hisat2 2.2.1.0 no softclip no spliced alignment rna strandness R new summary" miRNA abundance is measured by RSEM "rsem calculate expression paired end forward prob 0.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output" for mRNA Seq "rsem calculate expression forward prob 1.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output fragment length mean 22 fragment length sd 10 seed length 15" for miRNA Seq Genome build: danRer10/Ensembl release 91 for mRNA Seq miRBase mature miRNA for microRNA Seq Supplementary files format and content: RSEM output gene abundance	Homozygous gemin6 mutants repeat 2		Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols		strain background:TAB 5\|genotype/variation:Homozygous gemin6 mutants\|Stage:7 dpf\|tissue:whole fish embryos	GSM3938551	GSM3938551: gemin6 hom 2 [miRNA seq]; Danio rerio; miRNA Seq	GSM3938551	1	Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols	GEO Accession:GSM3938551	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP214428	mir_G6_2.fastq.gz	fastq	1586876781.0	31115231.0	GSM3938551 r1	0:51	A:373921059;C:393906222;G:435371208;T:383652895;N:25397	51		373921059	393906222	435371208	383652895	25397	SRX6434720	SRS5089279	SRA920248	GEO	Burgess, NHGRI, NIH	1	0.01456	0.00199	0.99488	0.65884	51	B	usable mapping rate	illumina	hiseq_era	unknown	size_fractionation	unknown	bulk	bulk	bulk	United States	2019-07-12	Larval	Larval	Whole Organism	All anatomical structures
53044	53044	SRR9674333	SRX6434719	SRS5089278	SRP214428	PRJNA554249	the role of SMN complex in tissue regeneration	GSE134187	Transcriptome Analysis	we conducted RNA Seq and MiRNA Seq to screen the molecular targets and pathways involved in tissue regeneration of SMN complex members Overall design: we compared the 3 regeneration gene mutants to the 4 non regeneration gene mutants.			gemin6 hom 1 [miRNA seq]	GSM3938550	source name:Homozygous gemin6 mutants repeat 1\|strain background:TAB 5\|genotype/variation:Homozygous gemin6 mutants\|Stage:7 dpf\|tissue:whole fish embryos	gemin6 hom 1 [miRNA seq]	Reads are trimmed using Trimmomatic v0.36 Trimmed reads are aligned using STAR 2.5.4a mRNA or "hisat2 2.2.1.0 no softclip no spliced alignment rna strandness R new summary" miRNA abundance is measured by RSEM "rsem calculate expression paired end forward prob 0.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output" for mRNA Seq "rsem calculate expression forward prob 1.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output fragment length mean 22 fragment length sd 10 seed length 15" for miRNA Seq Genome build: danRer10/Ensembl release 91 for mRNA Seq miRBase mature miRNA for microRNA Seq Supplementary files format and content: RSEM output gene abundance	Homozygous gemin6 mutants repeat 1		Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols		strain background:TAB 5\|genotype/variation:Homozygous gemin6 mutants\|Stage:7 dpf\|tissue:whole fish embryos	GSM3938550	GSM3938550: gemin6 hom 1 [miRNA seq]; Danio rerio; miRNA Seq	GSM3938550	1	Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols	GEO Accession:GSM3938550	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP214428	mir_G6_1.fastq.gz	fastq	1632291159.0	32005709.0	GSM3938550 r1	0:51	A:387703621;C:405051941;G:452019824;T:387489473;N:26300	51		387703621	405051941	452019824	387489473	26300	SRX6434719	SRS5089278	SRA920248	GEO	Burgess, NHGRI, NIH	1	0.01378	0.00168	0.99482	0.66266	51	B	usable mapping rate	illumina	hiseq_era	unknown	size_fractionation	unknown	bulk	bulk	bulk	United States	2019-07-12	Larval	Larval	Whole Organism	All anatomical structures
53045	53045	SRR9674332	SRX6434718	SRS5089277	SRP214428	PRJNA554249	the role of SMN complex in tissue regeneration	GSE134187	Transcriptome Analysis	we conducted RNA Seq and MiRNA Seq to screen the molecular targets and pathways involved in tissue regeneration of SMN complex members Overall design: we compared the 3 regeneration gene mutants to the 4 non regeneration gene mutants.			gemin4 hom 3 [miRNA seq]	GSM3938549	source name:Homozygous gemin4 mutants repeat 3\|strain background:TAB 5\|genotype/variation:Homozygous gemin4 mutants\|Stage:7 dpf\|tissue:whole fish embryos	gemin4 hom 3 [miRNA seq]	Reads are trimmed using Trimmomatic v0.36 Trimmed reads are aligned using STAR 2.5.4a mRNA or "hisat2 2.2.1.0 no softclip no spliced alignment rna strandness R new summary" miRNA abundance is measured by RSEM "rsem calculate expression paired end forward prob 0.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output" for mRNA Seq "rsem calculate expression forward prob 1.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output fragment length mean 22 fragment length sd 10 seed length 15" for miRNA Seq Genome build: danRer10/Ensembl release 91 for mRNA Seq miRBase mature miRNA for microRNA Seq Supplementary files format and content: RSEM output gene abundance	Homozygous gemin4 mutants repeat 3		Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols		strain background:TAB 5\|genotype/variation:Homozygous gemin4 mutants\|Stage:7 dpf\|tissue:whole fish embryos	GSM3938549	GSM3938549: gemin4 hom 3 [miRNA seq]; Danio rerio; miRNA Seq	GSM3938549	1	Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols	GEO Accession:GSM3938549	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP214428	mir_G4_3.fastq.gz	fastq	1079490837.0	21166487.0	GSM3938549 r1	0:51	A:247548301;C:266526237;G:295997407;T:269401582;N:17310	51		247548301	266526237	295997407	269401582	17310	SRX6434718	SRS5089277	SRA920248	GEO	Burgess, NHGRI, NIH	1	0.01616	0.00211	0.99486	0.65494	51	B	usable mapping rate	illumina	hiseq_era	unknown	size_fractionation	unknown	bulk	bulk	bulk	United States	2019-07-12	Larval	Larval	Whole Organism	All anatomical structures
53046	53046	SRR9674331	SRX6434717	SRS5089276	SRP214428	PRJNA554249	the role of SMN complex in tissue regeneration	GSE134187	Transcriptome Analysis	we conducted RNA Seq and MiRNA Seq to screen the molecular targets and pathways involved in tissue regeneration of SMN complex members Overall design: we compared the 3 regeneration gene mutants to the 4 non regeneration gene mutants.			gemin4 hom 2 [miRNA seq]	GSM3938548	source name:Homozygous gemin4 mutants repeat 2\|strain background:TAB 5\|genotype/variation:Homozygous gemin4 mutants\|Stage:7 dpf\|tissue:whole fish embryos	gemin4 hom 2 [miRNA seq]	Reads are trimmed using Trimmomatic v0.36 Trimmed reads are aligned using STAR 2.5.4a mRNA or "hisat2 2.2.1.0 no softclip no spliced alignment rna strandness R new summary" miRNA abundance is measured by RSEM "rsem calculate expression paired end forward prob 0.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output" for mRNA Seq "rsem calculate expression forward prob 1.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output fragment length mean 22 fragment length sd 10 seed length 15" for miRNA Seq Genome build: danRer10/Ensembl release 91 for mRNA Seq miRBase mature miRNA for microRNA Seq Supplementary files format and content: RSEM output gene abundance	Homozygous gemin4 mutants repeat 2		Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols		strain background:TAB 5\|genotype/variation:Homozygous gemin4 mutants\|Stage:7 dpf\|tissue:whole fish embryos	GSM3938548	GSM3938548: gemin4 hom 2 [miRNA seq]; Danio rerio; miRNA Seq	GSM3938548	1	Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols	GEO Accession:GSM3938548	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP214428	mir_G4_2.fastq.gz	fastq	6427925862.0	126037762.0	GSM3938548 r1	0:51	A:1491339645;C:1560095279;G:1804953332;T:1571434430;N:103176	51		1491339645	1560095279	1804953332	1571434430	103176	SRX6434717	SRS5089276	SRA920248	GEO	Burgess, NHGRI, NIH	1	0.01032	0.00157	0.99504	0.70577	51	T	under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	unknown	bulk	bulk	bulk	United States	2019-07-12	Larval	Larval	Whole Organism	All anatomical structures
53047	53047	SRR9674330	SRX6434716	SRS5089275	SRP214428	PRJNA554249	the role of SMN complex in tissue regeneration	GSE134187	Transcriptome Analysis	we conducted RNA Seq and MiRNA Seq to screen the molecular targets and pathways involved in tissue regeneration of SMN complex members Overall design: we compared the 3 regeneration gene mutants to the 4 non regeneration gene mutants.			gemin4 hom 1 [miRNA seq]	GSM3938547	source name:Homozygous gemin4 mutants repeat 1\|strain background:TAB 5\|genotype/variation:Homozygous gemin4 mutants\|Stage:7 dpf\|tissue:whole fish embryos	gemin4 hom 1 [miRNA seq]	Reads are trimmed using Trimmomatic v0.36 Trimmed reads are aligned using STAR 2.5.4a mRNA or "hisat2 2.2.1.0 no softclip no spliced alignment rna strandness R new summary" miRNA abundance is measured by RSEM "rsem calculate expression paired end forward prob 0.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output" for mRNA Seq "rsem calculate expression forward prob 1.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output fragment length mean 22 fragment length sd 10 seed length 15" for miRNA Seq Genome build: danRer10/Ensembl release 91 for mRNA Seq miRBase mature miRNA for microRNA Seq Supplementary files format and content: RSEM output gene abundance	Homozygous gemin4 mutants repeat 1		Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols		strain background:TAB 5\|genotype/variation:Homozygous gemin4 mutants\|Stage:7 dpf\|tissue:whole fish embryos	GSM3938547	GSM3938547: gemin4 hom 1 [miRNA seq]; Danio rerio; miRNA Seq	GSM3938547	1	Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols	GEO Accession:GSM3938547	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP214428	mir_G4_1.fastq.gz	fastq	3063591624.0	60070424.0	GSM3938547 r1	0:51	A:710248035;C:750319193;G:848095316;T:754879685;N:49395	51		710248035	750319193	848095316	754879685	49395	SRX6434716	SRS5089275	SRA920248	GEO	Burgess, NHGRI, NIH	1	0.01137	0.00151	0.99527	0.69096	51	T	under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	unknown	bulk	bulk	bulk	United States	2019-07-12	Larval	Larval	Whole Organism	All anatomical structures
57067	57067	SRR11214402	SRX7826914	SRS6238049	SRP251256	PRJNA609696	Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq]	GSE146200	Transcriptome Analysis	Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.	parent bioproject:PRJNA609691	pubmed:28962522	JD18 [miRNA seq]	GSM4368082	source name:30 pooled larvae 5dpf triptolide for 6 h\|strain:WIK\|developmental stage:5dpf\|treatment:triptolide 1.6μM for 6 h\|tissue:30 pooled larvae\|molecule subtype:small RNA	JD18 [miRNA seq]	The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.	30 pooled larvae 5dpf triptolide for 6 h	5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes	Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.	Zebrafish Danio rerio were maintained at 28.5 °C	strain:WIK\|developmental stage:5dpf\|treatment:triptolide 1.6μM for 6 h\|tissue:30 pooled larvae\|molecule subtype:small RNA	GSM4368082	GSM4368082: JD18 [miRNA seq]; Danio rerio; ncRNA Seq	GSM4368082	1	Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.	GEO Accession:GSM4368082	ncRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	NextSeq 550	SRP251256	small_JD18.combined.fastq.gz	fastq	702201000.0	14044020.0	GSM4368082 r1	0:50 1:0	A:165610842;C:167169519;G:192886323;T:176528538;N:5778	50	0	165610842	167169519	192886323	176528538	5778	SRX7826914	SRS6238049	SRA1049684	GEO	Centre for Immunity, Infection and Evolution	1	0.06331	0.00756	0.99153	0.5451	50	B	usable mapping rate	illumina	nextseq	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2020-03-02	Larval	Larval	Whole Organism	All anatomical structures
57068	57068	SRR11214401	SRX7826913	SRS6238048	SRP251256	PRJNA609696	Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq]	GSE146200	Transcriptome Analysis	Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.	parent bioproject:PRJNA609691	pubmed:28962522	JD17 [miRNA seq]	GSM4368081	source name:30 pooled larvae 5dpf triptolide for 6 h\|strain:WIK\|developmental stage:5dpf\|treatment:triptolide 1.6μM for 6 h\|tissue:30 pooled larvae\|molecule subtype:small RNA	JD17 [miRNA seq]	The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.	30 pooled larvae 5dpf triptolide for 6 h	5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes	Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.	Zebrafish Danio rerio were maintained at 28.5 °C	strain:WIK\|developmental stage:5dpf\|treatment:triptolide 1.6μM for 6 h\|tissue:30 pooled larvae\|molecule subtype:small RNA	GSM4368081	GSM4368081: JD17 [miRNA seq]; Danio rerio; ncRNA Seq	GSM4368081	1	Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.	GEO Accession:GSM4368081	ncRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	NextSeq 550	SRP251256	small_JD17.combined.fastq.gz	fastq	429694400.0	8593888.0	GSM4368081 r1	0:50 1:0	A:105670449;C:101354858;G:115926173;T:106739304;N:3616	50	0	105670449	101354858	115926173	106739304	3616	SRX7826913	SRS6238048	SRA1049684	GEO	Centre for Immunity, Infection and Evolution	1	0.04686	0.00437	0.99389	0.53154	50	B	usable mapping rate	illumina	nextseq	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2020-03-02	Larval	Larval	Whole Organism	All anatomical structures
57069	57069	SRR11214400	SRX7826912	SRS6238047	SRP251256	PRJNA609696	Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq]	GSE146200	Transcriptome Analysis	Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.	parent bioproject:PRJNA609691	pubmed:28962522	JD16 [miRNA seq]	GSM4368080	source name:30 pooled larvae 5dpf triptolide for 6 h\|strain:WIK\|developmental stage:5dpf\|treatment:triptolide 1.6μM for 6 h\|tissue:30 pooled larvae\|molecule subtype:small RNA	JD16 [miRNA seq]	The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.	30 pooled larvae 5dpf triptolide for 6 h	5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes	Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.	Zebrafish Danio rerio were maintained at 28.5 °C	strain:WIK\|developmental stage:5dpf\|treatment:triptolide 1.6μM for 6 h\|tissue:30 pooled larvae\|molecule subtype:small RNA	GSM4368080	GSM4368080: JD16 [miRNA seq]; Danio rerio; ncRNA Seq	GSM4368080	1	Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.	GEO Accession:GSM4368080	ncRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	NextSeq 550	SRP251256	small_JD16.combined.fastq.gz	fastq	381826650.0	7636533.0	GSM4368080 r1	0:50 1:0	A:92578473;C:90665066;G:103254018;T:95325823;N:3270	50	0	92578473	90665066	103254018	95325823	3270	SRX7826912	SRS6238047	SRA1049684	GEO	Centre for Immunity, Infection and Evolution	1	0.07185	0.00402	0.99419	0.49823	50	B	usable mapping rate	illumina	nextseq	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2020-03-02	Larval	Larval	Whole Organism	All anatomical structures
57070	57070	SRR11214399	SRX7826911	SRS6238046	SRP251256	PRJNA609696	Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq]	GSE146200	Transcriptome Analysis	Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.	parent bioproject:PRJNA609691	pubmed:28962522	JD15 [miRNA seq]	GSM4368079	source name:30 pooled larvae 5dpf triptolide for 6 h\|strain:WIK\|developmental stage:5dpf\|treatment:triptolide 1.6μM for 6 h\|tissue:30 pooled larvae\|molecule subtype:small RNA	JD15 [miRNA seq]	The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.	30 pooled larvae 5dpf triptolide for 6 h	5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes	Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.	Zebrafish Danio rerio were maintained at 28.5 °C	strain:WIK\|developmental stage:5dpf\|treatment:triptolide 1.6μM for 6 h\|tissue:30 pooled larvae\|molecule subtype:small RNA	GSM4368079	GSM4368079: JD15 [miRNA seq]; Danio rerio; ncRNA Seq	GSM4368079	1	Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.	GEO Accession:GSM4368079	ncRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	NextSeq 550	SRP251256	small_JD15.combined.fastq.gz	fastq	285535900.0	5710718.0	GSM4368079 r1	0:50 1:0	A:68624024;C:67839672;G:77291276;T:71778522;N:2406	50	0	68624024	67839672	77291276	71778522	2406	SRX7826911	SRS6238046	SRA1049684	GEO	Centre for Immunity, Infection and Evolution	1	0.07651	0.00425	0.99407	0.54635	50	B	usable mapping rate	illumina	nextseq	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2020-03-02	Larval	Larval	Whole Organism	All anatomical structures
57071	57071	SRR11214398	SRX7826910	SRS6238045	SRP251256	PRJNA609696	Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq]	GSE146200	Transcriptome Analysis	Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.	parent bioproject:PRJNA609691	pubmed:28962522	JD14 [miRNA seq]	GSM4368078	source name:30 pooled larvae 5dpf triptolide for 6 h\|strain:WIK\|developmental stage:5dpf\|treatment:triptolide 1.6μM for 6 h\|tissue:30 pooled larvae\|molecule subtype:small RNA	JD14 [miRNA seq]	The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.	30 pooled larvae 5dpf triptolide for 6 h	5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes	Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.	Zebrafish Danio rerio were maintained at 28.5 °C	strain:WIK\|developmental stage:5dpf\|treatment:triptolide 1.6μM for 6 h\|tissue:30 pooled larvae\|molecule subtype:small RNA	GSM4368078	GSM4368078: JD14 [miRNA seq]; Danio rerio; ncRNA Seq	GSM4368078	1	Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.	GEO Accession:GSM4368078	ncRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	NextSeq 550	SRP251256	small_JD14.combined.fastq.gz	fastq	363231350.0	7264627.0	GSM4368078 r1	0:50 1:0	A:87298047;C:86511359;G:98123632;T:91295160;N:3152	50	0	87298047	86511359	98123632	91295160	3152	SRX7826910	SRS6238045	SRA1049684	GEO	Centre for Immunity, Infection and Evolution	1	0.07156	0.00417	0.99314	0.49982	50	B	usable mapping rate	illumina	nextseq	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2020-03-02	Larval	Larval	Whole Organism	All anatomical structures
57072	57072	SRR11214397	SRX7826909	SRS6238044	SRP251256	PRJNA609696	Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq]	GSE146200	Transcriptome Analysis	Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.	parent bioproject:PRJNA609691	pubmed:28962522	JD13 [miRNA seq]	GSM4368077	source name:30 pooled larvae 5dpf triptolide for 6 h\|strain:WIK\|developmental stage:5dpf\|treatment:triptolide 1.6μM for 6 h\|tissue:30 pooled larvae\|molecule subtype:small RNA	JD13 [miRNA seq]	The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.	30 pooled larvae 5dpf triptolide for 6 h	5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes	Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.	Zebrafish Danio rerio were maintained at 28.5 °C	strain:WIK\|developmental stage:5dpf\|treatment:triptolide 1.6μM for 6 h\|tissue:30 pooled larvae\|molecule subtype:small RNA	GSM4368077	GSM4368077: JD13 [miRNA seq]; Danio rerio; ncRNA Seq	GSM4368077	1	Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.	GEO Accession:GSM4368077	ncRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	NextSeq 550	SRP251256	small_JD13.combined.fastq.gz	fastq	280852650.0	5617053.0	GSM4368077 r1	0:50 1:0	A:66976453;C:66985314;G:76111707;T:70776819;N:2357	50	0	66976453	66985314	76111707	70776819	2357	SRX7826909	SRS6238044	SRA1049684	GEO	Centre for Immunity, Infection and Evolution	1	0.0785	0.00403	0.99454	0.53818	50	B	usable mapping rate	illumina	nextseq	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2020-03-02	Larval	Larval	Whole Organism	All anatomical structures
57073	57073	SRR11214396	SRX7826908	SRS6238043	SRP251256	PRJNA609696	Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq]	GSE146200	Transcriptome Analysis	Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.	parent bioproject:PRJNA609691	pubmed:28962522	JD12 [miRNA seq]	GSM4368076	source name:30 pooled larvae 5dpf triptolide for 6 h\|strain:WIK\|developmental stage:5dpf\|treatment:triptolide 1.6μM for 6 h\|tissue:30 pooled larvae\|molecule subtype:small RNA	JD12 [miRNA seq]	The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.	30 pooled larvae 5dpf triptolide for 6 h	5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes	Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.	Zebrafish Danio rerio were maintained at 28.5 °C	strain:WIK\|developmental stage:5dpf\|treatment:triptolide 1.6μM for 6 h\|tissue:30 pooled larvae\|molecule subtype:small RNA	GSM4368076	GSM4368076: JD12 [miRNA seq]; Danio rerio; ncRNA Seq	GSM4368076	1	Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.	GEO Accession:GSM4368076	ncRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	NextSeq 550	SRP251256	small_JD12.combined.fastq.gz	fastq	267278950.0	5345579.0	GSM4368076 r1	0:50 1:0	A:63524573;C:63700392;G:72574389;T:67477407;N:2189	50	0	63524573	63700392	72574389	67477407	2189	SRX7826908	SRS6238043	SRA1049684	GEO	Centre for Immunity, Infection and Evolution	1	0.0867	0.00429	0.99403	0.53048	50	B	usable mapping rate	illumina	nextseq	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2020-03-02	Larval	Larval	Whole Organism	All anatomical structures
57074	57074	SRR11214395	SRX7826907	SRS6238042	SRP251256	PRJNA609696	Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq]	GSE146200	Transcriptome Analysis	Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.	parent bioproject:PRJNA609691	pubmed:28962522	JD11 [miRNA seq]	GSM4368075	source name:30 pooled larvae 5dpf triptolide for 6 h\|strain:WIK\|developmental stage:5dpf\|treatment:triptolide 1.6μM for 6 h\|tissue:30 pooled larvae\|molecule subtype:small RNA	JD11 [miRNA seq]	The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.	30 pooled larvae 5dpf triptolide for 6 h	5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes	Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.	Zebrafish Danio rerio were maintained at 28.5 °C	strain:WIK\|developmental stage:5dpf\|treatment:triptolide 1.6μM for 6 h\|tissue:30 pooled larvae\|molecule subtype:small RNA	GSM4368075	GSM4368075: JD11 [miRNA seq]; Danio rerio; ncRNA Seq	GSM4368075	1	Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.	GEO Accession:GSM4368075	ncRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	NextSeq 550	SRP251256	small_JD11.combined.fastq.gz	fastq	323802250.0	6476045.0	GSM4368075 r1	0:50 1:0	A:78153815;C:77052322;G:87557986;T:81035226;N:2901	50	0	78153815	77052322	87557986	81035226	2901	SRX7826907	SRS6238042	SRA1049684	GEO	Centre for Immunity, Infection and Evolution	1	0.06809	0.00424	0.99368	0.52229	50	B	usable mapping rate	illumina	nextseq	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2020-03-02	Larval	Larval	Whole Organism	All anatomical structures
57075	57075	SRR11214394	SRX7826906	SRS6238041	SRP251256	PRJNA609696	Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq]	GSE146200	Transcriptome Analysis	Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.	parent bioproject:PRJNA609691	pubmed:28962522	JD08 [miRNA seq]	GSM4368074	source name:30 pooled larvae 5dpf vehicle\|strain:WIK\|developmental stage:5dpf\|treatment:vehicle\|tissue:30 pooled larvae\|molecule subtype:small RNA	JD08 [miRNA seq]	The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.	30 pooled larvae 5dpf vehicle	5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes	Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.	Zebrafish Danio rerio were maintained at 28.5 °C	strain:WIK\|developmental stage:5dpf\|treatment:vehicle\|tissue:30 pooled larvae\|molecule subtype:small RNA	GSM4368074	GSM4368074: JD08 [miRNA seq]; Danio rerio; ncRNA Seq	GSM4368074	1	Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.	GEO Accession:GSM4368074	ncRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	NextSeq 550	SRP251256	small_JD08.combined.fastq.gz	fastq	375132100.0	7502642.0	GSM4368074 r1	0:50 1:0	A:89764502;C:89300619;G:101501695;T:94562105;N:3179	50	0	89764502	89300619	101501695	94562105	3179	SRX7826906	SRS6238041	SRA1049684	GEO	Centre for Immunity, Infection and Evolution	1	0.07787	0.0042	0.99338	0.52599	50	B	usable mapping rate	illumina	nextseq	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2020-03-02	Larval	Larval	Whole Organism	All anatomical structures
57076	57076	SRR11214393	SRX7826905	SRS6238040	SRP251256	PRJNA609696	Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq]	GSE146200	Transcriptome Analysis	Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.	parent bioproject:PRJNA609691	pubmed:28962522	JD07 [miRNA seq]	GSM4368073	source name:30 pooled larvae 5dpf vehicle\|strain:WIK\|developmental stage:5dpf\|treatment:vehicle\|tissue:30 pooled larvae\|molecule subtype:small RNA	JD07 [miRNA seq]	The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.	30 pooled larvae 5dpf vehicle	5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes	Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.	Zebrafish Danio rerio were maintained at 28.5 °C	strain:WIK\|developmental stage:5dpf\|treatment:vehicle\|tissue:30 pooled larvae\|molecule subtype:small RNA	GSM4368073	GSM4368073: JD07 [miRNA seq]; Danio rerio; ncRNA Seq	GSM4368073	1	Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.	GEO Accession:GSM4368073	ncRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	NextSeq 550	SRP251256	small_JD07.combined.fastq.gz	fastq	317528050.0	6350561.0	GSM4368073 r1	0:50 1:0	A:75643339;C:75642242;G:86133220;T:80106532;N:2717	50	0	75643339	75642242	86133220	80106532	2717	SRX7826905	SRS6238040	SRA1049684	GEO	Centre for Immunity, Infection and Evolution	1	0.07711	0.00424	0.9934	0.53196	50	B	usable mapping rate	illumina	nextseq	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2020-03-02	Larval	Larval	Whole Organism	All anatomical structures
57077	57077	SRR11214392	SRX7826904	SRS6238039	SRP251256	PRJNA609696	Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq]	GSE146200	Transcriptome Analysis	Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.	parent bioproject:PRJNA609691	pubmed:28962522	JD06 [miRNA seq]	GSM4368072	source name:30 pooled larvae 5dpf vehicle\|strain:WIK\|developmental stage:5dpf\|treatment:vehicle\|tissue:30 pooled larvae\|molecule subtype:small RNA	JD06 [miRNA seq]	The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.	30 pooled larvae 5dpf vehicle	5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes	Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.	Zebrafish Danio rerio were maintained at 28.5 °C	strain:WIK\|developmental stage:5dpf\|treatment:vehicle\|tissue:30 pooled larvae\|molecule subtype:small RNA	GSM4368072	GSM4368072: JD06 [miRNA seq]; Danio rerio; ncRNA Seq	GSM4368072	1	Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.	GEO Accession:GSM4368072	ncRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	NextSeq 550	SRP251256	small_JD06.combined.fastq.gz	fastq	313235150.0	6264703.0	GSM4368072 r1	0:50 1:0	A:74970317;C:74745173;G:84767516;T:78749342;N:2802	50	0	74970317	74745173	84767516	78749342	2802	SRX7826904	SRS6238039	SRA1049684	GEO	Centre for Immunity, Infection and Evolution	1	0.07206	0.00403	0.99312	0.52846	50	B	usable mapping rate	illumina	nextseq	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2020-03-02	Larval	Larval	Whole Organism	All anatomical structures
57078	57078	SRR11214391	SRX7826903	SRS6238038	SRP251256	PRJNA609696	Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq]	GSE146200	Transcriptome Analysis	Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.	parent bioproject:PRJNA609691	pubmed:28962522	JD05 [miRNA seq]	GSM4368071	source name:30 pooled larvae 5dpf vehicle\|strain:WIK\|developmental stage:5dpf\|treatment:vehicle\|tissue:30 pooled larvae\|molecule subtype:small RNA	JD05 [miRNA seq]	The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.	30 pooled larvae 5dpf vehicle	5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes	Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.	Zebrafish Danio rerio were maintained at 28.5 °C	strain:WIK\|developmental stage:5dpf\|treatment:vehicle\|tissue:30 pooled larvae\|molecule subtype:small RNA	GSM4368071	GSM4368071: JD05 [miRNA seq]; Danio rerio; ncRNA Seq	GSM4368071	1	Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.	GEO Accession:GSM4368071	ncRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	NextSeq 550	SRP251256	small_JD05.combined.fastq.gz	fastq	282608400.0	5652168.0	GSM4368071 r1	0:50 1:0	A:67639670;C:67139768;G:76678815;T:71147790;N:2357	50	0	67639670	67139768	76678815	71147790	2357	SRX7826903	SRS6238038	SRA1049684	GEO	Centre for Immunity, Infection and Evolution	1	0.07587	0.00384	0.99299	0.5434	50	B	usable mapping rate	illumina	nextseq	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2020-03-02	Larval	Larval	Whole Organism	All anatomical structures
57079	57079	SRR11214390	SRX7826902	SRS6238037	SRP251256	PRJNA609696	Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq]	GSE146200	Transcriptome Analysis	Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.	parent bioproject:PRJNA609691	pubmed:28962522	JD04 [miRNA seq]	GSM4368070	source name:30 pooled larvae 5dpf vehicle\|strain:WIK\|developmental stage:5dpf\|treatment:vehicle\|tissue:30 pooled larvae\|molecule subtype:small RNA	JD04 [miRNA seq]	The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.	30 pooled larvae 5dpf vehicle	5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes	Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.	Zebrafish Danio rerio were maintained at 28.5 °C	strain:WIK\|developmental stage:5dpf\|treatment:vehicle\|tissue:30 pooled larvae\|molecule subtype:small RNA	GSM4368070	GSM4368070: JD04 [miRNA seq]; Danio rerio; ncRNA Seq	GSM4368070	1	Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.	GEO Accession:GSM4368070	ncRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	NextSeq 550	SRP251256	small_JD04.combined.fastq.gz	fastq	289767100.0	5795342.0	GSM4368070 r1	0:50 1:0	A:69580978;C:68900579;G:78340509;T:72942639;N:2395	50	0	69580978	68900579	78340509	72942639	2395	SRX7826902	SRS6238037	SRA1049684	GEO	Centre for Immunity, Infection and Evolution	1	0.07492	0.00373	0.99295	0.52294	50	B	usable mapping rate	illumina	nextseq	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2020-03-02	Larval	Larval	Whole Organism	All anatomical structures
57080	57080	SRR11214389	SRX7826901	SRS6238036	SRP251256	PRJNA609696	Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq]	GSE146200	Transcriptome Analysis	Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.	parent bioproject:PRJNA609691	pubmed:28962522	JD03 [miRNA seq]	GSM4368069	source name:30 pooled larvae 5dpf vehicle\|strain:WIK\|developmental stage:5dpf\|treatment:vehicle\|tissue:30 pooled larvae\|molecule subtype:small RNA	JD03 [miRNA seq]	The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.	30 pooled larvae 5dpf vehicle	5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes	Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.	Zebrafish Danio rerio were maintained at 28.5 °C	strain:WIK\|developmental stage:5dpf\|treatment:vehicle\|tissue:30 pooled larvae\|molecule subtype:small RNA	GSM4368069	GSM4368069: JD03 [miRNA seq]; Danio rerio; ncRNA Seq	GSM4368069	1	Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.	GEO Accession:GSM4368069	ncRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	NextSeq 550	SRP251256	small_JD03.combined.fastq.gz	fastq	230982600.0	4619652.0	GSM4368069 r1	0:50 1:0	A:55200177;C:55003182;G:62615802;T:58161510;N:1929	50	0	55200177	55003182	62615802	58161510	1929	SRX7826901	SRS6238036	SRA1049684	GEO	Centre for Immunity, Infection and Evolution	1	0.07179	0.00361	0.99336	0.47352	50	B	usable mapping rate	illumina	nextseq	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2020-03-02	Larval	Larval	Whole Organism	All anatomical structures
57081	57081	SRR11214388	SRX7826900	SRS6238035	SRP251256	PRJNA609696	Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq]	GSE146200	Transcriptome Analysis	Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.	parent bioproject:PRJNA609691	pubmed:28962522	JD02 [miRNA seq]	GSM4368068	source name:30 pooled larvae 5dpf vehicle\|strain:WIK\|developmental stage:5dpf\|treatment:vehicle\|tissue:30 pooled larvae\|molecule subtype:small RNA	JD02 [miRNA seq]	The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.	30 pooled larvae 5dpf vehicle	5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes	Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.	Zebrafish Danio rerio were maintained at 28.5 °C	strain:WIK\|developmental stage:5dpf\|treatment:vehicle\|tissue:30 pooled larvae\|molecule subtype:small RNA	GSM4368068	GSM4368068: JD02 [miRNA seq]; Danio rerio; ncRNA Seq	GSM4368068	1	Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.	GEO Accession:GSM4368068	ncRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	NextSeq 550	SRP251256	small_JD02.combined.fastq.gz	fastq	367984500.0	7359690.0	GSM4368068 r1	0:50 1:0	A:87859797;C:87548819;G:99752643;T:92820007;N:3234	50	0	87859797	87548819	99752643	92820007	3234	SRX7826900	SRS6238035	SRA1049684	GEO	Centre for Immunity, Infection and Evolution	1	0.07619	0.00398	0.99403	0.53717	50	B	usable mapping rate	illumina	nextseq	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2020-03-02	Larval	Larval	Whole Organism	All anatomical structures
57082	57082	SRR11214387	SRX7826899	SRS6238034	SRP251256	PRJNA609696	Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq]	GSE146200	Transcriptome Analysis	Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.	parent bioproject:PRJNA609691	pubmed:28962522	JD01 [miRNA seq]	GSM4368067	source name:30 pooled larvae 5dpf vehicle\|strain:WIK\|developmental stage:5dpf\|treatment:vehicle\|tissue:30 pooled larvae\|molecule subtype:small RNA	JD01 [miRNA seq]	The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.	30 pooled larvae 5dpf vehicle	5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes	Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.	Zebrafish Danio rerio were maintained at 28.5 °C	strain:WIK\|developmental stage:5dpf\|treatment:vehicle\|tissue:30 pooled larvae\|molecule subtype:small RNA	GSM4368067	GSM4368067: JD01 [miRNA seq]; Danio rerio; ncRNA Seq	GSM4368067	1	Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.	GEO Accession:GSM4368067	ncRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	NextSeq 550	SRP251256	small_JD01.combined.fastq.gz	fastq	374941900.0	7498838.0	GSM4368067 r1	0:50 1:0	A:90013932;C:89307034;G:101275933;T:94341753;N:3248	50	0	90013932	89307034	101275933	94341753	3248	SRX7826899	SRS6238034	SRA1049684	GEO	Centre for Immunity, Infection and Evolution	1	0.07456	0.00386	0.99399	0.52664	50	B	usable mapping rate	illumina	nextseq	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2020-03-02	Larval	Larval	Whole Organism	All anatomical structures
63643	63643	SRR13979112	SRX10356673	SRS8474629	SRP310924	PRJNA714931	Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks	GSE169013	Transcriptome Analysis	Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con…		pubmed:33898466	miRNA TiBP rep4	GSM5174052	tissue:zebrafish whole embryos\|strain:5D\|developmental stage:48 hpf	miRNA TiBP rep4	For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample	zebrafish whole embryos	Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA		strain:5D\|developmental stage:48 hpf	GSM5174052	GSM5174052: miRNA TiBP rep4; Danio rerio; miRNA Seq	GSM5174052	1	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA	GEO Accession:GSM5174052	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP310924	miRNA_lane1-s028-indexRPI28-CAAAAG-52_S28_L001_R1_001.fastq.gz	fastq	910334614.0	9013214.0	GSM5174052 r1	0:101 1:0	A:290447743;C:219962173;G:188092578;T:211816048;N:16072	101	0	290447743	219962173	188092578	211816048	16072	SRX10356673	SRS8474629	SRA1207022	GEO	Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University	1	0.00011	0.0	0.99967	0.75	101	T	under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2021-03-16	Hatching	Embryo	Whole Organism	All anatomical structures
63644	63644	SRR13979111	SRX10356672	SRS8474628	SRP310924	PRJNA714931	Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks	GSE169013	Transcriptome Analysis	Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con…		pubmed:33898466	miRNA TiBP rep3	GSM5174051	tissue:zebrafish whole embryos\|strain:5D\|developmental stage:48 hpf	miRNA TiBP rep3	For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample	zebrafish whole embryos	Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA		strain:5D\|developmental stage:48 hpf	GSM5174051	GSM5174051: miRNA TiBP rep3; Danio rerio; miRNA Seq	GSM5174051	1	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA	GEO Accession:GSM5174051	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP310924	miRNA_lane1-s027-indexRPI27-ATTCCT-51_S27_L001_R1_001.fastq.gz	fastq	1206610034.0	11946634.0	GSM5174051 r1	0:101 1:0	A:350061820;C:302802434;G:235521116;T:318199102;N:25562	101	0	350061820	302802434	235521116	318199102	25562	SRX10356672	SRS8474628	SRA1207022	GEO	Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University	1	0.00013	0.0	0.99965	0.79166	101	T	under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2021-03-16	Hatching	Embryo	Whole Organism	All anatomical structures
63645	63645	SRR13979110	SRX10356671	SRS8474626	SRP310924	PRJNA714931	Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks	GSE169013	Transcriptome Analysis	Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con…		pubmed:33898466	miRNA TiBP rep2	GSM5174050	tissue:zebrafish whole embryos\|strain:5D\|developmental stage:48 hpf	miRNA TiBP rep2	For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample	zebrafish whole embryos	Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA		strain:5D\|developmental stage:48 hpf	GSM5174050	GSM5174050: miRNA TiBP rep2; Danio rerio; miRNA Seq	GSM5174050	1	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA	GEO Accession:GSM5174050	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP310924	miRNA_lane1-s026-indexRPI26-ATGAGC-50_S26_L001_R1_001.fastq.gz	fastq	464537279.0	4599379.0	GSM5174050 r1	0:101 1:0	A:139497834;C:112216637;G:99887123;T:112926329;N:9356	101	0	139497834	112216637	99887123	112926329	9356	SRX10356671	SRS8474626	SRA1207022	GEO	Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University	1	0.00022	1e-05	0.99955	0.61538	101	T	under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2021-03-16	Hatching	Embryo	Whole Organism	All anatomical structures
63646	63646	SRR13979109	SRX10356670	SRS8474627	SRP310924	PRJNA714931	Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks	GSE169013	Transcriptome Analysis	Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con…		pubmed:33898466	miRNA TiBP rep1	GSM5174049	tissue:zebrafish whole embryos\|strain:5D\|developmental stage:48 hpf	miRNA TiBP rep1	For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample	zebrafish whole embryos	Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA		strain:5D\|developmental stage:48 hpf	GSM5174049	GSM5174049: miRNA TiBP rep1; Danio rerio; miRNA Seq	GSM5174049	1	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA	GEO Accession:GSM5174049	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP310924	miRNA_lane1-s025-indexRPI25-ACTGAT-49_S25_L001_R1_001.fastq.gz	fastq	1146926508.0	11355708.0	GSM5174049 r1	0:101 1:0	A:344954395;C:275566512;G:235491109;T:290891698;N:22794	101	0	344954395	275566512	235491109	290891698	22794	SRX10356670	SRS8474627	SRA1207022	GEO	Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University	1	0.00019	1e-05	0.99965	0.71875	101	T	under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2021-03-16	Hatching	Embryo	Whole Organism	All anatomical structures
63647	63647	SRR13979108	SRX10356669	SRS8474625	SRP310924	PRJNA714931	Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks	GSE169013	Transcriptome Analysis	Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con…		pubmed:33898466	miRNA TPP rep4	GSM5174048	tissue:zebrafish whole embryos\|strain:5D\|developmental stage:48 hpf	miRNA TPP rep4	For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample	zebrafish whole embryos	Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA		strain:5D\|developmental stage:48 hpf	GSM5174048	GSM5174048: miRNA TPP rep4; Danio rerio; miRNA Seq	GSM5174048	1	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA	GEO Accession:GSM5174048	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP310924	miRNA_lane1-s036-indexRPI36-CCAACA-60_S36_L001_R1_001.fastq.gz	fastq	927517340.0	9183340.0	GSM5174048 r1	0:101 1:0	A:288988916;C:242744912;G:181427113;T:214337769;N:18630	101	0	288988916	242744912	181427113	214337769	18630	SRX10356669	SRS8474625	SRA1207022	GEO	Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University	1	0.00023	1e-05	0.99955	0.70731	101	T	under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2021-03-16	Hatching	Embryo	Whole Organism	All anatomical structures
63648	63648	SRR13979107	SRX10356668	SRS8474624	SRP310924	PRJNA714931	Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks	GSE169013	Transcriptome Analysis	Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con…		pubmed:33898466	miRNA TPP rep3	GSM5174047	tissue:zebrafish whole embryos\|strain:5D\|developmental stage:48 hpf	miRNA TPP rep3	For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample	zebrafish whole embryos	Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA		strain:5D\|developmental stage:48 hpf	GSM5174047	GSM5174047: miRNA TPP rep3; Danio rerio; miRNA Seq	GSM5174047	1	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA	GEO Accession:GSM5174047	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP310924	miRNA_lane1-s035-indexRPI35-CATTTT-59_S35_L001_R1_001.fastq.gz	fastq	1013252907.0	10032207.0	GSM5174047 r1	0:101 1:0	A:295518831;C:243561888;G:197719671;T:276430583;N:21934	101	0	295518831	243561888	197719671	276430583	21934	SRX10356668	SRS8474624	SRA1207022	GEO	Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University	1	0.00013	0.0	0.99973	0.48	101	T	under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2021-03-16	Hatching	Embryo	Whole Organism	All anatomical structures
63649	63649	SRR13979106	SRX10356667	SRS8474623	SRP310924	PRJNA714931	Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks	GSE169013	Transcriptome Analysis	Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con…		pubmed:33898466	miRNA TPP rep2	GSM5174046	tissue:zebrafish whole embryos\|strain:5D\|developmental stage:48 hpf	miRNA TPP rep2	For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample	zebrafish whole embryos	Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA		strain:5D\|developmental stage:48 hpf	GSM5174046	GSM5174046: miRNA TPP rep2; Danio rerio; miRNA Seq	GSM5174046	1	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA	GEO Accession:GSM5174046	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP310924	miRNA_lane1-s034-indexRPI34-CATGGC-58_S34_L001_R1_001.fastq.gz	fastq	907210381.0	8982281.0	GSM5174046 r1	0:101 1:0	A:265012714;C:227793861;G:194928689;T:219454152;N:20965	101	0	265012714	227793861	194928689	219454152	20965	SRX10356667	SRS8474623	SRA1207022	GEO	Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University	1	0.00013	0.0	0.99965	0.875	101	T	under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2021-03-16	Hatching	Embryo	Whole Organism	All anatomical structures
63650	63650	SRR13979105	SRX10356666	SRS8474622	SRP310924	PRJNA714931	Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks	GSE169013	Transcriptome Analysis	Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con…		pubmed:33898466	miRNA TPP rep1	GSM5174045	tissue:zebrafish whole embryos\|strain:5D\|developmental stage:48 hpf	miRNA TPP rep1	For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample	zebrafish whole embryos	Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA		strain:5D\|developmental stage:48 hpf	GSM5174045	GSM5174045: miRNA TPP rep1; Danio rerio; miRNA Seq	GSM5174045	1	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA	GEO Accession:GSM5174045	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP310924	miRNA_lane1-s033-indexRPI33-CAGGCG-57_S33_L001_R1_001.fastq.gz	fastq	980681013.0	9709713.0	GSM5174045 r1	0:101 1:0	A:286952877;C:245397809;G:220787030;T:227522023;N:21274	101	0	286952877	245397809	220787030	227522023	21274	SRX10356666	SRS8474622	SRA1207022	GEO	Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University	1	0.00021	1e-05	0.99961	0.72222	101	T	under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2021-03-16	Hatching	Embryo	Whole Organism	All anatomical structures
63651	63651	SRR13979104	SRX10356665	SRS8474621	SRP310924	PRJNA714931	Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks	GSE169013	Transcriptome Analysis	Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con…		pubmed:33898466	miRNA TBPH rep4	GSM5174044	tissue:zebrafish whole embryos\|strain:5D\|developmental stage:48 hpf	miRNA TBPH rep4	For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample	zebrafish whole embryos	Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA		strain:5D\|developmental stage:48 hpf	GSM5174044	GSM5174044: miRNA TBPH rep4; Danio rerio; miRNA Seq	GSM5174044	1	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA	GEO Accession:GSM5174044	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP310924	miRNA_lane1-s012-indexRPI12-CTTGTA-24_S12_L001_R1_001.fastq.gz	fastq	879997850.0	8712850.0	GSM5174044 r1	0:101 1:0	A:257202916;C:211754629;G:179803383;T:231218549;N:18373	101	0	257202916	211754629	179803383	231218549	18373	SRX10356665	SRS8474621	SRA1207022	GEO	Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University	1	0.00022	0.0	0.99961	0.55	101	T	under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2021-03-16	Hatching	Embryo	Whole Organism	All anatomical structures
63652	63652	SRR13979103	SRX10356664	SRS8474620	SRP310924	PRJNA714931	Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks	GSE169013	Transcriptome Analysis	Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con…		pubmed:33898466	miRNA TBPH rep3	GSM5174043	tissue:zebrafish whole embryos\|strain:5D\|developmental stage:48 hpf	miRNA TBPH rep3	For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample	zebrafish whole embryos	Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA		strain:5D\|developmental stage:48 hpf	GSM5174043	GSM5174043: miRNA TBPH rep3; Danio rerio; miRNA Seq	GSM5174043	1	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA	GEO Accession:GSM5174043	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP310924	miRNA_lane1-s011-indexRPI11-GGCTAC-23_S11_L001_R1_001.fastq.gz	fastq	883707883.0	8749583.0	GSM5174043 r1	0:101 1:0	A:256575313;C:222504855;G:189827000;T:214781797;N:18918	101	0	256575313	222504855	189827000	214781797	18918	SRX10356664	SRS8474620	SRA1207022	GEO	Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University	1	0.00021	0.0	0.99961	0.725	101	T	under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2021-03-16	Hatching	Embryo	Whole Organism	All anatomical structures
63653	63653	SRR13979102	SRX10356663	SRS8474619	SRP310924	PRJNA714931	Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks	GSE169013	Transcriptome Analysis	Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con…		pubmed:33898466	miRNA TBPH rep2	GSM5174042	tissue:zebrafish whole embryos\|strain:5D\|developmental stage:48 hpf	miRNA TBPH rep2	For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample	zebrafish whole embryos	Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA		strain:5D\|developmental stage:48 hpf	GSM5174042	GSM5174042: miRNA TBPH rep2; Danio rerio; miRNA Seq	GSM5174042	1	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA	GEO Accession:GSM5174042	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP310924	miRNA_lane1-s010-indexRPI10-TAGCTT-22_S10_L001_R1_001.fastq.gz	fastq	727499667.0	7202967.0	GSM5174042 r1	0:101 1:0	A:212029291;C:175832603;G:148851978;T:190770471;N:15324	101	0	212029291	175832603	148851978	190770471	15324	SRX10356663	SRS8474619	SRA1207022	GEO	Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University	1	0.00025	1e-05	0.99951	0.68181	101	T	under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2021-03-16	Hatching	Embryo	Whole Organism	All anatomical structures
63654	63654	SRR13979101	SRX10356662	SRS8474618	SRP310924	PRJNA714931	Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks	GSE169013	Transcriptome Analysis	Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con…		pubmed:33898466	miRNA TBPH rep1	GSM5174041	tissue:zebrafish whole embryos\|strain:5D\|developmental stage:48 hpf	miRNA TBPH rep1	For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample	zebrafish whole embryos	Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA		strain:5D\|developmental stage:48 hpf	GSM5174041	GSM5174041: miRNA TBPH rep1; Danio rerio; miRNA Seq	GSM5174041	1	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA	GEO Accession:GSM5174041	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP310924	miRNA_lane1-s009-indexRPI9-GATCAG-21_S9_L001_R1_001.fastq.gz	fastq	351322743.0	3478443.0	GSM5174041 r1	0:101 1:0	A:105338110;C:85172820;G:75749691;T:85054964;N:7158	101	0	105338110	85172820	75749691	85054964	7158	SRX10356662	SRS8474618	SRA1207022	GEO	Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University	1	0.00036	1e-05	0.99953	0.52238	101	T	under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2021-03-16	Hatching	Embryo	Whole Organism	All anatomical structures
63655	63655	SRR13979100	SRX10356661	SRS8474616	SRP310924	PRJNA714931	Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks	GSE169013	Transcriptome Analysis	Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con…		pubmed:33898466	miRNA TCEP rep4	GSM5174040	tissue:zebrafish whole embryos\|strain:5D\|developmental stage:48 hpf	miRNA TCEP rep4	For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample	zebrafish whole embryos	Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA		strain:5D\|developmental stage:48 hpf	GSM5174040	GSM5174040: miRNA TCEP rep4; Danio rerio; miRNA Seq	GSM5174040	1	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA	GEO Accession:GSM5174040	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP310924	miRNA_lane1-s044-indexRPI44-TATAAT-72_S44_L001_R1_001.fastq.gz	fastq	904258656.0	8953056.0	GSM5174040 r1	0:101 1:0	A:282578101;C:207780974;G:175938229;T:237943510;N:17842	101	0	282578101	207780974	175938229	237943510	17842	SRX10356661	SRS8474616	SRA1207022	GEO	Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University	1	0.0002	0.0	0.99951	0.72972	101	T	under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2021-03-16	Hatching	Embryo	Whole Organism	All anatomical structures
63656	63656	SRR13979099	SRX10356660	SRS8474615	SRP310924	PRJNA714931	Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks	GSE169013	Transcriptome Analysis	Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con…		pubmed:33898466	miRNA TCEP rep3	GSM5174039	tissue:zebrafish whole embryos\|strain:5D\|developmental stage:48 hpf	miRNA TCEP rep3	For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample	zebrafish whole embryos	Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA		strain:5D\|developmental stage:48 hpf	GSM5174039	GSM5174039: miRNA TCEP rep3; Danio rerio; miRNA Seq	GSM5174039	1	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA	GEO Accession:GSM5174039	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP310924	miRNA_lane1-s043-indexRPI43-TACAGC-71_S43_L001_R1_001.fastq.gz	fastq	908098777.0	8991077.0	GSM5174039 r1	0:101 1:0	A:274350569;C:227463819;G:185316266;T:220948697;N:19426	101	0	274350569	227463819	185316266	220948697	19426	SRX10356660	SRS8474615	SRA1207022	GEO	Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University	1	0.00015	0.0	0.99965	0.57142	101	T	under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2021-03-16	Hatching	Embryo	Whole Organism	All anatomical structures
63657	63657	SRR13979098	SRX10356659	SRS8474617	SRP310924	PRJNA714931	Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks	GSE169013	Transcriptome Analysis	Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con…		pubmed:33898466	miRNA TCEP rep2	GSM5174038	tissue:zebrafish whole embryos\|strain:5D\|developmental stage:48 hpf	miRNA TCEP rep2	For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample	zebrafish whole embryos	Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA		strain:5D\|developmental stage:48 hpf	GSM5174038	GSM5174038: miRNA TCEP rep2; Danio rerio; miRNA Seq	GSM5174038	1	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA	GEO Accession:GSM5174038	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP310924	miRNA_lane1-s042-indexRPI42-TAATCG-70_S42_L001_R1_001.fastq.gz	fastq	738320403.0	7310103.0	GSM5174038 r1	0:101 1:0	A:221107544;C:178181142;G:152128298;T:186889068;N:14351	101	0	221107544	178181142	152128298	186889068	14351	SRX10356659	SRS8474617	SRA1207022	GEO	Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University	1	0.00017	0.0	0.99965	0.59375	101	T	under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2021-03-16	Hatching	Embryo	Whole Organism	All anatomical structures
63658	63658	SRR13979097	SRX10356658	SRS8474612	SRP310924	PRJNA714931	Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks	GSE169013	Transcriptome Analysis	Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con…		pubmed:33898466	miRNA TCEP rep1	GSM5174037	tissue:zebrafish whole embryos\|strain:5D\|developmental stage:48 hpf	miRNA TCEP rep1	For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample	zebrafish whole embryos	Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA		strain:5D\|developmental stage:48 hpf	GSM5174037	GSM5174037: miRNA TCEP rep1; Danio rerio; miRNA Seq	GSM5174037	1	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA	GEO Accession:GSM5174037	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP310924	miRNA_lane1-s041-indexRPI41-GACGAC-69_S41_L001_R1_001.fastq.gz	fastq	470221761.0	4655661.0	GSM5174037 r1	0:101 1:0	A:142688200;C:117856681;G:100380615;T:109286679;N:9586	101	0	142688200	117856681	100380615	109286679	9586	SRX10356658	SRS8474612	SRA1207022	GEO	Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University	1	0.00028	1e-05	0.99951	0.66666	101	T	under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2021-03-16	Hatching	Embryo	Whole Organism	All anatomical structures
63659	63659	SRR13979096	SRX10356657	SRS8474613	SRP310924	PRJNA714931	Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks	GSE169013	Transcriptome Analysis	Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con…		pubmed:33898466	miRNA TDBPP rep4	GSM5174036	tissue:zebrafish whole embryos\|strain:5D\|developmental stage:48 hpf	miRNA TDBPP rep4	For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample	zebrafish whole embryos	Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA		strain:5D\|developmental stage:48 hpf	GSM5174036	GSM5174036: miRNA TDBPP rep4; Danio rerio; miRNA Seq	GSM5174036	1	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA	GEO Accession:GSM5174036	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP310924	miRNA_lane1-s024-indexRPI24-GGTAGC-48_S24_L001_R1_001.fastq.gz	fastq	889897668.0	8810868.0	GSM5174036 r1	0:101 1:0	A:253810688;C:216798740;G:203615337;T:215653771;N:19132	101	0	253810688	216798740	203615337	215653771	19132	SRX10356657	SRS8474613	SRA1207022	GEO	Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University	1	0.00019	0.0	0.99963	0.41176	101	T	under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2021-03-16	Hatching	Embryo	Whole Organism	All anatomical structures
63660	63660	SRR13979095	SRX10356656	SRS8474614	SRP310924	PRJNA714931	Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks	GSE169013	Transcriptome Analysis	Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con…		pubmed:33898466	miRNA TDBPP rep3	GSM5174035	tissue:zebrafish whole embryos\|strain:5D\|developmental stage:48 hpf	miRNA TDBPP rep3	For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample	zebrafish whole embryos	Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA		strain:5D\|developmental stage:48 hpf	GSM5174035	GSM5174035: miRNA TDBPP rep3; Danio rerio; miRNA Seq	GSM5174035	1	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA	GEO Accession:GSM5174035	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP310924	miRNA_lane1-s023-indexRPI23-GAGTGG-47_S23_L001_R1_001.fastq.gz	fastq	528666623.0	5234323.0	GSM5174035 r1	0:101 1:0	A:145917522;C:125201606;G:128827845;T:128709318;N:10332	101	0	145917522	125201606	128827845	128709318	10332	SRX10356656	SRS8474614	SRA1207022	GEO	Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University	1	0.00024	0.0	0.99961	0.56818	101	T	under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2021-03-16	Hatching	Embryo	Whole Organism	All anatomical structures
63661	63661	SRR13979094	SRX10356655	SRS8474609	SRP310924	PRJNA714931	Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks	GSE169013	Transcriptome Analysis	Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con…		pubmed:33898466	miRNA TDBPP rep2	GSM5174034	tissue:zebrafish whole embryos\|strain:5D\|developmental stage:48 hpf	miRNA TDBPP rep2	For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample	zebrafish whole embryos	Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA		strain:5D\|developmental stage:48 hpf	GSM5174034	GSM5174034: miRNA TDBPP rep2; Danio rerio; miRNA Seq	GSM5174034	1	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA	GEO Accession:GSM5174034	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP310924	miRNA_lane1-s022-indexRPI22-CGTACG-46_S22_L001_R1_001.fastq.gz	fastq	906963537.0	8979837.0	GSM5174034 r1	0:101 1:0	A:246251307;C:236436405;G:206539134;T:217717657;N:19034	101	0	246251307	236436405	206539134	217717657	19034	SRX10356655	SRS8474609	SRA1207022	GEO	Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University	1	0.00015	0.0	0.99967	0.65384	101	T	under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2021-03-16	Hatching	Embryo	Whole Organism	All anatomical structures
63662	63662	SRR13979093	SRX10356654	SRS8474611	SRP310924	PRJNA714931	Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks	GSE169013	Transcriptome Analysis	Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con…		pubmed:33898466	miRNA TDBPP rep1	GSM5174033	tissue:zebrafish whole embryos\|strain:5D\|developmental stage:48 hpf	miRNA TDBPP rep1	For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample	zebrafish whole embryos	Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA		strain:5D\|developmental stage:48 hpf	GSM5174033	GSM5174033: miRNA TDBPP rep1; Danio rerio; miRNA Seq	GSM5174033	1	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA	GEO Accession:GSM5174033	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP310924	miRNA_lane1-s021-indexRPI21-GTTTCG-45_S21_L001_R1_001.fastq.gz	fastq	556898547.0	5513847.0	GSM5174033 r1	0:101 1:0	A:149304325;C:137357612;G:124103413;T:146121425;N:11772	101	0	149304325	137357612	124103413	146121425	11772	SRX10356654	SRS8474611	SRA1207022	GEO	Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University	1	0.00021	0.0	0.99957	0.7027	101	T	under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2021-03-16	Hatching	Embryo	Whole Organism	All anatomical structures
63663	63663	SRR13979092	SRX10356653	SRS8474610	SRP310924	PRJNA714931	Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks	GSE169013	Transcriptome Analysis	Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con…		pubmed:33898466	miRNA TCPP rep4	GSM5174032	tissue:zebrafish whole embryos\|strain:5D\|developmental stage:48 hpf	miRNA TCPP rep4	For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample	zebrafish whole embryos	Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA		strain:5D\|developmental stage:48 hpf	GSM5174032	GSM5174032: miRNA TCPP rep4; Danio rerio; miRNA Seq	GSM5174032	1	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA	GEO Accession:GSM5174032	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP310924	miRNA_lane1-s016-indexRPI16-CCGTCC-28_S16_L001_R1_001.fastq.gz	fastq	885697179.0	8769279.0	GSM5174032 r1	0:101 1:0	A:247836719;C:241737695;G:181087463;T:215012979;N:22323	101	0	247836719	241737695	181087463	215012979	22323	SRX10356653	SRS8474610	SRA1207022	GEO	Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University	1	0.00019	0.0	0.99967	0.68571	101	T	under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2021-03-16	Hatching	Embryo	Whole Organism	All anatomical structures
63664	63664	SRR13979091	SRX10356652	SRS8474608	SRP310924	PRJNA714931	Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks	GSE169013	Transcriptome Analysis	Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con…		pubmed:33898466	miRNA TCPP rep3	GSM5174031	tissue:zebrafish whole embryos\|strain:5D\|developmental stage:48 hpf	miRNA TCPP rep3	For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample	zebrafish whole embryos	Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA		strain:5D\|developmental stage:48 hpf	GSM5174031	GSM5174031: miRNA TCPP rep3; Danio rerio; miRNA Seq	GSM5174031	1	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA	GEO Accession:GSM5174031	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP310924	miRNA_lane1-s015-indexRPI15-ATGTCA-27_S15_L001_R1_001.fastq.gz	fastq	566510010.0	5609010.0	GSM5174031 r1	0:101 1:0	A:170383116;C:137048514;G:115945259;T:143122249;N:10872	101	0	170383116	137048514	115945259	143122249	10872	SRX10356652	SRS8474608	SRA1207022	GEO	Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University	1	0.00025	0.0	0.99967	0.54347	101	T	under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2021-03-16	Hatching	Embryo	Whole Organism	All anatomical structures
63665	63665	SRR13979090	SRX10356651	SRS8474607	SRP310924	PRJNA714931	Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks	GSE169013	Transcriptome Analysis	Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con…		pubmed:33898466	miRNA TCPP rep2	GSM5174030	tissue:zebrafish whole embryos\|strain:5D\|developmental stage:48 hpf	miRNA TCPP rep2	For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample	zebrafish whole embryos	Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA		strain:5D\|developmental stage:48 hpf	GSM5174030	GSM5174030: miRNA TCPP rep2; Danio rerio; miRNA Seq	GSM5174030	1	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA	GEO Accession:GSM5174030	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP310924	miRNA_lane1-s014-indexRPI14-AGTTCC-26_S14_L001_R1_001.fastq.gz	fastq	892405902.0	8835702.0	GSM5174030 r1	0:101 1:0	A:259754435;C:224608997;G:182748088;T:225275385;N:18997	101	0	259754435	224608997	182748088	225275385	18997	SRX10356651	SRS8474607	SRA1207022	GEO	Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University	1	0.00022	0.0	0.99951	0.64285	101	T	under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2021-03-16	Hatching	Embryo	Whole Organism	All anatomical structures
63666	63666	SRR13979089	SRX10356650	SRS8474606	SRP310924	PRJNA714931	Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks	GSE169013	Transcriptome Analysis	Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con…		pubmed:33898466	miRNA TCPP rep1	GSM5174029	tissue:zebrafish whole embryos\|strain:5D\|developmental stage:48 hpf	miRNA TCPP rep1	For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample	zebrafish whole embryos	Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA		strain:5D\|developmental stage:48 hpf	GSM5174029	GSM5174029: miRNA TCPP rep1; Danio rerio; miRNA Seq	GSM5174029	1	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA	GEO Accession:GSM5174029	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP310924	miRNA_lane1-s013-indexRPI13-AGTCAA-25_S13_L001_R1_001.fastq.gz	fastq	1059166295.0	10486795.0	GSM5174029 r1	0:101 1:0	A:329962449;C:255719926;G:216763563;T:256700660;N:19697	101	0	329962449	255719926	216763563	256700660	19697	SRX10356650	SRS8474606	SRA1207022	GEO	Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University	1	0.00013	1e-05	0.99969	0.63636	101	T	under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2021-03-16	Hatching	Embryo	Whole Organism	All anatomical structures
63667	63667	SRR13979088	SRX10356649	SRS8474605	SRP310924	PRJNA714931	Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks	GSE169013	Transcriptome Analysis	Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con…		pubmed:33898466	miRNA TBBPA rep4	GSM5174028	tissue:zebrafish whole embryos\|strain:5D\|developmental stage:48 hpf	miRNA TBBPA rep4	For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample	zebrafish whole embryos	Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA		strain:5D\|developmental stage:48 hpf	GSM5174028	GSM5174028: miRNA TBBPA rep4; Danio rerio; miRNA Seq	GSM5174028	1	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA	GEO Accession:GSM5174028	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP310924	miRNA_lane1-s008-indexRPI8-ACTTGA-20_S8_L001_R1_001.fastq.gz	fastq	868526270.0	8599270.0	GSM5174028 r1	0:101 1:0	A:259616680;C:210636450;G:178110756;T:220145615;N:16769	101	0	259616680	210636450	178110756	220145615	16769	SRX10356649	SRS8474605	SRA1207022	GEO	Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University	1	0.00023	0.0	0.99961	0.67441	101	T	under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2021-03-16	Hatching	Embryo	Whole Organism	All anatomical structures
63668	63668	SRR13979087	SRX10356648	SRS8474604	SRP310924	PRJNA714931	Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks	GSE169013	Transcriptome Analysis	Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con…		pubmed:33898466	miRNA TBBPA rep3	GSM5174027	tissue:zebrafish whole embryos\|strain:5D\|developmental stage:48 hpf	miRNA TBBPA rep3	For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample	zebrafish whole embryos	Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA		strain:5D\|developmental stage:48 hpf	GSM5174027	GSM5174027: miRNA TBBPA rep3; Danio rerio; miRNA Seq	GSM5174027	1	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA	GEO Accession:GSM5174027	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP310924	miRNA_lane1-s007-indexRPI7-CAGATC-19_S7_L001_R1_001.fastq.gz	fastq	493578011.0	4886911.0	GSM5174027 r1	0:101 1:0	A:147046152;C:124953541;G:102431606;T:119137120;N:9592	101	0	147046152	124953541	102431606	119137120	9592	SRX10356648	SRS8474604	SRA1207022	GEO	Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University	1	0.00024	1e-05	0.99947	0.76744	101	T	under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2021-03-16	Hatching	Embryo	Whole Organism	All anatomical structures
63669	63669	SRR13979086	SRX10356647	SRS8474603	SRP310924	PRJNA714931	Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks	GSE169013	Transcriptome Analysis	Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con…		pubmed:33898466	miRNA TBBPA rep2	GSM5174026	tissue:zebrafish whole embryos\|strain:5D\|developmental stage:48 hpf	miRNA TBBPA rep2	For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample	zebrafish whole embryos	Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA		strain:5D\|developmental stage:48 hpf	GSM5174026	GSM5174026: miRNA TBBPA rep2; Danio rerio; miRNA Seq	GSM5174026	1	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA	GEO Accession:GSM5174026	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP310924	miRNA_lane1-s006-indexRPI6-GCCAAT-18_S6_L001_R1_001.fastq.gz	fastq	910368853.0	9013553.0	GSM5174026 r1	0:101 1:0	A:270122236;C:230334670;G:190520709;T:219373774;N:17464	101	0	270122236	230334670	190520709	219373774	17464	SRX10356647	SRS8474603	SRA1207022	GEO	Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University	1	0.00023	0.0	0.99949	0.72727	101	T	under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2021-03-16	Hatching	Embryo	Whole Organism	All anatomical structures
63670	63670	SRR13979085	SRX10356646	SRS8474602	SRP310924	PRJNA714931	Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks	GSE169013	Transcriptome Analysis	Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con…		pubmed:33898466	miRNA TBBPA rep1	GSM5174025	tissue:zebrafish whole embryos\|strain:5D\|developmental stage:48 hpf	miRNA TBBPA rep1	For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample	zebrafish whole embryos	Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA		strain:5D\|developmental stage:48 hpf	GSM5174025	GSM5174025: miRNA TBBPA rep1; Danio rerio; miRNA Seq	GSM5174025	1	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA	GEO Accession:GSM5174025	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP310924	miRNA_lane1-s005-indexRPI5-ACAGTG-17_S5_L001_R1_001.fastq.gz	fastq	894131992.0	8852792.0	GSM5174025 r1	0:101 1:0	A:261443048;C:220215927;G:200185007;T:212270956;N:17054	101	0	261443048	220215927	200185007	212270956	17054	SRX10356646	SRS8474602	SRA1207022	GEO	Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University	1	0.00021	1e-05	0.99953	0.7027	101	T	under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2021-03-16	Hatching	Embryo	Whole Organism	All anatomical structures
63671	63671	SRR13979084	SRX10356645	SRS8474601	SRP310924	PRJNA714931	Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks	GSE169013	Transcriptome Analysis	Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con…		pubmed:33898466	miRNA TBBPA DBPE rep4	GSM5174024	tissue:zebrafish whole embryos\|strain:5D\|developmental stage:48 hpf DBPE	miRNA TBBPA DBPE rep4	For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample	zebrafish whole embryos	Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA		strain:5D\|developmental stage:48 hpf DBPE	GSM5174024	GSM5174024: miRNA TBBPA DBPE rep4; Danio rerio; miRNA Seq	GSM5174024	1	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA	GEO Accession:GSM5174024	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP310924	miRNA_lane1-s040-indexRPI40-CTCAGA-68_S40_L001_R1_001.fastq.gz	fastq	567614950.0	5619950.0	GSM5174024 r1	0:101 1:0	A:171789620;C:142600627;G:115292068;T:137921194;N:11441	101	0	171789620	142600627	115292068	137921194	11441	SRX10356645	SRS8474601	SRA1207022	GEO	Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University	1	0.00014	0.0	0.99965	0.55555	101	T	under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2021-03-16	Hatching	Embryo	Whole Organism	All anatomical structures
63672	63672	SRR13979083	SRX10356644	SRS8474600	SRP310924	PRJNA714931	Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks	GSE169013	Transcriptome Analysis	Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con…		pubmed:33898466	miRNA TBBPA DBPE rep3	GSM5174023	tissue:zebrafish whole embryos\|strain:5D\|developmental stage:48 hpf DBPE	miRNA TBBPA DBPE rep3	For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample	zebrafish whole embryos	Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA		strain:5D\|developmental stage:48 hpf DBPE	GSM5174023	GSM5174023: miRNA TBBPA DBPE rep3; Danio rerio; miRNA Seq	GSM5174023	1	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA	GEO Accession:GSM5174023	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP310924	miRNA_lane1-s039-indexRPI39-CTATAC-67_S39_L001_R1_001.fastq.gz	fastq	883651020.0	8749020.0	GSM5174023 r1	0:101 1:0	A:267266527;C:221471697;G:172032269;T:222861646;N:18881	101	0	267266527	221471697	172032269	222861646	18881	SRX10356644	SRS8474600	SRA1207022	GEO	Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University	1	0.00024	1e-05	0.99959	0.65116	101	T	under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2021-03-16	Hatching	Embryo	Whole Organism	All anatomical structures
63673	63673	SRR13979082	SRX10356643	SRS8474599	SRP310924	PRJNA714931	Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks	GSE169013	Transcriptome Analysis	Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con…		pubmed:33898466	miRNA TBBPA DBPE rep2	GSM5174022	tissue:zebrafish whole embryos\|strain:5D\|developmental stage:48 hpf DBPE	miRNA TBBPA DBPE rep2	For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample	zebrafish whole embryos	Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA		strain:5D\|developmental stage:48 hpf DBPE	GSM5174022	GSM5174022: miRNA TBBPA DBPE rep2; Danio rerio; miRNA Seq	GSM5174022	1	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA	GEO Accession:GSM5174022	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP310924	miRNA_lane1-s038-indexRPI38-CTAGCT-66_S38_L001_R1_001.fastq.gz	fastq	311086666.0	3080066.0	GSM5174022 r1	0:101 1:0	A:90852851;C:77957592;G:63570096;T:78699630;N:6497	101	0	90852851	77957592	63570096	78699630	6497	SRX10356643	SRS8474599	SRA1207022	GEO	Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University	1	0.00036	1e-05	0.99947	0.6875	101	T	under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2021-03-16	Hatching	Embryo	Whole Organism	All anatomical structures
63674	63674	SRR13979081	SRX10356642	SRS8474598	SRP310924	PRJNA714931	Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks	GSE169013	Transcriptome Analysis	Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con…		pubmed:33898466	miRNA TBBPA DBPE rep1	GSM5174021	tissue:zebrafish whole embryos\|strain:5D\|developmental stage:48 hpf DBPE	miRNA TBBPA DBPE rep1	For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample	zebrafish whole embryos	Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA		strain:5D\|developmental stage:48 hpf DBPE	GSM5174021	GSM5174021: miRNA TBBPA DBPE rep1; Danio rerio; miRNA Seq	GSM5174021	1	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA	GEO Accession:GSM5174021	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP310924	miRNA_lane1-s037-indexRPI37-CGGAAT-65_S37_L001_R1_001.fastq.gz	fastq	1002314506.0	9923906.0	GSM5174021 r1	0:101 1:0	A:303735625;C:240217618;G:214324562;T:244016797;N:19904	101	0	303735625	240217618	214324562	244016797	19904	SRX10356642	SRS8474598	SRA1207022	GEO	Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University	1	0.00024	1e-05	0.99953	0.66666	101	T	under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2021-03-16	Hatching	Embryo	Whole Organism	All anatomical structures
63675	63675	SRR13979080	SRX10356641	SRS8474597	SRP310924	PRJNA714931	Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks	GSE169013	Transcriptome Analysis	Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con…		pubmed:33898466	miRNA IPP rep4	GSM5174020	tissue:zebrafish whole embryos\|strain:5D\|developmental stage:48 hpf	miRNA IPP rep4	For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample	zebrafish whole embryos	Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA		strain:5D\|developmental stage:48 hpf	GSM5174020	GSM5174020: miRNA IPP rep4; Danio rerio; miRNA Seq	GSM5174020	1	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA	GEO Accession:GSM5174020	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP310924	miRNA_lane1-s032-indexRPI32-CACTCA-56_S32_L001_R1_001.fastq.gz	fastq	1129258881.0	11180781.0	GSM5174020 r1	0:101 1:0	A:335239774;C:296599595;G:223965990;T:273431685;N:21837	101	0	335239774	296599595	223965990	273431685	21837	SRX10356641	SRS8474597	SRA1207022	GEO	Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University	1	0.00013	0.0	0.99959	0.75	101	T	under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2021-03-16	Hatching	Embryo	Whole Organism	All anatomical structures
63676	63676	SRR13979079	SRX10356640	SRS8474596	SRP310924	PRJNA714931	Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks	GSE169013	Transcriptome Analysis	Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con…		pubmed:33898466	miRNA IPP rep3	GSM5174019	tissue:zebrafish whole embryos\|strain:5D\|developmental stage:48 hpf	miRNA IPP rep3	For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample	zebrafish whole embryos	Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA		strain:5D\|developmental stage:48 hpf	GSM5174019	GSM5174019: miRNA IPP rep3; Danio rerio; miRNA Seq	GSM5174019	1	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA	GEO Accession:GSM5174019	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP310924	miRNA_lane1-s031-indexRPI31-CACGAT-55_S31_L001_R1_001.fastq.gz	fastq	1364695941.0	13511841.0	GSM5174019 r1	0:101 1:0	A:408343873;C:341704999;G:281119661;T:333499060;N:28348	101	0	408343873	341704999	281119661	333499060	28348	SRX10356640	SRS8474596	SRA1207022	GEO	Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University	1	0.00016	0.0	0.99961	0.68965	101	T	under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2021-03-16	Hatching	Embryo	Whole Organism	All anatomical structures
63677	63677	SRR13979078	SRX10356639	SRS8474595	SRP310924	PRJNA714931	Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks	GSE169013	Transcriptome Analysis	Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con…		pubmed:33898466	miRNA IPP rep2	GSM5174018	tissue:zebrafish whole embryos\|strain:5D\|developmental stage:48 hpf	miRNA IPP rep2	For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample	zebrafish whole embryos	Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA		strain:5D\|developmental stage:48 hpf	GSM5174018	GSM5174018: miRNA IPP rep2; Danio rerio; miRNA Seq	GSM5174018	1	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA	GEO Accession:GSM5174018	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP310924	miRNA_lane1-s030-indexRPI30-CACCGG-54_S30_L001_R1_001.fastq.gz	fastq	1118435923.0	11073623.0	GSM5174018 r1	0:101 1:0	A:322914077;C:292720303;G:241919484;T:260855307;N:26752	101	0	322914077	292720303	241919484	260855307	26752	SRX10356639	SRS8474595	SRA1207022	GEO	Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University	1	0.0002	1e-05	0.99959	0.74285	101	T	under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2021-03-16	Hatching	Embryo	Whole Organism	All anatomical structures
63678	63678	SRR13979077	SRX10356638	SRS8474594	SRP310924	PRJNA714931	Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks	GSE169013	Transcriptome Analysis	Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con…		pubmed:33898466	miRNA IPP rep1	GSM5174017	tissue:zebrafish whole embryos\|strain:5D\|developmental stage:48 hpf	miRNA IPP rep1	For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample	zebrafish whole embryos	Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA		strain:5D\|developmental stage:48 hpf	GSM5174017	GSM5174017: miRNA IPP rep1; Danio rerio; miRNA Seq	GSM5174017	1	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA	GEO Accession:GSM5174017	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP310924	miRNA_lane1-s029-indexRPI29-CAACTA-53_S29_L001_R1_001.fastq.gz	fastq	965915217.0	9563517.0	GSM5174017 r1	0:101 1:0	A:298517953;C:241792467;G:190277966;T:235308237;N:18594	101	0	298517953	241792467	190277966	235308237	18594	SRX10356638	SRS8474594	SRA1207022	GEO	Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University	1	0.00011	0.0	0.99973	0.55	101	T	under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2021-03-16	Hatching	Embryo	Whole Organism	All anatomical structures
63679	63679	SRR13979076	SRX10356637	SRS8474593	SRP310924	PRJNA714931	Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks	GSE169013	Transcriptome Analysis	Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con…		pubmed:33898466	miRNA BDE 47 rep4	GSM5174016	tissue:zebrafish whole embryos\|strain:5D\|developmental stage:48 hpf	miRNA BDE 47 rep4	For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample	zebrafish whole embryos	Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA		strain:5D\|developmental stage:48 hpf	GSM5174016	GSM5174016: miRNA BDE 47 rep4; Danio rerio; miRNA Seq	GSM5174016	1	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA	GEO Accession:GSM5174016	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP310924	miRNA_lane1-s020-indexRPI20-GTGGCC-44_S20_L001_R1_001.fastq.gz	fastq	990919989.0	9811089.0	GSM5174016 r1	0:101 1:0	A:281268229;C:247800394;G:221010761;T:240816791;N:23814	101	0	281268229	247800394	221010761	240816791	23814	SRX10356637	SRS8474593	SRA1207022	GEO	Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University	1	0.00016	0.0	0.99965	0.7	101	T	under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2021-03-16	Hatching	Embryo	Whole Organism	All anatomical structures
63680	63680	SRR13979075	SRX10356636	SRS8474592	SRP310924	PRJNA714931	Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks	GSE169013	Transcriptome Analysis	Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con…		pubmed:33898466	miRNA BDE 47 rep3	GSM5174015	tissue:zebrafish whole embryos\|strain:5D\|developmental stage:48 hpf	miRNA BDE 47 rep3	For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample	zebrafish whole embryos	Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA		strain:5D\|developmental stage:48 hpf	GSM5174015	GSM5174015: miRNA BDE 47 rep3; Danio rerio; miRNA Seq	GSM5174015	1	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA	GEO Accession:GSM5174015	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP310924	miRNA_lane1-s019-indexRPI19-GTGAAA-43_S19_L001_R1_001.fastq.gz	fastq	936520278.0	9272478.0	GSM5174015 r1	0:101 1:0	A:292610982;C:215924738;G:200657250;T:227310895;N:16413	101	0	292610982	215924738	200657250	227310895	16413	SRX10356636	SRS8474592	SRA1207022	GEO	Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University	1	0.00017	0.0	0.99961	0.6	101	T	under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2021-03-16	Hatching	Embryo	Whole Organism	All anatomical structures
63681	63681	SRR13979074	SRX10356635	SRS8474591	SRP310924	PRJNA714931	Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks	GSE169013	Transcriptome Analysis	Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con…		pubmed:33898466	miRNA BDE 47 rep2	GSM5174014	tissue:zebrafish whole embryos\|strain:5D\|developmental stage:48 hpf	miRNA BDE 47 rep2	For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample	zebrafish whole embryos	Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA		strain:5D\|developmental stage:48 hpf	GSM5174014	GSM5174014: miRNA BDE 47 rep2; Danio rerio; miRNA Seq	GSM5174014	1	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA	GEO Accession:GSM5174014	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP310924	miRNA_lane1-s018-indexRPI18-GTCCGC-42_S18_L001_R1_001.fastq.gz	fastq	923871038.0	9147238.0	GSM5174014 r1	0:101 1:0	A:261826604;C:240583077;G:197471686;T:223966265;N:23406	101	0	261826604	240583077	197471686	223966265	23406	SRX10356635	SRS8474591	SRA1207022	GEO	Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University	1	0.00019	0.0	0.99963	0.70588	101	T	under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2021-03-16	Hatching	Embryo	Whole Organism	All anatomical structures
63682	63682	SRR13979073	SRX10356634	SRS8474588	SRP310924	PRJNA714931	Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks	GSE169013	Transcriptome Analysis	Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con…		pubmed:33898466	miRNA BDE 47 rep1	GSM5174013	tissue:zebrafish whole embryos\|strain:5D\|developmental stage:48 hpf	miRNA BDE 47 rep1	For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample	zebrafish whole embryos	Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA		strain:5D\|developmental stage:48 hpf	GSM5174013	GSM5174013: miRNA BDE 47 rep1; Danio rerio; miRNA Seq	GSM5174013	1	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA	GEO Accession:GSM5174013	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP310924	miRNA_lane1-s017-indexRPI17-GTAGAG-41_S17_L001_R1_001.fastq.gz	fastq	963214780.0	9536780.0	GSM5174013 r1	0:101 1:0	A:290268878;C:222146596;G:216903245;T:233878186;N:17875	101	0	290268878	222146596	216903245	233878186	17875	SRX10356634	SRS8474588	SRA1207022	GEO	Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University	1	0.00013	0.0	0.99971	0.58333	101	T	under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2021-03-16	Hatching	Embryo	Whole Organism	All anatomical structures
63683	63683	SRR13979072	SRX10356633	SRS8474589	SRP310924	PRJNA714931	Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks	GSE169013	Transcriptome Analysis	Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con…		pubmed:33898466	miRNA Control rep4	GSM5174012	tissue:zebrafish whole embryos\|strain:5D\|developmental stage:48 hpf	miRNA Control rep4	For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample	zebrafish whole embryos	Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA		strain:5D\|developmental stage:48 hpf	GSM5174012	GSM5174012: miRNA Control rep4; Danio rerio; miRNA Seq	GSM5174012	1	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA	GEO Accession:GSM5174012	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP310924	miRNA_lane1-s004-indexRPI4-TGACCA-4_S4_L001_R1_001.fastq.gz	fastq	776677274.0	7689874.0	GSM5174012 r1	0:101 1:0	A:233505881;C:196049592;G:158864473;T:188241779;N:15549	101	0	233505881	196049592	158864473	188241779	15549	SRX10356633	SRS8474589	SRA1207022	GEO	Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University	1	0.00024	0.0	0.99949	0.76086	101	T	under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2021-03-16	Hatching	Embryo	Whole Organism	All anatomical structures
63684	63684	SRR13979071	SRX10356632	SRS8474590	SRP310924	PRJNA714931	Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks	GSE169013	Transcriptome Analysis	Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con…		pubmed:33898466	miRNA Control rep3	GSM5174011	tissue:zebrafish whole embryos\|strain:5D\|developmental stage:48 hpf	miRNA Control rep3	For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample	zebrafish whole embryos	Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA		strain:5D\|developmental stage:48 hpf	GSM5174011	GSM5174011: miRNA Control rep3; Danio rerio; miRNA Seq	GSM5174011	1	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA	GEO Accession:GSM5174011	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP310924	miRNA_lane1-s003-indexRPI3-TTAGGC-3_S3_L001_R1_001.fastq.gz	fastq	489457615.0	4846115.0	GSM5174011 r1	0:101 1:0	A:141598763;C:118796680;G:105152559;T:123899061;N:10552	101	0	141598763	118796680	105152559	123899061	10552	SRX10356632	SRS8474590	SRA1207022	GEO	Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University	1	0.00037	0.0	0.99947	0.66666	101	T	under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2021-03-16	Hatching	Embryo	Whole Organism	All anatomical structures
63685	63685	SRR13979070	SRX10356631	SRS8474586	SRP310924	PRJNA714931	Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks	GSE169013	Transcriptome Analysis	Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con…		pubmed:33898466	miRNA Control rep2	GSM5174010	tissue:zebrafish whole embryos\|strain:5D\|developmental stage:48 hpf	miRNA Control rep2	For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample	zebrafish whole embryos	Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA		strain:5D\|developmental stage:48 hpf	GSM5174010	GSM5174010: miRNA Control rep2; Danio rerio; miRNA Seq	GSM5174010	1	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA	GEO Accession:GSM5174010	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP310924	miRNA_lane1-s002-indexRPI2-CGATGT-2_S2_L001_R1_001.fastq.gz	fastq	777242066.0	7695466.0	GSM5174010 r1	0:101 1:0	A:226389551;C:187485077;G:166405949;T:196945091;N:16398	101	0	226389551	187485077	166405949	196945091	16398	SRX10356631	SRS8474586	SRA1207022	GEO	Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University	1	0.00026	0.0	0.99957	0.62	101	T	under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2021-03-16	Hatching	Embryo	Whole Organism	All anatomical structures
63686	63686	SRR13979069	SRX10356630	SRS8474585	SRP310924	PRJNA714931	Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks	GSE169013	Transcriptome Analysis	Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and con…		pubmed:33898466	miRNA Control rep1	GSM5174009	tissue:zebrafish whole embryos\|strain:5D\|developmental stage:48 hpf	miRNA Control rep1	For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample	zebrafish whole embryos	Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA		strain:5D\|developmental stage:48 hpf	GSM5174009	GSM5174009: miRNA Control rep1; Danio rerio; miRNA Seq	GSM5174009	1	FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA	GEO Accession:GSM5174009	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP310924	miRNA_lane1-s001-indexRPI1-ATCACG-1_S1_L001_R1_001.fastq.gz	fastq	370858163.0	3671863.0	GSM5174009 r1	0:101 1:0	A:112058381;C:93306905;G:75506546;T:89979021;N:7310	101	0	112058381	93306905	75506546	89979021	7310	SRX10356630	SRS8474585	SRA1207022	GEO	Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University	1	0.00033	1e-05	0.99949	0.64516	101	T	under 1.2% mapping rate	illumina	hiseq_era	unknown	size_fractionation	trueseq	bulk	bulk	bulk	United States	2021-03-16	Hatching	Embryo	Whole Organism	All anatomical structures

Advanced export

JSON shape: default, array, newline-delimited

CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;