metadata: run_metadata: 289 rows where experiment.library_selection = "other" and tissue

289 rows where experiment.library_selection = "other" and tissue_curation = "Embryo Imprecise"

descending

Link	rowid ▼	run.accession	experiment.accession	sample.accession	study.accession	bioproject	study.title	study.alias	study.type	study.abstract	study.PMIDs	sample.description	sample.title	sample.alias	sample.attributes	GEOsample.title	GEOsample.dataprocessing	GEOsample.source	GEOsample.treatmentprotocol	GEOsample.extractprotocol	GEOsample.growthprotocol	GEOsample.characteristics	GEOsample.accession	experiment.title	experiment.alias	experiment.library_name	experiment.design_description	experiment.library_construction_protocol	experiment.attributes	experiment.library_strategy	experiment.library_source	experiment.library_selection	experiment.library_layout	experiment.platform	experiment.instrument_model	experiment.spot_descriptor	experiment.study_ref	run.attributes	run.filename	run.semantic_name	run.total_bases	run.total_spots	run.alias	run.read_lengths	run.base_counts	run.r1_length	run.r2_length	run.Acount	run.Ccount	run.Gcount	run.Tcount	run.Ncount	run.experiment	run.pool_member	submission.accession	submission.srasource	submission.bioprojectsource	seqdetective.n_mates	seqdetective.mapping_rate.mate1	seqdetective.mapping_rate.mate2	seqdetective.nofeature_rate.mate1	seqdetective.nofeature_rate.mate2	seqdetective.sparsity.mate1	seqdetective.sparsity.mate2	seqdetective.pos_strand_rate.mate1	seqdetective.pos_strand_rate.mate2	seqdetective.readlen.mate1	seqdetective.readlen.mate2	seqdetective.judgement.mate1	seqdetective.judgement.mate2	seqdetective.judgement.reason	platform_family	instrument_generation	read_bias	selection_class	prep_kit	sc_or_bulk	tech_class	technology	submission.bioprojectsource.country	earliest_date	devstage_curation	devstage_curation_coarse	tissue_curation	tissue_curation_coarse
25182	25182	SRR25670729	SRX21396042	SRS18636200	SRP455680	PRJNA1006406	Control of polyA tail length and translation in vertebrate oocytes and early embryos	GSE241107	Other	During oocyte maturation and early embryonic development polyA tail lengths strongly influence mRNA translation. However how tail lengths are controlled at different developmental stages has been unclear. Here we performed tail length and translational profiling of mRNA reporter libraries each with > 10 million three prime UTR sequence variants in frog oocytes and embryos and fish embryos. These analyses revealed that the UUUUA motif specifies cytoplasmic polyadenylation and identified diverse context features that modulate the activity of this 5 mer. Additional sequence motifs drive stage specific deadenylation in embryos and UUUUA and C rich motifs drive tail length independent translational repression in oocytes. A neural network model accurately predicts tail length change during oocyte maturation in frogs mice and humans. Analyses of human sequence variants showed that those predicted to disrupt tail length control have been under negative selection implying that our insights into control of polyA tail length and translation have implications for human health and fertility. Overall design: Sythetic mRNA reporter libraries with random three prime UTR sequences under four different sequence contexts were injected into frog oocytes and embryos and fish embryos. PolyA tail lengths were measured to at different developmental stages to examine sequence motifs that caused tail length changes. At the same time polyA tail lengths of endogenous mRNAs from frog oocytes and embryos fish embryos and mouse oocytes were measured to investiage how their tail lengths were controlled. Please note that sample titles have been updated on Jan 6 2024.			Fish embryo mRNA germ ring PAL seq v4	GSM7716871	source name:embryo\|tissue:embryo\|treatment:N1\|geo loc name:missing\|collection date:missing	Fish embryo mRNA germ ring PAL seq v4	For gene specific tail seq of mRNA reporters data were processed with a custom script available at https://github.com/coffeebond/MPRA tail seq. For PAL seq v3 or v4 reads were trimmed with cutadapt v3.7 with the parameters “ m 15 quality base=64 q 20 20 match read wildcards e 0.05 a NNNNATCTCGTATGCCGTCTTCTGCTTG O 7”. The trimmed reads were mapped using STAR v2.7.1a to the reference database containing the genomic sequences of the organism from which the mRNAs were obtained the genomic sequences of humans or fish depending on which spike in RNAs were used and the sequences of the polyA standards generated previously with the parameters “ runThreadN 16 runMode alignReads outFilterMultimapNmax 1 outReadsUnmapped Fastx outFilterType BySJout outSAMattributes All outSAMtype BAM Unsorted SortedByCoordinate”. Uniquely mapped read were furhter processed with a custom script available at https://github.com/coffeebond/PAL seq. Assembly: Homo sapiens: GRCh38.p7 primary assembly. Mus muculus: GRCh38.p4 primary assembly. Xenopus laevis: v10.1 assembly. Danio rerio: GRCz11 assembly. Supplementary files format and content: For gene specific tail seq of mRNA reporters tab delimited text files with columns indicating 1 sequence of the variable region; 2 median tail length; 3 number of reads; 4–7 tail lengths at quantile 10 25 75 and 90. Supplementary files format and content: For PAL seq v3 or v4 tab delimited files with columns indicating 1 gene ID or polyA site ID; 2 read cluster ID; 3 tail length Library strategy: PAL seq v4	embryo		Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5 100 mM KCl 5 mM MgCl2 1% [v/v] Triton X 100 100 µg/ml cycloheximide cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer] and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr denuded with 3 mg/ml hyaluronidase for 2 min washed and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases but for the N60 library injected into fish embryos and frog oocytes the N37 PAS N17 library injected into fish embryos and frog oocytes and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009 8 pmol KXSH010 and 2x SSC 0.3 M NaCl 30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher 65002 and incubated for 20 min at 23°C on a thermal mixer shaking with 15 sec on and 1 min 45 sec off. The superna…		tissue:embryo\|treatment:N1	GSM7716871	GSM7716871: Fish embryo mRNA germ ring PAL seq v4; Danio rerio; OTHER	GSM7716871 r1	GSM7716871	1	Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5 100 mM KCl 5 mM MgCl2 1% [v/v] Triton X 100 100 µg/ml cycloheximide cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer] and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr denuded with 3 mg/ml hyaluronidase for 2 min washed and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases but for the N60 library injected into fish embryos and frog oocytes the N37 PAS N17 library injected into fish embryos and frog oocytes and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009 8 pmol KXSH010 and 2x SSC 0.3 M NaCl 30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher 65002 and incubated for 20 min at 23°C on a thermal mixer shaking with 15 sec on and 1 min 45 sec off. The superna…		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina HiSeq 2500		SRP455680		Fish_embryo_mRNA_germ_ring_PAL_seq_v4_rep1_raw_read2.fastq.gz Fish_embryo_mRNA_germ_ring_PAL_seq_v4_rep1_raw_read1.fastq.gz	fastq fastq	2834842912.0	9234016.0	GSM7716871 r1	0:52 1:255	A:725811118;C:702410592;G:747583409;T:651018348;N:8019445	52	255	725811118	702410592	747583409	651018348	8019445	SRX21396042	SRS18636200	SRA1694849	Whitehead Institute	Whitehead Institute	2	0.00023	0.30494	8e-05	0.01793	0.99967	0.99971	0.5	1.0	52	255	T	B	mate1 technical by mapping diff	illumina	hiseq_era	unknown	poly_a	unknown	bulk	bulk	bulk	United States	2023-08-17	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
25183	25183	SRR25670730	SRX21396042	SRS18636200	SRP455680	PRJNA1006406	Control of polyA tail length and translation in vertebrate oocytes and early embryos	GSE241107	Other	During oocyte maturation and early embryonic development polyA tail lengths strongly influence mRNA translation. However how tail lengths are controlled at different developmental stages has been unclear. Here we performed tail length and translational profiling of mRNA reporter libraries each with > 10 million three prime UTR sequence variants in frog oocytes and embryos and fish embryos. These analyses revealed that the UUUUA motif specifies cytoplasmic polyadenylation and identified diverse context features that modulate the activity of this 5 mer. Additional sequence motifs drive stage specific deadenylation in embryos and UUUUA and C rich motifs drive tail length independent translational repression in oocytes. A neural network model accurately predicts tail length change during oocyte maturation in frogs mice and humans. Analyses of human sequence variants showed that those predicted to disrupt tail length control have been under negative selection implying that our insights into control of polyA tail length and translation have implications for human health and fertility. Overall design: Sythetic mRNA reporter libraries with random three prime UTR sequences under four different sequence contexts were injected into frog oocytes and embryos and fish embryos. PolyA tail lengths were measured to at different developmental stages to examine sequence motifs that caused tail length changes. At the same time polyA tail lengths of endogenous mRNAs from frog oocytes and embryos fish embryos and mouse oocytes were measured to investiage how their tail lengths were controlled. Please note that sample titles have been updated on Jan 6 2024.			Fish embryo mRNA germ ring PAL seq v4	GSM7716871	source name:embryo\|tissue:embryo\|treatment:N1\|geo loc name:missing\|collection date:missing	Fish embryo mRNA germ ring PAL seq v4	For gene specific tail seq of mRNA reporters data were processed with a custom script available at https://github.com/coffeebond/MPRA tail seq. For PAL seq v3 or v4 reads were trimmed with cutadapt v3.7 with the parameters “ m 15 quality base=64 q 20 20 match read wildcards e 0.05 a NNNNATCTCGTATGCCGTCTTCTGCTTG O 7”. The trimmed reads were mapped using STAR v2.7.1a to the reference database containing the genomic sequences of the organism from which the mRNAs were obtained the genomic sequences of humans or fish depending on which spike in RNAs were used and the sequences of the polyA standards generated previously with the parameters “ runThreadN 16 runMode alignReads outFilterMultimapNmax 1 outReadsUnmapped Fastx outFilterType BySJout outSAMattributes All outSAMtype BAM Unsorted SortedByCoordinate”. Uniquely mapped read were furhter processed with a custom script available at https://github.com/coffeebond/PAL seq. Assembly: Homo sapiens: GRCh38.p7 primary assembly. Mus muculus: GRCh38.p4 primary assembly. Xenopus laevis: v10.1 assembly. Danio rerio: GRCz11 assembly. Supplementary files format and content: For gene specific tail seq of mRNA reporters tab delimited text files with columns indicating 1 sequence of the variable region; 2 median tail length; 3 number of reads; 4–7 tail lengths at quantile 10 25 75 and 90. Supplementary files format and content: For PAL seq v3 or v4 tab delimited files with columns indicating 1 gene ID or polyA site ID; 2 read cluster ID; 3 tail length Library strategy: PAL seq v4	embryo		Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5 100 mM KCl 5 mM MgCl2 1% [v/v] Triton X 100 100 µg/ml cycloheximide cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer] and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr denuded with 3 mg/ml hyaluronidase for 2 min washed and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases but for the N60 library injected into fish embryos and frog oocytes the N37 PAS N17 library injected into fish embryos and frog oocytes and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009 8 pmol KXSH010 and 2x SSC 0.3 M NaCl 30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher 65002 and incubated for 20 min at 23°C on a thermal mixer shaking with 15 sec on and 1 min 45 sec off. The superna…		tissue:embryo\|treatment:N1	GSM7716871	GSM7716871: Fish embryo mRNA germ ring PAL seq v4; Danio rerio; OTHER	GSM7716871 r1	GSM7716871	1	Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5 100 mM KCl 5 mM MgCl2 1% [v/v] Triton X 100 100 µg/ml cycloheximide cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer] and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr denuded with 3 mg/ml hyaluronidase for 2 min washed and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases but for the N60 library injected into fish embryos and frog oocytes the N37 PAS N17 library injected into fish embryos and frog oocytes and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009 8 pmol KXSH010 and 2x SSC 0.3 M NaCl 30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher 65002 and incubated for 20 min at 23°C on a thermal mixer shaking with 15 sec on and 1 min 45 sec off. The superna…		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina HiSeq 2500		SRP455680		Fish_embryo_mRNA_germ_ring_PAL_seq_v4_rep2_raw_read1.fastq.gz Fish_embryo_mRNA_germ_ring_PAL_seq_v4_rep2_raw_read2.fastq.gz	fastq fastq	3473033898.0	11312814.0	GSM7716871 r2	0:52 1:255	A:853178471;C:899976159;G:962100712;T:750811461;N:6967095	52	255	853178471	899976159	962100712	750811461	6967095	SRX21396042	SRS18636200	SRA1694849	Whitehead Institute	Whitehead Institute	2	0.00049	0.0	0.00012	0.0	0.99941	1.0	0.64864		52	255	T	T	mates < 9% mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	bulk	bulk	bulk	United States	2023-08-17	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
25184	25184	SRR25670731	SRX21396041	SRS18636199	SRP455680	PRJNA1006406	Control of polyA tail length and translation in vertebrate oocytes and early embryos	GSE241107	Other	During oocyte maturation and early embryonic development polyA tail lengths strongly influence mRNA translation. However how tail lengths are controlled at different developmental stages has been unclear. Here we performed tail length and translational profiling of mRNA reporter libraries each with > 10 million three prime UTR sequence variants in frog oocytes and embryos and fish embryos. These analyses revealed that the UUUUA motif specifies cytoplasmic polyadenylation and identified diverse context features that modulate the activity of this 5 mer. Additional sequence motifs drive stage specific deadenylation in embryos and UUUUA and C rich motifs drive tail length independent translational repression in oocytes. A neural network model accurately predicts tail length change during oocyte maturation in frogs mice and humans. Analyses of human sequence variants showed that those predicted to disrupt tail length control have been under negative selection implying that our insights into control of polyA tail length and translation have implications for human health and fertility. Overall design: Sythetic mRNA reporter libraries with random three prime UTR sequences under four different sequence contexts were injected into frog oocytes and embryos and fish embryos. PolyA tail lengths were measured to at different developmental stages to examine sequence motifs that caused tail length changes. At the same time polyA tail lengths of endogenous mRNAs from frog oocytes and embryos fish embryos and mouse oocytes were measured to investiage how their tail lengths were controlled. Please note that sample titles have been updated on Jan 6 2024.			Fish embryo mRNA zfs:0000015 PAL seq v4	GSM7716870	source name:embryo\|tissue:embryo\|treatment:N1\|geo loc name:missing\|collection date:missing	Fish embryo mRNA zfs:0000015 PAL seq v4	For gene specific tail seq of mRNA reporters data were processed with a custom script available at https://github.com/coffeebond/MPRA tail seq. For PAL seq v3 or v4 reads were trimmed with cutadapt v3.7 with the parameters “ m 15 quality base=64 q 20 20 match read wildcards e 0.05 a NNNNATCTCGTATGCCGTCTTCTGCTTG O 7”. The trimmed reads were mapped using STAR v2.7.1a to the reference database containing the genomic sequences of the organism from which the mRNAs were obtained the genomic sequences of humans or fish depending on which spike in RNAs were used and the sequences of the polyA standards generated previously with the parameters “ runThreadN 16 runMode alignReads outFilterMultimapNmax 1 outReadsUnmapped Fastx outFilterType BySJout outSAMattributes All outSAMtype BAM Unsorted SortedByCoordinate”. Uniquely mapped read were furhter processed with a custom script available at https://github.com/coffeebond/PAL seq. Assembly: Homo sapiens: GRCh38.p7 primary assembly. Mus muculus: GRCh38.p4 primary assembly. Xenopus laevis: v10.1 assembly. Danio rerio: GRCz11 assembly. Supplementary files format and content: For gene specific tail seq of mRNA reporters tab delimited text files with columns indicating 1 sequence of the variable region; 2 median tail length; 3 number of reads; 4–7 tail lengths at quantile 10 25 75 and 90. Supplementary files format and content: For PAL seq v3 or v4 tab delimited files with columns indicating 1 gene ID or polyA site ID; 2 read cluster ID; 3 tail length Library strategy: PAL seq v4	embryo		Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5 100 mM KCl 5 mM MgCl2 1% [v/v] Triton X 100 100 µg/ml cycloheximide cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer] and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr denuded with 3 mg/ml hyaluronidase for 2 min washed and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases but for the N60 library injected into fish embryos and frog oocytes the N37 PAS N17 library injected into fish embryos and frog oocytes and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009 8 pmol KXSH010 and 2x SSC 0.3 M NaCl 30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher 65002 and incubated for 20 min at 23°C on a thermal mixer shaking with 15 sec on and 1 min 45 sec off. The superna…		tissue:embryo\|treatment:N1	GSM7716870	GSM7716870: Fish embryo mRNA zfs:0000015 PAL seq v4; Danio rerio; OTHER	GSM7716870 r1	GSM7716870	1	Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5 100 mM KCl 5 mM MgCl2 1% [v/v] Triton X 100 100 µg/ml cycloheximide cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer] and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr denuded with 3 mg/ml hyaluronidase for 2 min washed and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases but for the N60 library injected into fish embryos and frog oocytes the N37 PAS N17 library injected into fish embryos and frog oocytes and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009 8 pmol KXSH010 and 2x SSC 0.3 M NaCl 30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher 65002 and incubated for 20 min at 23°C on a thermal mixer shaking with 15 sec on and 1 min 45 sec off. The superna…		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina HiSeq 2500		SRP455680		Fish_embryo_mRNA_30percent_epiboly_PAL_seq_v4_rep1_raw_read1.fastq.gz Fish_embryo_mRNA_30percent_epiboly_PAL_seq_v4_rep1_raw_read2.fastq.gz	fastq fastq	2695203962.0	8779166.0	GSM7716870 r1	0:52 1:255	A:684535386;C:669852151;G:719008886;T:614209811;N:7597728	52	255	684535386	669852151	719008886	614209811	7597728	SRX21396041	SRS18636199	SRA1694849	Whitehead Institute	Whitehead Institute	2	0.00117	0.35837	0.00017	0.00682	0.99859	0.99963	0.69473	1.0	52	255	T	B	mate1 technical by mapping diff	illumina	hiseq_era	unknown	poly_a	unknown	bulk	bulk	bulk	United States	2023-08-17	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
25185	25185	SRR25670732	SRX21396041	SRS18636199	SRP455680	PRJNA1006406	Control of polyA tail length and translation in vertebrate oocytes and early embryos	GSE241107	Other	During oocyte maturation and early embryonic development polyA tail lengths strongly influence mRNA translation. However how tail lengths are controlled at different developmental stages has been unclear. Here we performed tail length and translational profiling of mRNA reporter libraries each with > 10 million three prime UTR sequence variants in frog oocytes and embryos and fish embryos. These analyses revealed that the UUUUA motif specifies cytoplasmic polyadenylation and identified diverse context features that modulate the activity of this 5 mer. Additional sequence motifs drive stage specific deadenylation in embryos and UUUUA and C rich motifs drive tail length independent translational repression in oocytes. A neural network model accurately predicts tail length change during oocyte maturation in frogs mice and humans. Analyses of human sequence variants showed that those predicted to disrupt tail length control have been under negative selection implying that our insights into control of polyA tail length and translation have implications for human health and fertility. Overall design: Sythetic mRNA reporter libraries with random three prime UTR sequences under four different sequence contexts were injected into frog oocytes and embryos and fish embryos. PolyA tail lengths were measured to at different developmental stages to examine sequence motifs that caused tail length changes. At the same time polyA tail lengths of endogenous mRNAs from frog oocytes and embryos fish embryos and mouse oocytes were measured to investiage how their tail lengths were controlled. Please note that sample titles have been updated on Jan 6 2024.			Fish embryo mRNA zfs:0000015 PAL seq v4	GSM7716870	source name:embryo\|tissue:embryo\|treatment:N1\|geo loc name:missing\|collection date:missing	Fish embryo mRNA zfs:0000015 PAL seq v4	For gene specific tail seq of mRNA reporters data were processed with a custom script available at https://github.com/coffeebond/MPRA tail seq. For PAL seq v3 or v4 reads were trimmed with cutadapt v3.7 with the parameters “ m 15 quality base=64 q 20 20 match read wildcards e 0.05 a NNNNATCTCGTATGCCGTCTTCTGCTTG O 7”. The trimmed reads were mapped using STAR v2.7.1a to the reference database containing the genomic sequences of the organism from which the mRNAs were obtained the genomic sequences of humans or fish depending on which spike in RNAs were used and the sequences of the polyA standards generated previously with the parameters “ runThreadN 16 runMode alignReads outFilterMultimapNmax 1 outReadsUnmapped Fastx outFilterType BySJout outSAMattributes All outSAMtype BAM Unsorted SortedByCoordinate”. Uniquely mapped read were furhter processed with a custom script available at https://github.com/coffeebond/PAL seq. Assembly: Homo sapiens: GRCh38.p7 primary assembly. Mus muculus: GRCh38.p4 primary assembly. Xenopus laevis: v10.1 assembly. Danio rerio: GRCz11 assembly. Supplementary files format and content: For gene specific tail seq of mRNA reporters tab delimited text files with columns indicating 1 sequence of the variable region; 2 median tail length; 3 number of reads; 4–7 tail lengths at quantile 10 25 75 and 90. Supplementary files format and content: For PAL seq v3 or v4 tab delimited files with columns indicating 1 gene ID or polyA site ID; 2 read cluster ID; 3 tail length Library strategy: PAL seq v4	embryo		Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5 100 mM KCl 5 mM MgCl2 1% [v/v] Triton X 100 100 µg/ml cycloheximide cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer] and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr denuded with 3 mg/ml hyaluronidase for 2 min washed and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases but for the N60 library injected into fish embryos and frog oocytes the N37 PAS N17 library injected into fish embryos and frog oocytes and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009 8 pmol KXSH010 and 2x SSC 0.3 M NaCl 30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher 65002 and incubated for 20 min at 23°C on a thermal mixer shaking with 15 sec on and 1 min 45 sec off. The superna…		tissue:embryo\|treatment:N1	GSM7716870	GSM7716870: Fish embryo mRNA zfs:0000015 PAL seq v4; Danio rerio; OTHER	GSM7716870 r1	GSM7716870	1	Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5 100 mM KCl 5 mM MgCl2 1% [v/v] Triton X 100 100 µg/ml cycloheximide cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer] and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr denuded with 3 mg/ml hyaluronidase for 2 min washed and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases but for the N60 library injected into fish embryos and frog oocytes the N37 PAS N17 library injected into fish embryos and frog oocytes and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009 8 pmol KXSH010 and 2x SSC 0.3 M NaCl 30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher 65002 and incubated for 20 min at 23°C on a thermal mixer shaking with 15 sec on and 1 min 45 sec off. The superna…		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina HiSeq 2500		SRP455680		Fish_embryo_mRNA_30percent_epiboly_PAL_seq_v4_rep2_raw_read2.fastq.gz Fish_embryo_mRNA_30percent_epiboly_PAL_seq_v4_rep2_raw_read1.fastq.gz	fastq fastq	3476338446.0	11323578.0	GSM7716870 r2	0:52 1:255	A:841832234;C:898325199;G:968774318;T:760398070;N:7008625	52	255	841832234	898325199	968774318	760398070	7008625	SRX21396041	SRS18636199	SRA1694849	Whitehead Institute	Whitehead Institute	2	0.00245	0.0	0.00047	0.0	0.99803	1.0	0.58536		52	255	T	T	mates < 9% mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	bulk	bulk	bulk	United States	2023-08-17	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
25186	25186	SRR25670733	SRX21396040	SRS18636198	SRP455680	PRJNA1006406	Control of polyA tail length and translation in vertebrate oocytes and early embryos	GSE241107	Other	During oocyte maturation and early embryonic development polyA tail lengths strongly influence mRNA translation. However how tail lengths are controlled at different developmental stages has been unclear. Here we performed tail length and translational profiling of mRNA reporter libraries each with > 10 million three prime UTR sequence variants in frog oocytes and embryos and fish embryos. These analyses revealed that the UUUUA motif specifies cytoplasmic polyadenylation and identified diverse context features that modulate the activity of this 5 mer. Additional sequence motifs drive stage specific deadenylation in embryos and UUUUA and C rich motifs drive tail length independent translational repression in oocytes. A neural network model accurately predicts tail length change during oocyte maturation in frogs mice and humans. Analyses of human sequence variants showed that those predicted to disrupt tail length control have been under negative selection implying that our insights into control of polyA tail length and translation have implications for human health and fertility. Overall design: Sythetic mRNA reporter libraries with random three prime UTR sequences under four different sequence contexts were injected into frog oocytes and embryos and fish embryos. PolyA tail lengths were measured to at different developmental stages to examine sequence motifs that caused tail length changes. At the same time polyA tail lengths of endogenous mRNAs from frog oocytes and embryos fish embryos and mouse oocytes were measured to investiage how their tail lengths were controlled. Please note that sample titles have been updated on Jan 6 2024.			Fish embryo mRNA sphere PAL seq v4	GSM7716869	source name:embryo\|tissue:embryo\|treatment:N1\|geo loc name:missing\|collection date:missing	Fish embryo mRNA sphere PAL seq v4	For gene specific tail seq of mRNA reporters data were processed with a custom script available at https://github.com/coffeebond/MPRA tail seq. For PAL seq v3 or v4 reads were trimmed with cutadapt v3.7 with the parameters “ m 15 quality base=64 q 20 20 match read wildcards e 0.05 a NNNNATCTCGTATGCCGTCTTCTGCTTG O 7”. The trimmed reads were mapped using STAR v2.7.1a to the reference database containing the genomic sequences of the organism from which the mRNAs were obtained the genomic sequences of humans or fish depending on which spike in RNAs were used and the sequences of the polyA standards generated previously with the parameters “ runThreadN 16 runMode alignReads outFilterMultimapNmax 1 outReadsUnmapped Fastx outFilterType BySJout outSAMattributes All outSAMtype BAM Unsorted SortedByCoordinate”. Uniquely mapped read were furhter processed with a custom script available at https://github.com/coffeebond/PAL seq. Assembly: Homo sapiens: GRCh38.p7 primary assembly. Mus muculus: GRCh38.p4 primary assembly. Xenopus laevis: v10.1 assembly. Danio rerio: GRCz11 assembly. Supplementary files format and content: For gene specific tail seq of mRNA reporters tab delimited text files with columns indicating 1 sequence of the variable region; 2 median tail length; 3 number of reads; 4–7 tail lengths at quantile 10 25 75 and 90. Supplementary files format and content: For PAL seq v3 or v4 tab delimited files with columns indicating 1 gene ID or polyA site ID; 2 read cluster ID; 3 tail length Library strategy: PAL seq v4	embryo		Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5 100 mM KCl 5 mM MgCl2 1% [v/v] Triton X 100 100 µg/ml cycloheximide cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer] and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr denuded with 3 mg/ml hyaluronidase for 2 min washed and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases but for the N60 library injected into fish embryos and frog oocytes the N37 PAS N17 library injected into fish embryos and frog oocytes and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009 8 pmol KXSH010 and 2x SSC 0.3 M NaCl 30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher 65002 and incubated for 20 min at 23°C on a thermal mixer shaking with 15 sec on and 1 min 45 sec off. The superna…		tissue:embryo\|treatment:N1	GSM7716869	GSM7716869: Fish embryo mRNA sphere PAL seq v4; Danio rerio; OTHER	GSM7716869 r1	GSM7716869	1	Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5 100 mM KCl 5 mM MgCl2 1% [v/v] Triton X 100 100 µg/ml cycloheximide cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer] and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr denuded with 3 mg/ml hyaluronidase for 2 min washed and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases but for the N60 library injected into fish embryos and frog oocytes the N37 PAS N17 library injected into fish embryos and frog oocytes and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009 8 pmol KXSH010 and 2x SSC 0.3 M NaCl 30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher 65002 and incubated for 20 min at 23°C on a thermal mixer shaking with 15 sec on and 1 min 45 sec off. The superna…		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina HiSeq 2500		SRP455680		Fish_embryo_mRNA_sphere_PAL_seq_v4_rep1_raw_read1.fastq.gz Fish_embryo_mRNA_sphere_PAL_seq_v4_rep1_raw_read2.fastq.gz	fastq fastq	3211687254.0	10461522.0	GSM7716869 r1	0:52 1:255	A:813560400;C:775326762;G:854563477;T:759161458;N:9075157	52	255	813560400	775326762	854563477	759161458	9075157	SRX21396040	SRS18636198	SRA1694849	Whitehead Institute	Whitehead Institute	2	0.00088	0.43191	0.0004	0.01556	0.99916	0.99961	0.55769	1.0	52	255	T	B	mate1 technical by mapping diff	illumina	hiseq_era	unknown	poly_a	unknown	bulk	bulk	bulk	United States	2023-08-17	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
25187	25187	SRR25670734	SRX21396040	SRS18636198	SRP455680	PRJNA1006406	Control of polyA tail length and translation in vertebrate oocytes and early embryos	GSE241107	Other	During oocyte maturation and early embryonic development polyA tail lengths strongly influence mRNA translation. However how tail lengths are controlled at different developmental stages has been unclear. Here we performed tail length and translational profiling of mRNA reporter libraries each with > 10 million three prime UTR sequence variants in frog oocytes and embryos and fish embryos. These analyses revealed that the UUUUA motif specifies cytoplasmic polyadenylation and identified diverse context features that modulate the activity of this 5 mer. Additional sequence motifs drive stage specific deadenylation in embryos and UUUUA and C rich motifs drive tail length independent translational repression in oocytes. A neural network model accurately predicts tail length change during oocyte maturation in frogs mice and humans. Analyses of human sequence variants showed that those predicted to disrupt tail length control have been under negative selection implying that our insights into control of polyA tail length and translation have implications for human health and fertility. Overall design: Sythetic mRNA reporter libraries with random three prime UTR sequences under four different sequence contexts were injected into frog oocytes and embryos and fish embryos. PolyA tail lengths were measured to at different developmental stages to examine sequence motifs that caused tail length changes. At the same time polyA tail lengths of endogenous mRNAs from frog oocytes and embryos fish embryos and mouse oocytes were measured to investiage how their tail lengths were controlled. Please note that sample titles have been updated on Jan 6 2024.			Fish embryo mRNA sphere PAL seq v4	GSM7716869	source name:embryo\|tissue:embryo\|treatment:N1\|geo loc name:missing\|collection date:missing	Fish embryo mRNA sphere PAL seq v4	For gene specific tail seq of mRNA reporters data were processed with a custom script available at https://github.com/coffeebond/MPRA tail seq. For PAL seq v3 or v4 reads were trimmed with cutadapt v3.7 with the parameters “ m 15 quality base=64 q 20 20 match read wildcards e 0.05 a NNNNATCTCGTATGCCGTCTTCTGCTTG O 7”. The trimmed reads were mapped using STAR v2.7.1a to the reference database containing the genomic sequences of the organism from which the mRNAs were obtained the genomic sequences of humans or fish depending on which spike in RNAs were used and the sequences of the polyA standards generated previously with the parameters “ runThreadN 16 runMode alignReads outFilterMultimapNmax 1 outReadsUnmapped Fastx outFilterType BySJout outSAMattributes All outSAMtype BAM Unsorted SortedByCoordinate”. Uniquely mapped read were furhter processed with a custom script available at https://github.com/coffeebond/PAL seq. Assembly: Homo sapiens: GRCh38.p7 primary assembly. Mus muculus: GRCh38.p4 primary assembly. Xenopus laevis: v10.1 assembly. Danio rerio: GRCz11 assembly. Supplementary files format and content: For gene specific tail seq of mRNA reporters tab delimited text files with columns indicating 1 sequence of the variable region; 2 median tail length; 3 number of reads; 4–7 tail lengths at quantile 10 25 75 and 90. Supplementary files format and content: For PAL seq v3 or v4 tab delimited files with columns indicating 1 gene ID or polyA site ID; 2 read cluster ID; 3 tail length Library strategy: PAL seq v4	embryo		Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5 100 mM KCl 5 mM MgCl2 1% [v/v] Triton X 100 100 µg/ml cycloheximide cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer] and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr denuded with 3 mg/ml hyaluronidase for 2 min washed and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases but for the N60 library injected into fish embryos and frog oocytes the N37 PAS N17 library injected into fish embryos and frog oocytes and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009 8 pmol KXSH010 and 2x SSC 0.3 M NaCl 30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher 65002 and incubated for 20 min at 23°C on a thermal mixer shaking with 15 sec on and 1 min 45 sec off. The superna…		tissue:embryo\|treatment:N1	GSM7716869	GSM7716869: Fish embryo mRNA sphere PAL seq v4; Danio rerio; OTHER	GSM7716869 r1	GSM7716869	1	Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5 100 mM KCl 5 mM MgCl2 1% [v/v] Triton X 100 100 µg/ml cycloheximide cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer] and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr denuded with 3 mg/ml hyaluronidase for 2 min washed and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases but for the N60 library injected into fish embryos and frog oocytes the N37 PAS N17 library injected into fish embryos and frog oocytes and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009 8 pmol KXSH010 and 2x SSC 0.3 M NaCl 30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher 65002 and incubated for 20 min at 23°C on a thermal mixer shaking with 15 sec on and 1 min 45 sec off. The superna…		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina HiSeq 2500		SRP455680		Fish_embryo_mRNA_sphere_PAL_seq_v4_rep2_raw_read1.fastq.gz Fish_embryo_mRNA_sphere_PAL_seq_v4_rep2_raw_read2.fastq.gz	fastq fastq	3179916131.0	10358033.0	GSM7716869 r2	0:52 1:255	A:771755667;C:804256300;G:883166175;T:714242073;N:6495916	52	255	771755667	804256300	883166175	714242073	6495916	SRX21396040	SRS18636198	SRA1694849	Whitehead Institute	Whitehead Institute	2	0.00186	0.0	0.00088	0.0	0.99862	1.0	0.64705		52	255	T	T	mates < 9% mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	bulk	bulk	bulk	United States	2023-08-17	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
25188	25188	SRR25670735	SRX21396039	SRS18636197	SRP455680	PRJNA1006406	Control of polyA tail length and translation in vertebrate oocytes and early embryos	GSE241107	Other	During oocyte maturation and early embryonic development polyA tail lengths strongly influence mRNA translation. However how tail lengths are controlled at different developmental stages has been unclear. Here we performed tail length and translational profiling of mRNA reporter libraries each with > 10 million three prime UTR sequence variants in frog oocytes and embryos and fish embryos. These analyses revealed that the UUUUA motif specifies cytoplasmic polyadenylation and identified diverse context features that modulate the activity of this 5 mer. Additional sequence motifs drive stage specific deadenylation in embryos and UUUUA and C rich motifs drive tail length independent translational repression in oocytes. A neural network model accurately predicts tail length change during oocyte maturation in frogs mice and humans. Analyses of human sequence variants showed that those predicted to disrupt tail length control have been under negative selection implying that our insights into control of polyA tail length and translation have implications for human health and fertility. Overall design: Sythetic mRNA reporter libraries with random three prime UTR sequences under four different sequence contexts were injected into frog oocytes and embryos and fish embryos. PolyA tail lengths were measured to at different developmental stages to examine sequence motifs that caused tail length changes. At the same time polyA tail lengths of endogenous mRNAs from frog oocytes and embryos fish embryos and mouse oocytes were measured to investiage how their tail lengths were controlled. Please note that sample titles have been updated on Jan 6 2024.			Fish embryo mRNA 1024cell PAL seq v4	GSM7716868	source name:embryo\|tissue:embryo\|treatment:N1\|geo loc name:missing\|collection date:missing	Fish embryo mRNA 1024cell PAL seq v4	For gene specific tail seq of mRNA reporters data were processed with a custom script available at https://github.com/coffeebond/MPRA tail seq. For PAL seq v3 or v4 reads were trimmed with cutadapt v3.7 with the parameters “ m 15 quality base=64 q 20 20 match read wildcards e 0.05 a NNNNATCTCGTATGCCGTCTTCTGCTTG O 7”. The trimmed reads were mapped using STAR v2.7.1a to the reference database containing the genomic sequences of the organism from which the mRNAs were obtained the genomic sequences of humans or fish depending on which spike in RNAs were used and the sequences of the polyA standards generated previously with the parameters “ runThreadN 16 runMode alignReads outFilterMultimapNmax 1 outReadsUnmapped Fastx outFilterType BySJout outSAMattributes All outSAMtype BAM Unsorted SortedByCoordinate”. Uniquely mapped read were furhter processed with a custom script available at https://github.com/coffeebond/PAL seq. Assembly: Homo sapiens: GRCh38.p7 primary assembly. Mus muculus: GRCh38.p4 primary assembly. Xenopus laevis: v10.1 assembly. Danio rerio: GRCz11 assembly. Supplementary files format and content: For gene specific tail seq of mRNA reporters tab delimited text files with columns indicating 1 sequence of the variable region; 2 median tail length; 3 number of reads; 4–7 tail lengths at quantile 10 25 75 and 90. Supplementary files format and content: For PAL seq v3 or v4 tab delimited files with columns indicating 1 gene ID or polyA site ID; 2 read cluster ID; 3 tail length Library strategy: PAL seq v4	embryo		Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5 100 mM KCl 5 mM MgCl2 1% [v/v] Triton X 100 100 µg/ml cycloheximide cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer] and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr denuded with 3 mg/ml hyaluronidase for 2 min washed and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases but for the N60 library injected into fish embryos and frog oocytes the N37 PAS N17 library injected into fish embryos and frog oocytes and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009 8 pmol KXSH010 and 2x SSC 0.3 M NaCl 30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher 65002 and incubated for 20 min at 23°C on a thermal mixer shaking with 15 sec on and 1 min 45 sec off. The superna…		tissue:embryo\|treatment:N1	GSM7716868	GSM7716868: Fish embryo mRNA 1024cell PAL seq v4; Danio rerio; OTHER	GSM7716868 r1	GSM7716868	1	Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5 100 mM KCl 5 mM MgCl2 1% [v/v] Triton X 100 100 µg/ml cycloheximide cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer] and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr denuded with 3 mg/ml hyaluronidase for 2 min washed and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases but for the N60 library injected into fish embryos and frog oocytes the N37 PAS N17 library injected into fish embryos and frog oocytes and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009 8 pmol KXSH010 and 2x SSC 0.3 M NaCl 30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher 65002 and incubated for 20 min at 23°C on a thermal mixer shaking with 15 sec on and 1 min 45 sec off. The superna…		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina HiSeq 2500		SRP455680		Fish_embryo_mRNA_1024cell_PAL_seq_v4_rep1_raw_read1.fastq.gz Fish_embryo_mRNA_1024cell_PAL_seq_v4_rep1_raw_read2.fastq.gz	fastq fastq	2191900794.0	7139742.0	GSM7716868 r1	0:52 1:255	A:571954354;C:551162617;G:572445400;T:490238669;N:6099754	52	255	571954354	551162617	572445400	490238669	6099754	SRX21396039	SRS18636197	SRA1694849	Whitehead Institute	Whitehead Institute	2	0.0011	0.43387	6e-05	0.01058	0.99864	0.99971	0.74576	1.0	52	255	T	B	mate1 technical by mapping diff	illumina	hiseq_era	unknown	poly_a	unknown	bulk	bulk	bulk	United States	2023-08-17	Zygote	Embryo	Embryo Imprecise	All anatomical structures
25189	25189	SRR25670736	SRX21396039	SRS18636197	SRP455680	PRJNA1006406	Control of polyA tail length and translation in vertebrate oocytes and early embryos	GSE241107	Other	During oocyte maturation and early embryonic development polyA tail lengths strongly influence mRNA translation. However how tail lengths are controlled at different developmental stages has been unclear. Here we performed tail length and translational profiling of mRNA reporter libraries each with > 10 million three prime UTR sequence variants in frog oocytes and embryos and fish embryos. These analyses revealed that the UUUUA motif specifies cytoplasmic polyadenylation and identified diverse context features that modulate the activity of this 5 mer. Additional sequence motifs drive stage specific deadenylation in embryos and UUUUA and C rich motifs drive tail length independent translational repression in oocytes. A neural network model accurately predicts tail length change during oocyte maturation in frogs mice and humans. Analyses of human sequence variants showed that those predicted to disrupt tail length control have been under negative selection implying that our insights into control of polyA tail length and translation have implications for human health and fertility. Overall design: Sythetic mRNA reporter libraries with random three prime UTR sequences under four different sequence contexts were injected into frog oocytes and embryos and fish embryos. PolyA tail lengths were measured to at different developmental stages to examine sequence motifs that caused tail length changes. At the same time polyA tail lengths of endogenous mRNAs from frog oocytes and embryos fish embryos and mouse oocytes were measured to investiage how their tail lengths were controlled. Please note that sample titles have been updated on Jan 6 2024.			Fish embryo mRNA 1024cell PAL seq v4	GSM7716868	source name:embryo\|tissue:embryo\|treatment:N1\|geo loc name:missing\|collection date:missing	Fish embryo mRNA 1024cell PAL seq v4	For gene specific tail seq of mRNA reporters data were processed with a custom script available at https://github.com/coffeebond/MPRA tail seq. For PAL seq v3 or v4 reads were trimmed with cutadapt v3.7 with the parameters “ m 15 quality base=64 q 20 20 match read wildcards e 0.05 a NNNNATCTCGTATGCCGTCTTCTGCTTG O 7”. The trimmed reads were mapped using STAR v2.7.1a to the reference database containing the genomic sequences of the organism from which the mRNAs were obtained the genomic sequences of humans or fish depending on which spike in RNAs were used and the sequences of the polyA standards generated previously with the parameters “ runThreadN 16 runMode alignReads outFilterMultimapNmax 1 outReadsUnmapped Fastx outFilterType BySJout outSAMattributes All outSAMtype BAM Unsorted SortedByCoordinate”. Uniquely mapped read were furhter processed with a custom script available at https://github.com/coffeebond/PAL seq. Assembly: Homo sapiens: GRCh38.p7 primary assembly. Mus muculus: GRCh38.p4 primary assembly. Xenopus laevis: v10.1 assembly. Danio rerio: GRCz11 assembly. Supplementary files format and content: For gene specific tail seq of mRNA reporters tab delimited text files with columns indicating 1 sequence of the variable region; 2 median tail length; 3 number of reads; 4–7 tail lengths at quantile 10 25 75 and 90. Supplementary files format and content: For PAL seq v3 or v4 tab delimited files with columns indicating 1 gene ID or polyA site ID; 2 read cluster ID; 3 tail length Library strategy: PAL seq v4	embryo		Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5 100 mM KCl 5 mM MgCl2 1% [v/v] Triton X 100 100 µg/ml cycloheximide cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer] and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr denuded with 3 mg/ml hyaluronidase for 2 min washed and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases but for the N60 library injected into fish embryos and frog oocytes the N37 PAS N17 library injected into fish embryos and frog oocytes and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009 8 pmol KXSH010 and 2x SSC 0.3 M NaCl 30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher 65002 and incubated for 20 min at 23°C on a thermal mixer shaking with 15 sec on and 1 min 45 sec off. The superna…		tissue:embryo\|treatment:N1	GSM7716868	GSM7716868: Fish embryo mRNA 1024cell PAL seq v4; Danio rerio; OTHER	GSM7716868 r1	GSM7716868	1	Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5 100 mM KCl 5 mM MgCl2 1% [v/v] Triton X 100 100 µg/ml cycloheximide cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer] and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr denuded with 3 mg/ml hyaluronidase for 2 min washed and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases but for the N60 library injected into fish embryos and frog oocytes the N37 PAS N17 library injected into fish embryos and frog oocytes and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009 8 pmol KXSH010 and 2x SSC 0.3 M NaCl 30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher 65002 and incubated for 20 min at 23°C on a thermal mixer shaking with 15 sec on and 1 min 45 sec off. The superna…		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina HiSeq 2500		SRP455680		Fish_embryo_mRNA_1024cell_PAL_seq_v4_rep2_raw_read1.fastq.gz Fish_embryo_mRNA_1024cell_PAL_seq_v4_rep2_raw_read2.fastq.gz	fastq fastq	3840723193.0	12510499.0	GSM7716868 r2	0:52 1:255	A:985340216;C:991311706;G:1034487140;T:821820974;N:7763157	52	255	985340216	991311706	1034487140	821820974	7763157	SRX21396039	SRS18636197	SRA1694849	Whitehead Institute	Whitehead Institute	2	0.0021	0.0	0.00026	0.0	0.99859	1.0	0.71022		52	255	T	T	mates < 9% mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	bulk	bulk	bulk	United States	2023-08-17	Zygote	Embryo	Embryo Imprecise	All anatomical structures
25190	25190	SRR25670737	SRX21396038	SRS18636196	SRP455680	PRJNA1006406	Control of polyA tail length and translation in vertebrate oocytes and early embryos	GSE241107	Other	During oocyte maturation and early embryonic development polyA tail lengths strongly influence mRNA translation. However how tail lengths are controlled at different developmental stages has been unclear. Here we performed tail length and translational profiling of mRNA reporter libraries each with > 10 million three prime UTR sequence variants in frog oocytes and embryos and fish embryos. These analyses revealed that the UUUUA motif specifies cytoplasmic polyadenylation and identified diverse context features that modulate the activity of this 5 mer. Additional sequence motifs drive stage specific deadenylation in embryos and UUUUA and C rich motifs drive tail length independent translational repression in oocytes. A neural network model accurately predicts tail length change during oocyte maturation in frogs mice and humans. Analyses of human sequence variants showed that those predicted to disrupt tail length control have been under negative selection implying that our insights into control of polyA tail length and translation have implications for human health and fertility. Overall design: Sythetic mRNA reporter libraries with random three prime UTR sequences under four different sequence contexts were injected into frog oocytes and embryos and fish embryos. PolyA tail lengths were measured to at different developmental stages to examine sequence motifs that caused tail length changes. At the same time polyA tail lengths of endogenous mRNAs from frog oocytes and embryos fish embryos and mouse oocytes were measured to investiage how their tail lengths were controlled. Please note that sample titles have been updated on Jan 6 2024.			Fish embryo mRNA 128cell PAL seq v4	GSM7716867	source name:embryo\|tissue:embryo\|treatment:N1\|geo loc name:missing\|collection date:missing	Fish embryo mRNA 128cell PAL seq v4	For gene specific tail seq of mRNA reporters data were processed with a custom script available at https://github.com/coffeebond/MPRA tail seq. For PAL seq v3 or v4 reads were trimmed with cutadapt v3.7 with the parameters “ m 15 quality base=64 q 20 20 match read wildcards e 0.05 a NNNNATCTCGTATGCCGTCTTCTGCTTG O 7”. The trimmed reads were mapped using STAR v2.7.1a to the reference database containing the genomic sequences of the organism from which the mRNAs were obtained the genomic sequences of humans or fish depending on which spike in RNAs were used and the sequences of the polyA standards generated previously with the parameters “ runThreadN 16 runMode alignReads outFilterMultimapNmax 1 outReadsUnmapped Fastx outFilterType BySJout outSAMattributes All outSAMtype BAM Unsorted SortedByCoordinate”. Uniquely mapped read were furhter processed with a custom script available at https://github.com/coffeebond/PAL seq. Assembly: Homo sapiens: GRCh38.p7 primary assembly. Mus muculus: GRCh38.p4 primary assembly. Xenopus laevis: v10.1 assembly. Danio rerio: GRCz11 assembly. Supplementary files format and content: For gene specific tail seq of mRNA reporters tab delimited text files with columns indicating 1 sequence of the variable region; 2 median tail length; 3 number of reads; 4–7 tail lengths at quantile 10 25 75 and 90. Supplementary files format and content: For PAL seq v3 or v4 tab delimited files with columns indicating 1 gene ID or polyA site ID; 2 read cluster ID; 3 tail length Library strategy: PAL seq v4	embryo		Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5 100 mM KCl 5 mM MgCl2 1% [v/v] Triton X 100 100 µg/ml cycloheximide cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer] and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr denuded with 3 mg/ml hyaluronidase for 2 min washed and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases but for the N60 library injected into fish embryos and frog oocytes the N37 PAS N17 library injected into fish embryos and frog oocytes and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009 8 pmol KXSH010 and 2x SSC 0.3 M NaCl 30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher 65002 and incubated for 20 min at 23°C on a thermal mixer shaking with 15 sec on and 1 min 45 sec off. The superna…		tissue:embryo\|treatment:N1	GSM7716867	GSM7716867: Fish embryo mRNA 128cell PAL seq v4; Danio rerio; OTHER	GSM7716867 r1	GSM7716867	1	Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5 100 mM KCl 5 mM MgCl2 1% [v/v] Triton X 100 100 µg/ml cycloheximide cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer] and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr denuded with 3 mg/ml hyaluronidase for 2 min washed and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases but for the N60 library injected into fish embryos and frog oocytes the N37 PAS N17 library injected into fish embryos and frog oocytes and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009 8 pmol KXSH010 and 2x SSC 0.3 M NaCl 30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher 65002 and incubated for 20 min at 23°C on a thermal mixer shaking with 15 sec on and 1 min 45 sec off. The superna…		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina HiSeq 2500		SRP455680		Fish_embryo_mRNA_128cell_PAL_seq_v4_rep1_raw_read1.fastq.gz Fish_embryo_mRNA_128cell_PAL_seq_v4_rep1_raw_read2.fastq.gz	fastq fastq	2104868443.0	6856249.0	GSM7716867 r1	0:52 1:255	A:539122676;C:505234642;G:558793048;T:495876292;N:5841785	52	255	539122676	505234642	558793048	495876292	5841785	SRX21396038	SRS18636196	SRA1694849	Whitehead Institute	Whitehead Institute	2	0.00035	0.29379	7e-05	0.01129	0.99949	0.99971	0.55882	0.79591	52	255	T	B	mate1 technical by mapping diff	illumina	hiseq_era	unknown	poly_a	unknown	bulk	bulk	bulk	United States	2023-08-17	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
25191	25191	SRR25670738	SRX21396038	SRS18636196	SRP455680	PRJNA1006406	Control of polyA tail length and translation in vertebrate oocytes and early embryos	GSE241107	Other	During oocyte maturation and early embryonic development polyA tail lengths strongly influence mRNA translation. However how tail lengths are controlled at different developmental stages has been unclear. Here we performed tail length and translational profiling of mRNA reporter libraries each with > 10 million three prime UTR sequence variants in frog oocytes and embryos and fish embryos. These analyses revealed that the UUUUA motif specifies cytoplasmic polyadenylation and identified diverse context features that modulate the activity of this 5 mer. Additional sequence motifs drive stage specific deadenylation in embryos and UUUUA and C rich motifs drive tail length independent translational repression in oocytes. A neural network model accurately predicts tail length change during oocyte maturation in frogs mice and humans. Analyses of human sequence variants showed that those predicted to disrupt tail length control have been under negative selection implying that our insights into control of polyA tail length and translation have implications for human health and fertility. Overall design: Sythetic mRNA reporter libraries with random three prime UTR sequences under four different sequence contexts were injected into frog oocytes and embryos and fish embryos. PolyA tail lengths were measured to at different developmental stages to examine sequence motifs that caused tail length changes. At the same time polyA tail lengths of endogenous mRNAs from frog oocytes and embryos fish embryos and mouse oocytes were measured to investiage how their tail lengths were controlled. Please note that sample titles have been updated on Jan 6 2024.			Fish embryo mRNA 128cell PAL seq v4	GSM7716867	source name:embryo\|tissue:embryo\|treatment:N1\|geo loc name:missing\|collection date:missing	Fish embryo mRNA 128cell PAL seq v4	For gene specific tail seq of mRNA reporters data were processed with a custom script available at https://github.com/coffeebond/MPRA tail seq. For PAL seq v3 or v4 reads were trimmed with cutadapt v3.7 with the parameters “ m 15 quality base=64 q 20 20 match read wildcards e 0.05 a NNNNATCTCGTATGCCGTCTTCTGCTTG O 7”. The trimmed reads were mapped using STAR v2.7.1a to the reference database containing the genomic sequences of the organism from which the mRNAs were obtained the genomic sequences of humans or fish depending on which spike in RNAs were used and the sequences of the polyA standards generated previously with the parameters “ runThreadN 16 runMode alignReads outFilterMultimapNmax 1 outReadsUnmapped Fastx outFilterType BySJout outSAMattributes All outSAMtype BAM Unsorted SortedByCoordinate”. Uniquely mapped read were furhter processed with a custom script available at https://github.com/coffeebond/PAL seq. Assembly: Homo sapiens: GRCh38.p7 primary assembly. Mus muculus: GRCh38.p4 primary assembly. Xenopus laevis: v10.1 assembly. Danio rerio: GRCz11 assembly. Supplementary files format and content: For gene specific tail seq of mRNA reporters tab delimited text files with columns indicating 1 sequence of the variable region; 2 median tail length; 3 number of reads; 4–7 tail lengths at quantile 10 25 75 and 90. Supplementary files format and content: For PAL seq v3 or v4 tab delimited files with columns indicating 1 gene ID or polyA site ID; 2 read cluster ID; 3 tail length Library strategy: PAL seq v4	embryo		Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5 100 mM KCl 5 mM MgCl2 1% [v/v] Triton X 100 100 µg/ml cycloheximide cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer] and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr denuded with 3 mg/ml hyaluronidase for 2 min washed and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases but for the N60 library injected into fish embryos and frog oocytes the N37 PAS N17 library injected into fish embryos and frog oocytes and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009 8 pmol KXSH010 and 2x SSC 0.3 M NaCl 30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher 65002 and incubated for 20 min at 23°C on a thermal mixer shaking with 15 sec on and 1 min 45 sec off. The superna…		tissue:embryo\|treatment:N1	GSM7716867	GSM7716867: Fish embryo mRNA 128cell PAL seq v4; Danio rerio; OTHER	GSM7716867 r1	GSM7716867	1	Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5 100 mM KCl 5 mM MgCl2 1% [v/v] Triton X 100 100 µg/ml cycloheximide cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer] and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr denuded with 3 mg/ml hyaluronidase for 2 min washed and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases but for the N60 library injected into fish embryos and frog oocytes the N37 PAS N17 library injected into fish embryos and frog oocytes and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009 8 pmol KXSH010 and 2x SSC 0.3 M NaCl 30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher 65002 and incubated for 20 min at 23°C on a thermal mixer shaking with 15 sec on and 1 min 45 sec off. The superna…		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina HiSeq 2500		SRP455680		Fish_embryo_mRNA_128cell_PAL_seq_v4_rep2_raw_read1.fastq.gz Fish_embryo_mRNA_128cell_PAL_seq_v4_rep2_raw_read2.fastq.gz	fastq fastq	3135806371.0	10214353.0	GSM7716867 r2	0:52 1:255	A:776612486;C:774126305;G:853951502;T:724788612;N:6327466	52	255	776612486	774126305	853951502	724788612	6327466	SRX21396038	SRS18636196	SRA1694849	Whitehead Institute	Whitehead Institute	2	0.00066	0.0	0.00011	0.0	0.99939	1.0	0.55737		52	255	T	T	mates < 9% mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	bulk	bulk	bulk	United States	2023-08-17	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
25192	25192	SRR25670739	SRX21396037	SRS18636195	SRP455680	PRJNA1006406	Control of polyA tail length and translation in vertebrate oocytes and early embryos	GSE241107	Other	During oocyte maturation and early embryonic development polyA tail lengths strongly influence mRNA translation. However how tail lengths are controlled at different developmental stages has been unclear. Here we performed tail length and translational profiling of mRNA reporter libraries each with > 10 million three prime UTR sequence variants in frog oocytes and embryos and fish embryos. These analyses revealed that the UUUUA motif specifies cytoplasmic polyadenylation and identified diverse context features that modulate the activity of this 5 mer. Additional sequence motifs drive stage specific deadenylation in embryos and UUUUA and C rich motifs drive tail length independent translational repression in oocytes. A neural network model accurately predicts tail length change during oocyte maturation in frogs mice and humans. Analyses of human sequence variants showed that those predicted to disrupt tail length control have been under negative selection implying that our insights into control of polyA tail length and translation have implications for human health and fertility. Overall design: Sythetic mRNA reporter libraries with random three prime UTR sequences under four different sequence contexts were injected into frog oocytes and embryos and fish embryos. PolyA tail lengths were measured to at different developmental stages to examine sequence motifs that caused tail length changes. At the same time polyA tail lengths of endogenous mRNAs from frog oocytes and embryos fish embryos and mouse oocytes were measured to investiage how their tail lengths were controlled. Please note that sample titles have been updated on Jan 6 2024.			Fish embryo mRNA 8cell PAL seq v4	GSM7716866	source name:embryo\|tissue:embryo\|treatment:N1\|geo loc name:missing\|collection date:missing	Fish embryo mRNA 8cell PAL seq v4	For gene specific tail seq of mRNA reporters data were processed with a custom script available at https://github.com/coffeebond/MPRA tail seq. For PAL seq v3 or v4 reads were trimmed with cutadapt v3.7 with the parameters “ m 15 quality base=64 q 20 20 match read wildcards e 0.05 a NNNNATCTCGTATGCCGTCTTCTGCTTG O 7”. The trimmed reads were mapped using STAR v2.7.1a to the reference database containing the genomic sequences of the organism from which the mRNAs were obtained the genomic sequences of humans or fish depending on which spike in RNAs were used and the sequences of the polyA standards generated previously with the parameters “ runThreadN 16 runMode alignReads outFilterMultimapNmax 1 outReadsUnmapped Fastx outFilterType BySJout outSAMattributes All outSAMtype BAM Unsorted SortedByCoordinate”. Uniquely mapped read were furhter processed with a custom script available at https://github.com/coffeebond/PAL seq. Assembly: Homo sapiens: GRCh38.p7 primary assembly. Mus muculus: GRCh38.p4 primary assembly. Xenopus laevis: v10.1 assembly. Danio rerio: GRCz11 assembly. Supplementary files format and content: For gene specific tail seq of mRNA reporters tab delimited text files with columns indicating 1 sequence of the variable region; 2 median tail length; 3 number of reads; 4–7 tail lengths at quantile 10 25 75 and 90. Supplementary files format and content: For PAL seq v3 or v4 tab delimited files with columns indicating 1 gene ID or polyA site ID; 2 read cluster ID; 3 tail length Library strategy: PAL seq v4	embryo		Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5 100 mM KCl 5 mM MgCl2 1% [v/v] Triton X 100 100 µg/ml cycloheximide cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer] and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr denuded with 3 mg/ml hyaluronidase for 2 min washed and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases but for the N60 library injected into fish embryos and frog oocytes the N37 PAS N17 library injected into fish embryos and frog oocytes and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009 8 pmol KXSH010 and 2x SSC 0.3 M NaCl 30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher 65002 and incubated for 20 min at 23°C on a thermal mixer shaking with 15 sec on and 1 min 45 sec off. The superna…		tissue:embryo\|treatment:N1	GSM7716866	GSM7716866: Fish embryo mRNA 8cell PAL seq v4; Danio rerio; OTHER	GSM7716866 r1	GSM7716866	1	Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5 100 mM KCl 5 mM MgCl2 1% [v/v] Triton X 100 100 µg/ml cycloheximide cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer] and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr denuded with 3 mg/ml hyaluronidase for 2 min washed and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases but for the N60 library injected into fish embryos and frog oocytes the N37 PAS N17 library injected into fish embryos and frog oocytes and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009 8 pmol KXSH010 and 2x SSC 0.3 M NaCl 30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher 65002 and incubated for 20 min at 23°C on a thermal mixer shaking with 15 sec on and 1 min 45 sec off. The superna…		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina HiSeq 2500		SRP455680		Fish_embryo_mRNA_8cell_PAL_seq_v4_rep1_raw_read1.fastq.gz Fish_embryo_mRNA_8cell_PAL_seq_v4_rep1_raw_read2.fastq.gz	fastq fastq	2618998887.0	8530941.0	GSM7716866 r1	0:52 1:255	A:673066508;C:641446717;G:706546263;T:590452494;N:7486905	52	255	673066508	641446717	706546263	590452494	7486905	SRX21396037	SRS18636195	SRA1694849	Whitehead Institute	Whitehead Institute	2	0.0009	0.43244	0.00014	0.0054	0.99902	0.99967	0.54901	1.0	52	255	T	B	mate1 technical by mapping diff	illumina	hiseq_era	unknown	poly_a	unknown	bulk	bulk	bulk	United States	2023-08-17	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
25193	25193	SRR25670740	SRX21396037	SRS18636195	SRP455680	PRJNA1006406	Control of polyA tail length and translation in vertebrate oocytes and early embryos	GSE241107	Other	During oocyte maturation and early embryonic development polyA tail lengths strongly influence mRNA translation. However how tail lengths are controlled at different developmental stages has been unclear. Here we performed tail length and translational profiling of mRNA reporter libraries each with > 10 million three prime UTR sequence variants in frog oocytes and embryos and fish embryos. These analyses revealed that the UUUUA motif specifies cytoplasmic polyadenylation and identified diverse context features that modulate the activity of this 5 mer. Additional sequence motifs drive stage specific deadenylation in embryos and UUUUA and C rich motifs drive tail length independent translational repression in oocytes. A neural network model accurately predicts tail length change during oocyte maturation in frogs mice and humans. Analyses of human sequence variants showed that those predicted to disrupt tail length control have been under negative selection implying that our insights into control of polyA tail length and translation have implications for human health and fertility. Overall design: Sythetic mRNA reporter libraries with random three prime UTR sequences under four different sequence contexts were injected into frog oocytes and embryos and fish embryos. PolyA tail lengths were measured to at different developmental stages to examine sequence motifs that caused tail length changes. At the same time polyA tail lengths of endogenous mRNAs from frog oocytes and embryos fish embryos and mouse oocytes were measured to investiage how their tail lengths were controlled. Please note that sample titles have been updated on Jan 6 2024.			Fish embryo mRNA 8cell PAL seq v4	GSM7716866	source name:embryo\|tissue:embryo\|treatment:N1\|geo loc name:missing\|collection date:missing	Fish embryo mRNA 8cell PAL seq v4	For gene specific tail seq of mRNA reporters data were processed with a custom script available at https://github.com/coffeebond/MPRA tail seq. For PAL seq v3 or v4 reads were trimmed with cutadapt v3.7 with the parameters “ m 15 quality base=64 q 20 20 match read wildcards e 0.05 a NNNNATCTCGTATGCCGTCTTCTGCTTG O 7”. The trimmed reads were mapped using STAR v2.7.1a to the reference database containing the genomic sequences of the organism from which the mRNAs were obtained the genomic sequences of humans or fish depending on which spike in RNAs were used and the sequences of the polyA standards generated previously with the parameters “ runThreadN 16 runMode alignReads outFilterMultimapNmax 1 outReadsUnmapped Fastx outFilterType BySJout outSAMattributes All outSAMtype BAM Unsorted SortedByCoordinate”. Uniquely mapped read were furhter processed with a custom script available at https://github.com/coffeebond/PAL seq. Assembly: Homo sapiens: GRCh38.p7 primary assembly. Mus muculus: GRCh38.p4 primary assembly. Xenopus laevis: v10.1 assembly. Danio rerio: GRCz11 assembly. Supplementary files format and content: For gene specific tail seq of mRNA reporters tab delimited text files with columns indicating 1 sequence of the variable region; 2 median tail length; 3 number of reads; 4–7 tail lengths at quantile 10 25 75 and 90. Supplementary files format and content: For PAL seq v3 or v4 tab delimited files with columns indicating 1 gene ID or polyA site ID; 2 read cluster ID; 3 tail length Library strategy: PAL seq v4	embryo		Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5 100 mM KCl 5 mM MgCl2 1% [v/v] Triton X 100 100 µg/ml cycloheximide cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer] and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr denuded with 3 mg/ml hyaluronidase for 2 min washed and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases but for the N60 library injected into fish embryos and frog oocytes the N37 PAS N17 library injected into fish embryos and frog oocytes and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009 8 pmol KXSH010 and 2x SSC 0.3 M NaCl 30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher 65002 and incubated for 20 min at 23°C on a thermal mixer shaking with 15 sec on and 1 min 45 sec off. The superna…		tissue:embryo\|treatment:N1	GSM7716866	GSM7716866: Fish embryo mRNA 8cell PAL seq v4; Danio rerio; OTHER	GSM7716866 r1	GSM7716866	1	Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5 100 mM KCl 5 mM MgCl2 1% [v/v] Triton X 100 100 µg/ml cycloheximide cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer] and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr denuded with 3 mg/ml hyaluronidase for 2 min washed and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases but for the N60 library injected into fish embryos and frog oocytes the N37 PAS N17 library injected into fish embryos and frog oocytes and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009 8 pmol KXSH010 and 2x SSC 0.3 M NaCl 30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher 65002 and incubated for 20 min at 23°C on a thermal mixer shaking with 15 sec on and 1 min 45 sec off. The superna…		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina HiSeq 2500		SRP455680		Fish_embryo_mRNA_8cell_PAL_seq_v4_rep2_raw_read1.fastq.gz Fish_embryo_mRNA_8cell_PAL_seq_v4_rep2_raw_read2.fastq.gz	fastq fastq	3028839589.0	9865927.0	GSM7716866 r2	0:52 1:255	A:756368817;C:758868409;G:836949742;T:670545278;N:6107343	52	255	756368817	758868409	836949742	670545278	6107343	SRX21396037	SRS18636195	SRA1694849	Whitehead Institute	Whitehead Institute	2	0.00156	0.0	0.00026	0.0	0.99835	1.0	0.44791		52	255	T	T	mates < 9% mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	bulk	bulk	bulk	United States	2023-08-17	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
25194	25194	SRR25670741	SRX21396036	SRS18636194	SRP455680	PRJNA1006406	Control of polyA tail length and translation in vertebrate oocytes and early embryos	GSE241107	Other	During oocyte maturation and early embryonic development polyA tail lengths strongly influence mRNA translation. However how tail lengths are controlled at different developmental stages has been unclear. Here we performed tail length and translational profiling of mRNA reporter libraries each with > 10 million three prime UTR sequence variants in frog oocytes and embryos and fish embryos. These analyses revealed that the UUUUA motif specifies cytoplasmic polyadenylation and identified diverse context features that modulate the activity of this 5 mer. Additional sequence motifs drive stage specific deadenylation in embryos and UUUUA and C rich motifs drive tail length independent translational repression in oocytes. A neural network model accurately predicts tail length change during oocyte maturation in frogs mice and humans. Analyses of human sequence variants showed that those predicted to disrupt tail length control have been under negative selection implying that our insights into control of polyA tail length and translation have implications for human health and fertility. Overall design: Sythetic mRNA reporter libraries with random three prime UTR sequences under four different sequence contexts were injected into frog oocytes and embryos and fish embryos. PolyA tail lengths were measured to at different developmental stages to examine sequence motifs that caused tail length changes. At the same time polyA tail lengths of endogenous mRNAs from frog oocytes and embryos fish embryos and mouse oocytes were measured to investiage how their tail lengths were controlled. Please note that sample titles have been updated on Jan 6 2024.			Fish embryo mRNA 1cell PAL seq v4	GSM7716865	source name:embryo\|tissue:embryo\|treatment:N1\|geo loc name:missing\|collection date:missing	Fish embryo mRNA 1cell PAL seq v4	For gene specific tail seq of mRNA reporters data were processed with a custom script available at https://github.com/coffeebond/MPRA tail seq. For PAL seq v3 or v4 reads were trimmed with cutadapt v3.7 with the parameters “ m 15 quality base=64 q 20 20 match read wildcards e 0.05 a NNNNATCTCGTATGCCGTCTTCTGCTTG O 7”. The trimmed reads were mapped using STAR v2.7.1a to the reference database containing the genomic sequences of the organism from which the mRNAs were obtained the genomic sequences of humans or fish depending on which spike in RNAs were used and the sequences of the polyA standards generated previously with the parameters “ runThreadN 16 runMode alignReads outFilterMultimapNmax 1 outReadsUnmapped Fastx outFilterType BySJout outSAMattributes All outSAMtype BAM Unsorted SortedByCoordinate”. Uniquely mapped read were furhter processed with a custom script available at https://github.com/coffeebond/PAL seq. Assembly: Homo sapiens: GRCh38.p7 primary assembly. Mus muculus: GRCh38.p4 primary assembly. Xenopus laevis: v10.1 assembly. Danio rerio: GRCz11 assembly. Supplementary files format and content: For gene specific tail seq of mRNA reporters tab delimited text files with columns indicating 1 sequence of the variable region; 2 median tail length; 3 number of reads; 4–7 tail lengths at quantile 10 25 75 and 90. Supplementary files format and content: For PAL seq v3 or v4 tab delimited files with columns indicating 1 gene ID or polyA site ID; 2 read cluster ID; 3 tail length Library strategy: PAL seq v4	embryo		Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5 100 mM KCl 5 mM MgCl2 1% [v/v] Triton X 100 100 µg/ml cycloheximide cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer] and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr denuded with 3 mg/ml hyaluronidase for 2 min washed and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases but for the N60 library injected into fish embryos and frog oocytes the N37 PAS N17 library injected into fish embryos and frog oocytes and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009 8 pmol KXSH010 and 2x SSC 0.3 M NaCl 30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher 65002 and incubated for 20 min at 23°C on a thermal mixer shaking with 15 sec on and 1 min 45 sec off. The superna…		tissue:embryo\|treatment:N1	GSM7716865	GSM7716865: Fish embryo mRNA 1cell PAL seq v4; Danio rerio; OTHER	GSM7716865 r1	GSM7716865	1	Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5 100 mM KCl 5 mM MgCl2 1% [v/v] Triton X 100 100 µg/ml cycloheximide cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer] and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr denuded with 3 mg/ml hyaluronidase for 2 min washed and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases but for the N60 library injected into fish embryos and frog oocytes the N37 PAS N17 library injected into fish embryos and frog oocytes and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009 8 pmol KXSH010 and 2x SSC 0.3 M NaCl 30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher 65002 and incubated for 20 min at 23°C on a thermal mixer shaking with 15 sec on and 1 min 45 sec off. The superna…		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina HiSeq 2500		SRP455680		Fish_embryo_mRNA_1cell_PAL_seq_v4_rep1_raw_read1.fastq.gz Fish_embryo_mRNA_1cell_PAL_seq_v4_rep1_raw_read2.fastq.gz	fastq fastq	2050143851.0	6677993.0	GSM7716865 r1	0:52 1:255	A:536391564;C:527126186;G:557802929;T:422990166;N:5833006	52	255	536391564	527126186	557802929	422990166	5833006	SRX21396036	SRS18636194	SRA1694849	Whitehead Institute	Whitehead Institute	2	0.00016	0.46479	4e-05	0.01408	0.99979	0.99969	0.54545	1.0	52	255	T	B	mate1 technical by mapping diff	illumina	hiseq_era	unknown	poly_a	unknown	bulk	bulk	bulk	United States	2023-08-17	Zygote	Embryo	Embryo Imprecise	All anatomical structures
25195	25195	SRR25670742	SRX21396036	SRS18636194	SRP455680	PRJNA1006406	Control of polyA tail length and translation in vertebrate oocytes and early embryos	GSE241107	Other	During oocyte maturation and early embryonic development polyA tail lengths strongly influence mRNA translation. However how tail lengths are controlled at different developmental stages has been unclear. Here we performed tail length and translational profiling of mRNA reporter libraries each with > 10 million three prime UTR sequence variants in frog oocytes and embryos and fish embryos. These analyses revealed that the UUUUA motif specifies cytoplasmic polyadenylation and identified diverse context features that modulate the activity of this 5 mer. Additional sequence motifs drive stage specific deadenylation in embryos and UUUUA and C rich motifs drive tail length independent translational repression in oocytes. A neural network model accurately predicts tail length change during oocyte maturation in frogs mice and humans. Analyses of human sequence variants showed that those predicted to disrupt tail length control have been under negative selection implying that our insights into control of polyA tail length and translation have implications for human health and fertility. Overall design: Sythetic mRNA reporter libraries with random three prime UTR sequences under four different sequence contexts were injected into frog oocytes and embryos and fish embryos. PolyA tail lengths were measured to at different developmental stages to examine sequence motifs that caused tail length changes. At the same time polyA tail lengths of endogenous mRNAs from frog oocytes and embryos fish embryos and mouse oocytes were measured to investiage how their tail lengths were controlled. Please note that sample titles have been updated on Jan 6 2024.			Fish embryo mRNA 1cell PAL seq v4	GSM7716865	source name:embryo\|tissue:embryo\|treatment:N1\|geo loc name:missing\|collection date:missing	Fish embryo mRNA 1cell PAL seq v4	For gene specific tail seq of mRNA reporters data were processed with a custom script available at https://github.com/coffeebond/MPRA tail seq. For PAL seq v3 or v4 reads were trimmed with cutadapt v3.7 with the parameters “ m 15 quality base=64 q 20 20 match read wildcards e 0.05 a NNNNATCTCGTATGCCGTCTTCTGCTTG O 7”. The trimmed reads were mapped using STAR v2.7.1a to the reference database containing the genomic sequences of the organism from which the mRNAs were obtained the genomic sequences of humans or fish depending on which spike in RNAs were used and the sequences of the polyA standards generated previously with the parameters “ runThreadN 16 runMode alignReads outFilterMultimapNmax 1 outReadsUnmapped Fastx outFilterType BySJout outSAMattributes All outSAMtype BAM Unsorted SortedByCoordinate”. Uniquely mapped read were furhter processed with a custom script available at https://github.com/coffeebond/PAL seq. Assembly: Homo sapiens: GRCh38.p7 primary assembly. Mus muculus: GRCh38.p4 primary assembly. Xenopus laevis: v10.1 assembly. Danio rerio: GRCz11 assembly. Supplementary files format and content: For gene specific tail seq of mRNA reporters tab delimited text files with columns indicating 1 sequence of the variable region; 2 median tail length; 3 number of reads; 4–7 tail lengths at quantile 10 25 75 and 90. Supplementary files format and content: For PAL seq v3 or v4 tab delimited files with columns indicating 1 gene ID or polyA site ID; 2 read cluster ID; 3 tail length Library strategy: PAL seq v4	embryo		Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5 100 mM KCl 5 mM MgCl2 1% [v/v] Triton X 100 100 µg/ml cycloheximide cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer] and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr denuded with 3 mg/ml hyaluronidase for 2 min washed and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases but for the N60 library injected into fish embryos and frog oocytes the N37 PAS N17 library injected into fish embryos and frog oocytes and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009 8 pmol KXSH010 and 2x SSC 0.3 M NaCl 30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher 65002 and incubated for 20 min at 23°C on a thermal mixer shaking with 15 sec on and 1 min 45 sec off. The superna…		tissue:embryo\|treatment:N1	GSM7716865	GSM7716865: Fish embryo mRNA 1cell PAL seq v4; Danio rerio; OTHER	GSM7716865 r1	GSM7716865	1	Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5 100 mM KCl 5 mM MgCl2 1% [v/v] Triton X 100 100 µg/ml cycloheximide cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer] and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr denuded with 3 mg/ml hyaluronidase for 2 min washed and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases but for the N60 library injected into fish embryos and frog oocytes the N37 PAS N17 library injected into fish embryos and frog oocytes and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009 8 pmol KXSH010 and 2x SSC 0.3 M NaCl 30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher 65002 and incubated for 20 min at 23°C on a thermal mixer shaking with 15 sec on and 1 min 45 sec off. The superna…		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina HiSeq 2500		SRP455680		Fish_embryo_mRNA_1cell_PAL_seq_v4_rep2_raw_read1.fastq.gz Fish_embryo_mRNA_1cell_PAL_seq_v4_rep2_raw_read2.fastq.gz	fastq fastq	3406093776.0	11094768.0	GSM7716865 r2	0:52 1:255	A:868054279;C:890446070;G:945289336;T:695324057;N:6980034	52	255	868054279	890446070	945289336	695324057	6980034	SRX21396036	SRS18636194	SRA1694849	Whitehead Institute	Whitehead Institute	2	0.00049	0.0	0.00014	0.0	0.99939	1.0	0.58974		52	255	T	T	mates < 9% mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	bulk	bulk	bulk	United States	2023-08-17	Zygote	Embryo	Embryo Imprecise	All anatomical structures
33990	33990	SRR31030860	SRX26416598	SRS22936450	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.	pubmed:39605352;pubmed:40037712		ZF NES GAPDH Rep4 minus	GSM8578751	source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo NES\|treatment:minus DBF\|geo loc name:missing\|collection date:missing	ZF NES GAPDH Rep4 minus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos		RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo NES\|treatment:minus DBF	GSM8578751	GSM8578751: ZF NES GAPDH Rep4 minus; Danio rerio; OTHER	GSM8578751 r1	GSM8578751	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182		ZF_NES_GAPDH_Rep4_minus.R1.fq.gz ZF_NES_GAPDH_Rep4_minus.R2.fq.gz	fastq fastq	1100578200.0	3668594.0	GSM8578751 r1	0:150 1:150	A:287878221;C:249390946;G:265835736;T:297454600;N:18697	150	150	287878221	249390946	265835736	297454600	18697	SRX26416598	SRS22936450	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	biological fallback assumption	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
33991	33991	SRR31030861	SRX26416597	SRS22936451	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.	pubmed:39605352;pubmed:40037712		ZF NES GAPDH Rep3 plus	GSM8578750	source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo NES\|treatment:plus DBF\|geo loc name:missing\|collection date:missing	ZF NES GAPDH Rep3 plus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos		RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo NES\|treatment:plus DBF	GSM8578750	GSM8578750: ZF NES GAPDH Rep3 plus; Danio rerio; OTHER	GSM8578750 r1	GSM8578750	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182		ZF_NES_GAPDH_Rep3_plus.R1.fq.gz ZF_NES_GAPDH_Rep3_plus.R2.fq.gz	fastq fastq	1231779300.0	4105931.0	GSM8578750 r1	0:150 1:150	A:322256597;C:278991471;G:297394980;T:333116282;N:19970	150	150	322256597	278991471	297394980	333116282	19970	SRX26416597	SRS22936451	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	biological fallback assumption	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
33992	33992	SRR31030862	SRX26416596	SRS22936449	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.	pubmed:39605352;pubmed:40037712		ZF NES GAPDH Rep3 minus	GSM8578749	source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo NES\|treatment:minus DBF\|geo loc name:missing\|collection date:missing	ZF NES GAPDH Rep3 minus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos		RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo NES\|treatment:minus DBF	GSM8578749	GSM8578749: ZF NES GAPDH Rep3 minus; Danio rerio; OTHER	GSM8578749 r1	GSM8578749	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182		ZF_NES_GAPDH_Rep3_minus.R1.fq.gz ZF_NES_GAPDH_Rep3_minus.R2.fq.gz	fastq fastq	1002124500.0	3340415.0	GSM8578749 r1	0:150 1:150	A:262024969;C:227163761;G:242157218;T:270761424;N:17128	150	150	262024969	227163761	242157218	270761424	17128	SRX26416596	SRS22936449	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	biological fallback assumption	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
33993	33993	SRR31030863	SRX26416595	SRS22936448	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.	pubmed:39605352;pubmed:40037712		ZF NES GAPDH Rep2 plus	GSM8578748	source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo NES\|treatment:plus DBF\|geo loc name:missing\|collection date:missing	ZF NES GAPDH Rep2 plus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos		RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo NES\|treatment:plus DBF	GSM8578748	GSM8578748: ZF NES GAPDH Rep2 plus; Danio rerio; OTHER	GSM8578748 r1	GSM8578748	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182		ZF_NES_GAPDH_Rep2_plus.R1.fq.gz ZF_NES_GAPDH_Rep2_plus.R2.fq.gz	fastq fastq	1051565100.0	3505217.0	GSM8578748 r1	0:150 1:150	A:275784945;C:237523425;G:253300749;T:284937948;N:18033	150	150	275784945	237523425	253300749	284937948	18033	SRX26416595	SRS22936448	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	biological fallback assumption	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
33994	33994	SRR31030864	SRX26416594	SRS22936447	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.	pubmed:39605352;pubmed:40037712		ZF NES GAPDH Rep2 minus	GSM8578747	source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo NES\|treatment:minus DBF\|geo loc name:missing\|collection date:missing	ZF NES GAPDH Rep2 minus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos		RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo NES\|treatment:minus DBF	GSM8578747	GSM8578747: ZF NES GAPDH Rep2 minus; Danio rerio; OTHER	GSM8578747 r1	GSM8578747	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182		ZF_NES_GAPDH_Rep2_minus.R1.fq.gz ZF_NES_GAPDH_Rep2_minus.R2.fq.gz	fastq fastq	1021837200.0	3406124.0	GSM8578747 r1	0:150 1:150	A:268290250;C:230525208;G:245949056;T:277056045;N:16641	150	150	268290250	230525208	245949056	277056045	16641	SRX26416594	SRS22936447	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	biological fallback assumption	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
33995	33995	SRR31030865	SRX26416593	SRS22936446	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.	pubmed:39605352;pubmed:40037712		ZF NES GAPDH Rep1 plus	GSM8578746	source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo NES\|treatment:plus DBF\|geo loc name:missing\|collection date:missing	ZF NES GAPDH Rep1 plus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos		RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo NES\|treatment:plus DBF	GSM8578746	GSM8578746: ZF NES GAPDH Rep1 plus; Danio rerio; OTHER	GSM8578746 r1	GSM8578746	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182		ZF_NES_GAPDH_Rep1_plus.R1.fq.gz ZF_NES_GAPDH_Rep1_plus.R2.fq.gz	fastq fastq	1093620300.0	3645401.0	GSM8578746 r1	0:150 1:150	A:285989719;C:247805250;G:264181043;T:295625946;N:18342	150	150	285989719	247805250	264181043	295625946	18342	SRX26416593	SRS22936446	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	biological fallback assumption	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
33996	33996	SRR31030866	SRX26416592	SRS22936445	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.	pubmed:39605352;pubmed:40037712		ZF NES GAPDH Rep1 minus	GSM8578745	source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo NES\|treatment:minus DBF\|geo loc name:missing\|collection date:missing	ZF NES GAPDH Rep1 minus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos		RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo NES\|treatment:minus DBF	GSM8578745	GSM8578745: ZF NES GAPDH Rep1 minus; Danio rerio; OTHER	GSM8578745 r1	GSM8578745	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182		ZF_NES_GAPDH_Rep1_minus.R1.fq.gz ZF_NES_GAPDH_Rep1_minus.R2.fq.gz	fastq fastq	911747100.0	3039157.0	GSM8578745 r1	0:150 1:150	A:239833349;C:205185786;G:218897710;T:247814511;N:15744	150	150	239833349	205185786	218897710	247814511	15744	SRX26416592	SRS22936445	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	biological fallback assumption	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
33997	33997	SRR31030867	SRX26416591	SRS22936444	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.	pubmed:39605352;pubmed:40037712		ZF H2B MALAT1 Rep4 plus	GSM8578744	source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:plus DBF\|geo loc name:missing\|collection date:missing	ZF H2B MALAT1 Rep4 plus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos		RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:plus DBF	GSM8578744	GSM8578744: ZF H2B MALAT1 Rep4 plus; Danio rerio; OTHER	GSM8578744 r1	GSM8578744	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182		ZF_H2B_MALAT1_Rep4_plus.R1.fq.gz ZF_H2B_MALAT1_Rep4_plus.R2.fq.gz	fastq fastq	842103300.0	2807011.0	GSM8578744 r1	0:150 1:150	A:204870477;C:222752099;G:215404135;T:199062275;N:14314	150	150	204870477	222752099	215404135	199062275	14314	SRX26416591	SRS22936444	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	biological fallback assumption	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
33998	33998	SRR31030868	SRX26416590	SRS22936442	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.	pubmed:39605352;pubmed:40037712		ZF H2B MALAT1 Rep4 minus	GSM8578743	source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:minus DBF\|geo loc name:missing\|collection date:missing	ZF H2B MALAT1 Rep4 minus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos		RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:minus DBF	GSM8578743	GSM8578743: ZF H2B MALAT1 Rep4 minus; Danio rerio; OTHER	GSM8578743 r1	GSM8578743	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182		ZF_H2B_MALAT1_Rep4_minus.R1.fq.gz ZF_H2B_MALAT1_Rep4_minus.R2.fq.gz	fastq fastq	1166375100.0	3887917.0	GSM8578743 r1	0:150 1:150	A:283781955;C:308660466;G:298298204;T:275614377;N:20098	150	150	283781955	308660466	298298204	275614377	20098	SRX26416590	SRS22936442	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	biological fallback assumption	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
33999	33999	SRR31030869	SRX26416589	SRS22936443	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.	pubmed:39605352;pubmed:40037712		ZF H2B MALAT1 Rep3 plus	GSM8578742	source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:plus DBF\|geo loc name:missing\|collection date:missing	ZF H2B MALAT1 Rep3 plus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos		RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:plus DBF	GSM8578742	GSM8578742: ZF H2B MALAT1 Rep3 plus; Danio rerio; OTHER	GSM8578742 r1	GSM8578742	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182		ZF_H2B_MALAT1_Rep3_plus.R1.fq.gz ZF_H2B_MALAT1_Rep3_plus.R2.fq.gz	fastq fastq	1159439400.0	3864798.0	GSM8578742 r1	0:150 1:150	A:282055391;C:306842216;G:296569227;T:273952570;N:19996	150	150	282055391	306842216	296569227	273952570	19996	SRX26416589	SRS22936443	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	biological fallback assumption	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34000	34000	SRR31030870	SRX26416588	SRS22936440	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.	pubmed:39605352;pubmed:40037712		ZF H2B MALAT1 Rep3 minus	GSM8578741	source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:minus DBF\|geo loc name:missing\|collection date:missing	ZF H2B MALAT1 Rep3 minus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos		RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:minus DBF	GSM8578741	GSM8578741: ZF H2B MALAT1 Rep3 minus; Danio rerio; OTHER	GSM8578741 r1	GSM8578741	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182		ZF_H2B_MALAT1_Rep3_minus.R1.fq.gz ZF_H2B_MALAT1_Rep3_minus.R2.fq.gz	fastq fastq	1008297600.0	3360992.0	GSM8578741 r1	0:150 1:150	A:245277585;C:266840408;G:257911846;T:238251305;N:16456	150	150	245277585	266840408	257911846	238251305	16456	SRX26416588	SRS22936440	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	biological fallback assumption	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34001	34001	SRR31030871	SRX26416587	SRS22936441	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.	pubmed:39605352;pubmed:40037712		ZF H2B MALAT1 Rep2 plus	GSM8578740	source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:plus DBF\|geo loc name:missing\|collection date:missing	ZF H2B MALAT1 Rep2 plus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos		RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:plus DBF	GSM8578740	GSM8578740: ZF H2B MALAT1 Rep2 plus; Danio rerio; OTHER	GSM8578740 r1	GSM8578740	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182		ZF_H2B_MALAT1_Rep2_plus.R1.fq.gz ZF_H2B_MALAT1_Rep2_plus.R2.fq.gz	fastq fastq	1419263400.0	4730878.0	GSM8578740 r1	0:150 1:150	A:345302268;C:375591885;G:362956395;T:335387828;N:25024	150	150	345302268	375591885	362956395	335387828	25024	SRX26416587	SRS22936441	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	biological fallback assumption	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34002	34002	SRR31030872	SRX26416586	SRS22936439	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.	pubmed:39605352;pubmed:40037712		ZF H2B MALAT1 Rep2 minus	GSM8578739	source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:minus DBF\|geo loc name:missing\|collection date:missing	ZF H2B MALAT1 Rep2 minus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos		RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:minus DBF	GSM8578739	GSM8578739: ZF H2B MALAT1 Rep2 minus; Danio rerio; OTHER	GSM8578739 r1	GSM8578739	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182		ZF_H2B_MALAT1_Rep2_minus.R1.fq.gz ZF_H2B_MALAT1_Rep2_minus.R2.fq.gz	fastq fastq	1249910700.0	4166369.0	GSM8578739 r1	0:150 1:150	A:304074828;C:330741431;G:319677748;T:295395235;N:21458	150	150	304074828	330741431	319677748	295395235	21458	SRX26416586	SRS22936439	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	biological fallback assumption	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34003	34003	SRR31030873	SRX26416585	SRS22936438	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.	pubmed:39605352;pubmed:40037712		ZF H2B MALAT1 Rep1 plus	GSM8578738	source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:plus DBF\|geo loc name:missing\|collection date:missing	ZF H2B MALAT1 Rep1 plus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos		RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:plus DBF	GSM8578738	GSM8578738: ZF H2B MALAT1 Rep1 plus; Danio rerio; OTHER	GSM8578738 r1	GSM8578738	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182		ZF_H2B_MALAT1_Rep1_plus.R1.fq.gz ZF_H2B_MALAT1_Rep1_plus.R2.fq.gz	fastq fastq	1257872700.0	4192909.0	GSM8578738 r1	0:150 1:150	A:306022947;C:332851039;G:321699513;T:297277788;N:21413	150	150	306022947	332851039	321699513	297277788	21413	SRX26416585	SRS22936438	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	biological fallback assumption	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34004	34004	SRR31030874	SRX26416584	SRS22936437	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.	pubmed:39605352;pubmed:40037712		ZF H2B MALAT1 Rep1 minus	GSM8578737	source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:minus DBF\|geo loc name:missing\|collection date:missing	ZF H2B MALAT1 Rep1 minus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos		RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:minus DBF	GSM8578737	GSM8578737: ZF H2B MALAT1 Rep1 minus; Danio rerio; OTHER	GSM8578737 r1	GSM8578737	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182		ZF_H2B_MALAT1_Rep1_minus.R1.fq.gz ZF_H2B_MALAT1_Rep1_minus.R2.fq.gz	fastq fastq	1377040200.0	4590134.0	GSM8578737 r1	0:150 1:150	A:335021330;C:364359707;G:352178356;T:325457746;N:23061	150	150	335021330	364359707	352178356	325457746	23061	SRX26416584	SRS22936437	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	biological fallback assumption	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34005	34005	SRR31030875	SRX26416583	SRS22936435	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.	pubmed:39605352;pubmed:40037712		ZF H2B GAPDH Rep4 plus	GSM8578736	source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:plus DBF\|geo loc name:missing\|collection date:missing	ZF H2B GAPDH Rep4 plus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos		RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:plus DBF	GSM8578736	GSM8578736: ZF H2B GAPDH Rep4 plus; Danio rerio; OTHER	GSM8578736 r1	GSM8578736	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182		ZF_H2B_GAPDH_Rep4_plus.R1.fq.gz ZF_H2B_GAPDH_Rep4_plus.R2.fq.gz	fastq fastq	1051103100.0	3503677.0	GSM8578736 r1	0:150 1:150	A:274220771;C:238733668;G:254670769;T:283460283;N:17609	150	150	274220771	238733668	254670769	283460283	17609	SRX26416583	SRS22936435	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	mate1-mate2 similar by mapping diff	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34006	34006	SRR31030876	SRX26416582	SRS22936436	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.	pubmed:39605352;pubmed:40037712		ZF H2B GAPDH Rep4 minus	GSM8578735	source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:minus DBF\|geo loc name:missing\|collection date:missing	ZF H2B GAPDH Rep4 minus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos		RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:minus DBF	GSM8578735	GSM8578735: ZF H2B GAPDH Rep4 minus; Danio rerio; OTHER	GSM8578735 r1	GSM8578735	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182		ZF_H2B_GAPDH_Rep4_minus.R1.fq.gz ZF_H2B_GAPDH_Rep4_minus.R2.fq.gz	fastq fastq	1206485700.0	4021619.0	GSM8578735 r1	0:150 1:150	A:314740194;C:274101014;G:292357972;T:325267132;N:19388	150	150	314740194	274101014	292357972	325267132	19388	SRX26416582	SRS22936436	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	mate1-mate2 similar by mapping diff	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34007	34007	SRR31030877	SRX26416581	SRS22936434	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.	pubmed:39605352;pubmed:40037712		ZF H2B GAPDH Rep3 plus	GSM8578734	source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:plus DBF\|geo loc name:missing\|collection date:missing	ZF H2B GAPDH Rep3 plus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos		RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:plus DBF	GSM8578734	GSM8578734: ZF H2B GAPDH Rep3 plus; Danio rerio; OTHER	GSM8578734 r1	GSM8578734	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182		ZF_H2B_GAPDH_Rep3_plus.R1.fq.gz ZF_H2B_GAPDH_Rep3_plus.R2.fq.gz	fastq fastq	1140550200.0	3801834.0	GSM8578734 r1	0:150 1:150	A:297636297;C:258828826;G:276373993;T:307692213;N:18871	150	150	297636297	258828826	276373993	307692213	18871	SRX26416581	SRS22936434	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	mate1-mate2 similar by mapping diff	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34008	34008	SRR31030878	SRX26416580	SRS22936433	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.	pubmed:39605352;pubmed:40037712		ZF H2B GAPDH Rep3 minus	GSM8578733	source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:minus DBF\|geo loc name:missing\|collection date:missing	ZF H2B GAPDH Rep3 minus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos		RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:minus DBF	GSM8578733	GSM8578733: ZF H2B GAPDH Rep3 minus; Danio rerio; OTHER	GSM8578733 r1	GSM8578733	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182		ZF_H2B_GAPDH_Rep3_minus.R1.fq.gz ZF_H2B_GAPDH_Rep3_minus.R2.fq.gz	fastq fastq	782406600.0	2608022.0	GSM8578733 r1	0:150 1:150	A:204132316;C:177696721;G:189675433;T:210888939;N:13191	150	150	204132316	177696721	189675433	210888939	13191	SRX26416580	SRS22936433	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	mate1-mate2 similar by mapping diff	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34009	34009	SRR31030879	SRX26416579	SRS22936431	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.	pubmed:39605352;pubmed:40037712		ZF H2B GAPDH Rep2 plus	GSM8578732	source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:plus DBF\|geo loc name:missing\|collection date:missing	ZF H2B GAPDH Rep2 plus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos		RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:plus DBF	GSM8578732	GSM8578732: ZF H2B GAPDH Rep2 plus; Danio rerio; OTHER	GSM8578732 r1	GSM8578732	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182		ZF_H2B_GAPDH_Rep2_plus.R1.fq.gz ZF_H2B_GAPDH_Rep2_plus.R2.fq.gz	fastq fastq	958297200.0	3194324.0	GSM8578732 r1	0:150 1:150	A:250011335;C:217600823;G:232206339;T:258462392;N:16311	150	150	250011335	217600823	232206339	258462392	16311	SRX26416579	SRS22936431	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	mate1-mate2 similar by mapping diff	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34010	34010	SRR31030880	SRX26416578	SRS22936432	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.	pubmed:39605352;pubmed:40037712		ZF H2B GAPDH Rep2 minus	GSM8578731	source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:minus DBF\|geo loc name:missing\|collection date:missing	ZF H2B GAPDH Rep2 minus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos		RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:minus DBF	GSM8578731	GSM8578731: ZF H2B GAPDH Rep2 minus; Danio rerio; OTHER	GSM8578731 r1	GSM8578731	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182		ZF_H2B_GAPDH_Rep2_minus.R1.fq.gz ZF_H2B_GAPDH_Rep2_minus.R2.fq.gz	fastq fastq	1020926700.0	3403089.0	GSM8578731 r1	0:150 1:150	A:266429488;C:231749424;G:247353147;T:275377720;N:16921	150	150	266429488	231749424	247353147	275377720	16921	SRX26416578	SRS22936432	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	mate1-mate2 similar by mapping diff	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34011	34011	SRR31030881	SRX26416577	SRS22936430	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.	pubmed:39605352;pubmed:40037712		ZF H2B GAPDH Rep1 plus	GSM8578730	source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:plus DBF\|geo loc name:missing\|collection date:missing	ZF H2B GAPDH Rep1 plus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos		RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:plus DBF	GSM8578730	GSM8578730: ZF H2B GAPDH Rep1 plus; Danio rerio; OTHER	GSM8578730 r1	GSM8578730	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182		ZF_H2B_GAPDH_Rep1_plus.R1.fq.gz ZF_H2B_GAPDH_Rep1_plus.R2.fq.gz	fastq fastq	1134318600.0	3781062.0	GSM8578730 r1	0:150 1:150	A:295931335;C:257596481;G:274848790;T:305922827;N:19167	150	150	295931335	257596481	274848790	305922827	19167	SRX26416577	SRS22936430	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	mate1-mate2 similar by mapping diff	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34012	34012	SRR31030882	SRX26416576	SRS22936429	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.	pubmed:39605352;pubmed:40037712		ZF H2B GAPDH Rep1 minus	GSM8578729	source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:minus DBF\|geo loc name:missing\|collection date:missing	ZF H2B GAPDH Rep1 minus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos		RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:minus DBF	GSM8578729	GSM8578729: ZF H2B GAPDH Rep1 minus; Danio rerio; OTHER	GSM8578729 r1	GSM8578729	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182		ZF_H2B_GAPDH_Rep1_minus.R1.fq.gz ZF_H2B_GAPDH_Rep1_minus.R2.fq.gz	fastq fastq	752638800.0	2508796.0	GSM8578729 r1	0:150 1:150	A:196331185;C:170899863;G:182460258;T:202935049;N:12445	150	150	196331185	170899863	182460258	202935049	12445	SRX26416576	SRS22936429	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	mate1-mate2 similar by mapping diff	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34013	34013	SRR31031004	SRX26416454	SRS22936307	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.	pubmed:39605352;pubmed:40037712		Zeb WT pDBF Rep3	GSM8578770	source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:wildtype\|treatment:plus DBF\|geo loc name:missing\|collection date:missing	Zeb WT pDBF Rep3	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos		RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:wildtype\|treatment:plus DBF	GSM8578770	GSM8578770: Zeb WT pDBF Rep3; Danio rerio; OTHER	GSM8578770 r1	GSM8578770	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182		Zeb_WT_pDBF_Rep3.R1.fq.gz Zeb_WT_pDBF_Rep3.R2.fq.gz	fastq fastq	23216831100.0	77389437.0	GSM8578770 r1	0:150 1:150	A:7577896837;C:3508911439;G:4823311862;T:7306393244;N:317718	150	150	7577896837	3508911439	4823311862	7306393244	317718	SRX26416454	SRS22936307	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	mate2-mate1 similar by mapping diff	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34014	34014	SRR31031005	SRX26416453	SRS22936305	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.	pubmed:39605352;pubmed:40037712		Zeb WT pDBF Rep2	GSM8578769	source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:wildtype\|treatment:plus DBF\|geo loc name:missing\|collection date:missing	Zeb WT pDBF Rep2	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos		RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:wildtype\|treatment:plus DBF	GSM8578769	GSM8578769: Zeb WT pDBF Rep2; Danio rerio; OTHER	GSM8578769 r1	GSM8578769	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182		Zeb_WT_pDBF_Rep2.R1.fq.gz Zeb_WT_pDBF_Rep2.R2.fq.gz	fastq fastq	27237049500.0	90790165.0	GSM8578769 r1	0:150 1:150	A:8800724632;C:4062692793;G:5651432074;T:8721823175;N:376826	150	150	8800724632	4062692793	5651432074	8721823175	376826	SRX26416453	SRS22936305	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	mate2-mate1 similar by mapping diff	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34015	34015	SRR31031006	SRX26416452	SRS22936306	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.	pubmed:39605352;pubmed:40037712		Zeb WT pDBF Rep1	GSM8578768	source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:wildtype\|treatment:plus DBF\|geo loc name:missing\|collection date:missing	Zeb WT pDBF Rep1	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos		RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:wildtype\|treatment:plus DBF	GSM8578768	GSM8578768: Zeb WT pDBF Rep1; Danio rerio; OTHER	GSM8578768 r1	GSM8578768	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182		Zeb_WT_pDBF_Rep1.R1.fq.gz Zeb_WT_pDBF_Rep1.R2.fq.gz	fastq fastq	22364115300.0	74547051.0	GSM8578768 r1	0:150 1:150	A:7336106577;C:3346831944;G:4451536371;T:7229335436;N:304972	150	150	7336106577	3346831944	4451536371	7229335436	304972	SRX26416452	SRS22936306	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	mate2-mate1 similar by mapping diff	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34016	34016	SRR31031007	SRX26416451	SRS22936304	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.	pubmed:39605352;pubmed:40037712		Zeb WT mDBF Rep3	GSM8578767	source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:wildtype\|treatment:minus DBF\|geo loc name:missing\|collection date:missing	Zeb WT mDBF Rep3	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos		RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:wildtype\|treatment:minus DBF	GSM8578767	GSM8578767: Zeb WT mDBF Rep3; Danio rerio; OTHER	GSM8578767 r1	GSM8578767	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182		Zeb_WT_mDBF_Rep3.R1.fq.gz Zeb_WT_mDBF_Rep3.R2.fq.gz	fastq fastq	20112719100.0	67042397.0	GSM8578767 r1	0:150 1:150	A:6537370232;C:2924919118;G:3973928235;T:6676228153;N:273362	150	150	6537370232	2924919118	3973928235	6676228153	273362	SRX26416451	SRS22936304	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	mate2-mate1 similar by mapping diff	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34017	34017	SRR31031008	SRX26416450	SRS22936303	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.	pubmed:39605352;pubmed:40037712		Zeb WT mDBF Rep2	GSM8578766	source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:wildtype\|treatment:minus DBF\|geo loc name:missing\|collection date:missing	Zeb WT mDBF Rep2	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos		RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:wildtype\|treatment:minus DBF	GSM8578766	GSM8578766: Zeb WT mDBF Rep2; Danio rerio; OTHER	GSM8578766 r1	GSM8578766	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182		Zeb_WT_mDBF_Rep2.R1.fq.gz Zeb_WT_mDBF_Rep2.R2.fq.gz	fastq fastq	24839552100.0	82798507.0	GSM8578766 r1	0:150 1:150	A:8176074473;C:3715794630;G:4984816273;T:7962528150;N:338574	150	150	8176074473	3715794630	4984816273	7962528150	338574	SRX26416450	SRS22936303	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	mate2-mate1 similar by mapping diff	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34018	34018	SRR31031009	SRX26416449	SRS22936302	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.	pubmed:39605352;pubmed:40037712		Zeb WT mDBF Rep1	GSM8578765	source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:wildtype\|treatment:minus DBF\|geo loc name:missing\|collection date:missing	Zeb WT mDBF Rep1	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos		RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:wildtype\|treatment:minus DBF	GSM8578765	GSM8578765: Zeb WT mDBF Rep1; Danio rerio; OTHER	GSM8578765 r1	GSM8578765	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182		Zeb_WT_mDBF_Rep1.R1.fq.gz Zeb_WT_mDBF_Rep1.R2.fq.gz	fastq fastq	23029785600.0	76765952.0	GSM8578765 r1	0:150 1:150	A:7509388471;C:3438475939;G:4820328116;T:7261277960;N:315114	150	150	7509388471	3438475939	4820328116	7261277960	315114	SRX26416449	SRS22936302	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	mate2-mate1 similar by mapping diff	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34019	34019	SRR31031010	SRX26416448	SRS22936301	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.	pubmed:39605352;pubmed:40037712		Zeb NES pDBF Rep2	GSM8578764	source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo NES\|treatment:plus DBF\|geo loc name:missing\|collection date:missing	Zeb NES pDBF Rep2	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos		RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo NES\|treatment:plus DBF	GSM8578764	GSM8578764: Zeb NES pDBF Rep2; Danio rerio; OTHER	GSM8578764 r1	GSM8578764	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182		Zeb_NES_pDBF_Rep2.R1.fq.gz Zeb_NES_pDBF_Rep2.R2.fq.gz	fastq fastq	25465584900.0	84885283.0	GSM8578764 r1	0:150 1:150	A:7944190976;C:4330095891;G:5473069331;T:7718120992;N:107710	150	150	7944190976	4330095891	5473069331	7718120992	107710	SRX26416448	SRS22936301	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	mate2-mate1 similar by mapping diff	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34020	34020	SRR31031011	SRX26416447	SRS22936300	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.	pubmed:39605352;pubmed:40037712		Zeb NES pDBF Rep1	GSM8578763	source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo NES\|treatment:plus DBF\|geo loc name:missing\|collection date:missing	Zeb NES pDBF Rep1	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos		RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo NES\|treatment:plus DBF	GSM8578763	GSM8578763: Zeb NES pDBF Rep1; Danio rerio; OTHER	GSM8578763 r1	GSM8578763	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182		Zeb_NES_pDBF_Rep1.R1.fq.gz Zeb_NES_pDBF_Rep1.R2.fq.gz	fastq fastq	21107351400.0	70357838.0	GSM8578763 r1	0:150 1:150	A:6528579219;C:3620666961;G:4496642830;T:6461373643;N:88747	150	150	6528579219	3620666961	4496642830	6461373643	88747	SRX26416447	SRS22936300	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	mate2-mate1 similar by mapping diff	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34021	34021	SRR31031012	SRX26416446	SRS22936299	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.	pubmed:39605352;pubmed:40037712		Zeb NES mDBF Rep2	GSM8578762	source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo NES\|treatment:minus DBF\|geo loc name:missing\|collection date:missing	Zeb NES mDBF Rep2	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos		RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo NES\|treatment:minus DBF	GSM8578762	GSM8578762: Zeb NES mDBF Rep2; Danio rerio; OTHER	GSM8578762 r1	GSM8578762	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182		Zeb_NES_mDBF_Rep2.R1.fq.gz Zeb_NES_mDBF_Rep2.R2.fq.gz	fastq fastq	21542967300.0	71809891.0	GSM8578762 r1	0:150 1:150	A:6722613760;C:3654507931;G:4628076548;T:6537678084;N:90977	150	150	6722613760	3654507931	4628076548	6537678084	90977	SRX26416446	SRS22936299	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	mate2-mate1 similar by mapping diff	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34022	34022	SRR31031013	SRX26416445	SRS22936297	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.	pubmed:39605352;pubmed:40037712		Zeb NES mDBF Rep1	GSM8578761	source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo NES\|treatment:minus DBF\|geo loc name:missing\|collection date:missing	Zeb NES mDBF Rep1	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos		RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo NES\|treatment:minus DBF	GSM8578761	GSM8578761: Zeb NES mDBF Rep1; Danio rerio; OTHER	GSM8578761 r1	GSM8578761	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182		Zeb_NES_mDBF_Rep1.R1.fq.gz Zeb_NES_mDBF_Rep1.R2.fq.gz	fastq fastq	23038870800.0	76796236.0	GSM8578761 r1	0:150 1:150	A:7216059153;C:3815899397;G:4909028200;T:7097787584;N:96466	150	150	7216059153	3815899397	4909028200	7097787584	96466	SRX26416445	SRS22936297	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	mate2-mate1 similar by mapping diff	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34023	34023	SRR31031014	SRX26416444	SRS22936298	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.	pubmed:39605352;pubmed:40037712		ZF NES MALAT1 Rep4 plus	GSM8578760	source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo NES\|treatment:plus DBF\|geo loc name:missing\|collection date:missing	ZF NES MALAT1 Rep4 plus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos		RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo NES\|treatment:plus DBF	GSM8578760	GSM8578760: ZF NES MALAT1 Rep4 plus; Danio rerio; OTHER	GSM8578760 r1	GSM8578760	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182		ZF_NES_MALAT1_Rep4_plus.R1.fq.gz ZF_NES_MALAT1_Rep4_plus.R2.fq.gz	fastq fastq	1091293200.0	3637644.0	GSM8578760 r1	0:150 1:150	A:265519561;C:288647650;G:279105515;T:258001510;N:18964	150	150	265519561	288647650	279105515	258001510	18964	SRX26416444	SRS22936298	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	biological fallback assumption	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34024	34024	SRR31031015	SRX26416443	SRS22936296	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.	pubmed:39605352;pubmed:40037712		ZF NES MALAT1 Rep4 minus	GSM8578759	source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo NES\|treatment:minus DBF\|geo loc name:missing\|collection date:missing	ZF NES MALAT1 Rep4 minus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos		RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo NES\|treatment:minus DBF	GSM8578759	GSM8578759: ZF NES MALAT1 Rep4 minus; Danio rerio; OTHER	GSM8578759 r1	GSM8578759	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182		ZF_NES_MALAT1_Rep4_minus.R1.fq.gz ZF_NES_MALAT1_Rep4_minus.R2.fq.gz	fastq fastq	1395963600.0	4653212.0	GSM8578759 r1	0:150 1:150	A:339654289;C:369433701;G:356957685;T:329893853;N:24072	150	150	339654289	369433701	356957685	329893853	24072	SRX26416443	SRS22936296	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	biological fallback assumption	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34025	34025	SRR31031016	SRX26416442	SRS22936295	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.	pubmed:39605352;pubmed:40037712		ZF NES MALAT1 Rep3 plus	GSM8578758	source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo NES\|treatment:plus DBF\|geo loc name:missing\|collection date:missing	ZF NES MALAT1 Rep3 plus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos		RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo NES\|treatment:plus DBF	GSM8578758	GSM8578758: ZF NES MALAT1 Rep3 plus; Danio rerio; OTHER	GSM8578758 r1	GSM8578758	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182		ZF_NES_MALAT1_Rep3_plus.R1.fq.gz ZF_NES_MALAT1_Rep3_plus.R2.fq.gz	fastq fastq	1556195100.0	5187317.0	GSM8578758 r1	0:150 1:150	A:378553535;C:411730281;G:398086882;T:367797563;N:26839	150	150	378553535	411730281	398086882	367797563	26839	SRX26416442	SRS22936295	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	biological fallback assumption	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34026	34026	SRR31031017	SRX26416441	SRS22936294	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.	pubmed:39605352;pubmed:40037712		ZF NES MALAT1 Rep3 minus	GSM8578757	source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo NES\|treatment:minus DBF\|geo loc name:missing\|collection date:missing	ZF NES MALAT1 Rep3 minus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos		RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo NES\|treatment:minus DBF	GSM8578757	GSM8578757: ZF NES MALAT1 Rep3 minus; Danio rerio; OTHER	GSM8578757 r1	GSM8578757	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182		ZF_NES_MALAT1_Rep3_minus.R1.fq.gz ZF_NES_MALAT1_Rep3_minus.R2.fq.gz	fastq fastq	1511328900.0	5037763.0	GSM8578757 r1	0:150 1:150	A:367639521;C:400036694;G:386523395;T:357103340;N:25950	150	150	367639521	400036694	386523395	357103340	25950	SRX26416441	SRS22936294	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	biological fallback assumption	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34027	34027	SRR31031018	SRX26416440	SRS22936293	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.	pubmed:39605352;pubmed:40037712		ZF NES MALAT1 Rep2 plus	GSM8578756	source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo NES\|treatment:plus DBF\|geo loc name:missing\|collection date:missing	ZF NES MALAT1 Rep2 plus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos		RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo NES\|treatment:plus DBF	GSM8578756	GSM8578756: ZF NES MALAT1 Rep2 plus; Danio rerio; OTHER	GSM8578756 r1	GSM8578756	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182		ZF_NES_MALAT1_Rep2_plus.R1.fq.gz ZF_NES_MALAT1_Rep2_plus.R2.fq.gz	fastq fastq	1451137800.0	4837126.0	GSM8578756 r1	0:150 1:150	A:353052445;C:383981771;G:371154128;T:342925275;N:24181	150	150	353052445	383981771	371154128	342925275	24181	SRX26416440	SRS22936293	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	biological fallback assumption	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34028	34028	SRR31031019	SRX26416439	SRS22936292	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.	pubmed:39605352;pubmed:40037712		ZF NES MALAT1 Rep2 minus	GSM8578755	source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo NES\|treatment:minus DBF\|geo loc name:missing\|collection date:missing	ZF NES MALAT1 Rep2 minus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos		RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo NES\|treatment:minus DBF	GSM8578755	GSM8578755: ZF NES MALAT1 Rep2 minus; Danio rerio; OTHER	GSM8578755 r1	GSM8578755	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182		ZF_NES_MALAT1_Rep2_minus.R1.fq.gz ZF_NES_MALAT1_Rep2_minus.R2.fq.gz	fastq fastq	1286489400.0	4288298.0	GSM8578755 r1	0:150 1:150	A:312986127;C:340482608;G:329001591;T:303997982;N:21092	150	150	312986127	340482608	329001591	303997982	21092	SRX26416439	SRS22936292	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	biological fallback assumption	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34029	34029	SRR31031020	SRX26416438	SRS22936291	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.	pubmed:39605352;pubmed:40037712		ZF NES MALAT1 Rep1 plus	GSM8578754	source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo NES\|treatment:plus DBF\|geo loc name:missing\|collection date:missing	ZF NES MALAT1 Rep1 plus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos		RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo NES\|treatment:plus DBF	GSM8578754	GSM8578754: ZF NES MALAT1 Rep1 plus; Danio rerio; OTHER	GSM8578754 r1	GSM8578754	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182		ZF_NES_MALAT1_Rep1_plus.R1.fq.gz ZF_NES_MALAT1_Rep1_plus.R2.fq.gz	fastq fastq	1146380100.0	3821267.0	GSM8578754 r1	0:150 1:150	A:278826422;C:303464534;G:293239572;T:270830265;N:19307	150	150	278826422	303464534	293239572	270830265	19307	SRX26416438	SRS22936291	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	biological fallback assumption	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34030	34030	SRR31031021	SRX26416437	SRS22936289	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.	pubmed:39605352;pubmed:40037712		ZF NES MALAT1 Rep1 minus	GSM8578753	source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo NES\|treatment:minus DBF\|geo loc name:missing\|collection date:missing	ZF NES MALAT1 Rep1 minus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos		RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo NES\|treatment:minus DBF	GSM8578753	GSM8578753: ZF NES MALAT1 Rep1 minus; Danio rerio; OTHER	GSM8578753 r1	GSM8578753	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182		ZF_NES_MALAT1_Rep1_minus.R1.fq.gz ZF_NES_MALAT1_Rep1_minus.R2.fq.gz	fastq fastq	1149087000.0	3830290.0	GSM8578753 r1	0:150 1:150	A:279487473;C:304130198;G:293947979;T:271501018;N:20332	150	150	279487473	304130198	293947979	271501018	20332	SRX26416437	SRS22936289	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	biological fallback assumption	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34031	34031	SRR31031022	SRX26416436	SRS22936290	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.	pubmed:39605352;pubmed:40037712		ZF NES GAPDH Rep4 plus	GSM8578752	source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo NES\|treatment:plus DBF\|geo loc name:missing\|collection date:missing	ZF NES GAPDH Rep4 plus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos		RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo NES\|treatment:plus DBF	GSM8578752	GSM8578752: ZF NES GAPDH Rep4 plus; Danio rerio; OTHER	GSM8578752 r1	GSM8578752	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182		ZF_NES_GAPDH_Rep4_plus.R1.fq.gz ZF_NES_GAPDH_Rep4_plus.R2.fq.gz	fastq fastq	1010253300.0	3367511.0	GSM8578752 r1	0:150 1:150	A:264284161;C:228880831;G:244038984;T:273032130;N:17194	150	150	264284161	228880831	244038984	273032130	17194	SRX26416436	SRS22936290	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	biological fallback assumption	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
36265	36265	SRR058073	SRX022206	SRS084221	SRP002640	PRJNA128943	Expanding the MicroRNA Targeting Code: A Novel Type of Site with Centered Pairing	GSE22068	Other	We present “centered sites ” a class of microRNA target sites that lacks both perfect seed pairing and three prime compensatory pairing and instead has 11–12 contiguous Watson–Crick pairs to the center of the microRNA. In elevated Mg2+ centered sites impart mRNA cleavage but in cells centered sites repress protein output without xxx Agronaute catalyzed cleavage. Our study also identified novel extensively paired sites that are cleavage substrates in cultured cells and human brain. This expanded repertoire of cleavage targets and the identification of the centered site type help explain why central regions of many microRNAs are evolutionarily conserved. Overall design: To study centered sites and identify miRNA cleavage targets mRNA degradomes were sequenced from human brain and HeLa cells and smallRNAs were sequenced from human brain and zebrafish embryo at 24 hpf. Replicates were combined before the analysis. Fastq files are not available for GSM548638 and GSM548639.	pubmed:20620952		Zebrafish Embryo small RNAs	GSM548640	source name:Embryo Cells\|data type:small RNAs\|tissue:embryo	Zebrafish Embryo small RNAs	Small RNA sequences from same total RNA samples were mapped to the human genome hg18 requiring a perfect match and reads co localizing to annotated miRNA loci miRBase version 11.0 were counted. sequence reads are summarized as frequency counts	Embryo Cells		The small RNA cDNA libraries were made as described Grimson et al. 2008 except for the three prime adaptor ligation which was five prime adenylated pTCGTATGCCGTCTTCTGCTTGidT. For a detailed protocol see http://web.wi.mit.edu/bartel/pub/protocols.html.		data type:small RNAs\|tissue:embryo	GSM548640	GSM548640: Zebrafish Embryo small RNAs	GSM548640: Zebrafish Embryo small RNAs	GSM548640: Zebrafish Embryo small RNAs	1		GEO Accession:GSM548640	RNA-Seq	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina Genome Analyzer	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP002640	quality book char:@\|quality scoring system:log odds	Zebrafish_embryo_24h.fastq	fastq	62213148.0	1728143.0	GSM548640 1	0:36	A:13550515;C:14269249;G:15670049;T:18673533;N:49802	36		13550515	14269249	15670049	18673533	49802	SRX022206	SRS084221	SRA020539	GEO	Bartel lab, Whitehead Institute	1	0.02298		0.02186		0.9988		0.3246		36		B		usable mapping rate	illumina	early_illumina	unknown	small_rna	unknown	bulk	unknown	unknown	United States	2010-06-01	Undetermined	Embryo	Embryo Imprecise	All anatomical structures
40214	40214	SRR2982513	SRX1471725	SRS1197481	SRP067139	PRJNA305418	RiboZero mRNA seq across zebrafish development for study of uORFs	PRJNA305418	Other	Untranslated mRNA regionsUTRs are key mediators of post transcriptional regulation. Previous studies have predicted thousands of ORFs in five prime'UTRs the vast majority of which have unknown function. We present a systematic analysis of the translation and function of upstream open reading framesuORFs across vertebrates. Combining high resolution ribosome footprinting and phasing we find that i uORFs are pervasive within vertebrate transcriptomes ii the majority show signatures of active translation and iii uORFs act as potent regulators of translation and RNA levels with a similar magnitude to miRNAs. Evolution has targeted sequence features to mitigate the effects of constitutively repressive uORFs. Finally we observe that the regulatory potential of uORFs on individual genes is conserved across species. These results provide insight into the regulatory code within mRNA leader sequences and their capacity to modulate translation across vertebrates.The mRNA seq data contained in this archive were used along with ribosome profiling data to calculate translation efficiency values.			48hpf	AG00751 mrna r0 48h	strain:TUAB\|age:48hpf\|sex:pooled male and female\|tissue:embryo\|genotype:wt\|BioSampleModel:Model organism or animal									AG00751 mrna r0 48h	48h mRNA R0	1	Twenty embryos per condition were collected from the same clutch from where the ribosome profiling timeseries was conducted.Bazzini et al 2014 Total RNA was isolated using 1mL of Trizol following manufacturer instructions. Ribosomal RNAs were depleted using Ribo Zero Epicentre/Illumina. Strand specific single end library was constructed according to the Illumina Sample Preparation Kit protocol using standard TruSeq adapters Libraries were prepared and sequenced in an Illumina Hi SEQ single end 75nt reads			RNA-Seq	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2000	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>75</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP067139		AG00751_SEQ0112_R1.fastq.gz	fastq	1859082512.0	24461612.0	48h mRNA R0 run1	0:76	A:488142494;C:422062452;G:411293722;T:537489879;N:93965	76		488142494	422062452	411293722	537489879	93965	SRX1471725	SRS1197481	SRA314809	Yale University\|Giraldez Lab	Yale University	1	0.8583		0.37297		0.6956		0.46541		76		B		usable mapping rate	illumina	hiseq_era	unknown	rrna_depletion	trueseq	bulk	unknown	unknown	United States	2015-12-08	Hatching	Embryo	Embryo Imprecise	All anatomical structures
40215	40215	SRR2982514	SRX1471724	SRS1197482	SRP067139	PRJNA305418	RiboZero mRNA seq across zebrafish development for study of uORFs	PRJNA305418	Other	Untranslated mRNA regionsUTRs are key mediators of post transcriptional regulation. Previous studies have predicted thousands of ORFs in five prime'UTRs the vast majority of which have unknown function. We present a systematic analysis of the translation and function of upstream open reading framesuORFs across vertebrates. Combining high resolution ribosome footprinting and phasing we find that i uORFs are pervasive within vertebrate transcriptomes ii the majority show signatures of active translation and iii uORFs act as potent regulators of translation and RNA levels with a similar magnitude to miRNAs. Evolution has targeted sequence features to mitigate the effects of constitutively repressive uORFs. Finally we observe that the regulatory potential of uORFs on individual genes is conserved across species. These results provide insight into the regulatory code within mRNA leader sequences and their capacity to modulate translation across vertebrates.The mRNA seq data contained in this archive were used along with ribosome profiling data to calculate translation efficiency values.			24hpf	AG00750 mrna r0 24h	strain:TUAB\|age:24hpf\|sex:pooled male and female\|tissue:embryo\|genotype:wt\|BioSampleModel:Model organism or animal									AG00750 mrna r0 24h	24h mRNA R0	1	Twenty embryos per condition were collected from the same clutch from where the ribosome profiling timeseries was conducted.Bazzini et al 2014 Total RNA was isolated using 1mL of Trizol following manufacturer instructions. Ribosomal RNAs were depleted using Ribo Zero Epicentre/Illumina. Strand specific single end library was constructed according to the Illumina Sample Preparation Kit protocol using standard TruSeq adapters Libraries were prepared and sequenced in an Illumina Hi SEQ single end 75nt reads			RNA-Seq	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2000	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>75</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP067139		AG00750_SEQ0114_R1.fastq.gz	fastq	2124277824.0	27951024.0	24h mRNA R0 run1	0:76	A:537946274;C:496576029;G:477023623;T:612576823;N:155075	76		537946274	496576029	477023623	612576823	155075	SRX1471724	SRS1197482	SRA314809	Yale University\|Giraldez Lab	Yale University	1	0.86054		0.27207		0.69877		0.47063		76		B		usable mapping rate	illumina	hiseq_era	unknown	rrna_depletion	trueseq	bulk	unknown	unknown	United States	2015-12-08	Pharyngula	Embryo	Embryo Imprecise	All anatomical structures
40216	40216	SRR2982511	SRX1471723	SRS1197479	SRP067139	PRJNA305418	RiboZero mRNA seq across zebrafish development for study of uORFs	PRJNA305418	Other	Untranslated mRNA regionsUTRs are key mediators of post transcriptional regulation. Previous studies have predicted thousands of ORFs in five prime'UTRs the vast majority of which have unknown function. We present a systematic analysis of the translation and function of upstream open reading framesuORFs across vertebrates. Combining high resolution ribosome footprinting and phasing we find that i uORFs are pervasive within vertebrate transcriptomes ii the majority show signatures of active translation and iii uORFs act as potent regulators of translation and RNA levels with a similar magnitude to miRNAs. Evolution has targeted sequence features to mitigate the effects of constitutively repressive uORFs. Finally we observe that the regulatory potential of uORFs on individual genes is conserved across species. These results provide insight into the regulatory code within mRNA leader sequences and their capacity to modulate translation across vertebrates.The mRNA seq data contained in this archive were used along with ribosome profiling data to calculate translation efficiency values.			12hpf	AG00434 mrna r0 12h	strain:TUAB\|age:12hpf\|sex:pooled male and female\|tissue:embryo\|genotype:wt\|BioSampleModel:Model organism or animal									AG00434 mrna r0 12h	12h mRNA R0	1	Twenty embryos per condition were collected from the same clutch from where the ribosome profiling timeseries was conducted.Bazzini et al 2014 Total RNA was isolated using 1mL of Trizol following manufacturer instructions. Ribosomal RNAs were depleted using Ribo Zero Epicentre/Illumina. Strand specific single end library was constructed according to the Illumina Sample Preparation Kit protocol using standard TruSeq adapters Libraries were prepared and sequenced in an Illumina Hi SEQ single end 75nt reads			RNA-Seq	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2000	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>75</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP067139		AG00434_SEQ0071_R1.fastq.gz	fastq	1990422368.0	26189768.0	12h mRNA R0 run1	0:76	A:512242204;C:469314942;G:452176134;T:556618667;N:70421	76		512242204	469314942	452176134	556618667	70421	SRX1471723	SRS1197479	SRA314809	Yale University\|Giraldez Lab	Yale University	1	0.88085		0.297		0.71711		0.46053		76		B		usable mapping rate	illumina	hiseq_era	unknown	rrna_depletion	trueseq	bulk	unknown	unknown	United States	2015-12-08	Segmentation	Embryo	Embryo Imprecise	All anatomical structures
40217	40217	SRR2982512	SRX1471722	SRS1197480	SRP067139	PRJNA305418	RiboZero mRNA seq across zebrafish development for study of uORFs	PRJNA305418	Other	Untranslated mRNA regionsUTRs are key mediators of post transcriptional regulation. Previous studies have predicted thousands of ORFs in five prime'UTRs the vast majority of which have unknown function. We present a systematic analysis of the translation and function of upstream open reading framesuORFs across vertebrates. Combining high resolution ribosome footprinting and phasing we find that i uORFs are pervasive within vertebrate transcriptomes ii the majority show signatures of active translation and iii uORFs act as potent regulators of translation and RNA levels with a similar magnitude to miRNAs. Evolution has targeted sequence features to mitigate the effects of constitutively repressive uORFs. Finally we observe that the regulatory potential of uORFs on individual genes is conserved across species. These results provide insight into the regulatory code within mRNA leader sequences and their capacity to modulate translation across vertebrates.The mRNA seq data contained in this archive were used along with ribosome profiling data to calculate translation efficiency values.			5hpf	AG00749 mrna r0 5h	strain:TUAB\|age:5hpf\|sex:pooled male and female\|tissue:embryo\|genotype:wt\|BioSampleModel:Model organism or animal									AG00749 mrna r0 5h	5h mRNA R0	1	Twenty embryos per condition were collected from the same clutch from where the ribosome profiling timeseries was conducted.Bazzini et al 2014 Total RNA was isolated using 1mL of Trizol following manufacturer instructions. Ribosomal RNAs were depleted using Ribo Zero Epicentre/Illumina. Strand specific single end library was constructed according to the Illumina Sample Preparation Kit protocol using standard TruSeq adapters Libraries were prepared and sequenced in an Illumina Hi SEQ single end 75nt reads			RNA-Seq	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2000	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>75</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP067139		AG00749_SEQ0114_R1.fastq.gz	fastq	3163721996.0	41627921.0	5h mRNA R0 run1	0:76	A:724093110;C:806620205;G:798759186;T:834042462;N:207033	76		724093110	806620205	798759186	834042462	207033	SRX1471722	SRS1197480	SRA314809	Yale University\|Giraldez Lab	Yale University	1	0.75274		0.23572		0.75448		0.47885		76		B		usable mapping rate	illumina	hiseq_era	unknown	rrna_depletion	trueseq	bulk	unknown	unknown	United States	2015-12-08	Blastula	Embryo	Embryo Imprecise	All anatomical structures
40218	40218	SRR2982510	SRX1471511	SRS1197399	SRP067139	PRJNA305418	RiboZero mRNA seq across zebrafish development for study of uORFs	PRJNA305418	Other	Untranslated mRNA regionsUTRs are key mediators of post transcriptional regulation. Previous studies have predicted thousands of ORFs in five prime'UTRs the vast majority of which have unknown function. We present a systematic analysis of the translation and function of upstream open reading framesuORFs across vertebrates. Combining high resolution ribosome footprinting and phasing we find that i uORFs are pervasive within vertebrate transcriptomes ii the majority show signatures of active translation and iii uORFs act as potent regulators of translation and RNA levels with a similar magnitude to miRNAs. Evolution has targeted sequence features to mitigate the effects of constitutively repressive uORFs. Finally we observe that the regulatory potential of uORFs on individual genes is conserved across species. These results provide insight into the regulatory code within mRNA leader sequences and their capacity to modulate translation across vertebrates.The mRNA seq data contained in this archive were used along with ribosome profiling data to calculate translation efficiency values.			2hpf	AG00244 mrna r0 2h	strain:TUAB\|age:2hpf\|sex:pooled male and female\|tissue:embryo\|genotype:wt\|BioSampleModel:Model organism or animal									AG00244 mrna r0 2h	2h mRNA R0	1	Twenty embryos per condition were collected from the same clutch from where the ribosome profiling timeseries was conducted.Bazzini et al 2014 Total RNA was isolated using 1mL of Trizol following manufacturer instructions. Ribosomal RNAs were depleted using Ribo Zero Epicentre/Illumina. Strand specific single end library was constructed according to the Illumina Sample Preparation Kit protocol using standard TruSeq adapters Libraries were prepared and sequenced in an Illumina Hi SEQ single end 75nt reads			RNA-Seq	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2000	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>75</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP067139		AG00244_SEQ0039_R1.fastq.gz	fastq	1010085524.0	13290599.0	2h mRNA R0 run1	0:76	A:196715560;C:309406513;G:286228000;T:217670217;N:65234	76		196715560	309406513	286228000	217670217	65234	SRX1471511	SRS1197399	SRA314809	Yale University\|Giraldez Lab	Yale University	1	0.89974		0.14215		0.79488		0.72171		76		B		usable mapping rate	illumina	hiseq_era	unknown	rrna_depletion	trueseq	bulk	unknown	unknown	United States	2015-12-08	Cleavage	Embryo	Embryo Imprecise	All anatomical structures
40249	40249	SRR3038049	SRX1494244	SRS1217111	SRP067641	PRJNA306648	Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition	GSE76212	Other	We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined	pubmed:28381614		IgG iCLIP zf ZGA rep3	GSM1976593	tissue:zebrafish embryo\|developmental stage:ZGA 1K cell stage\|antibody:anti IgG\|barcode sequence:NNNTGGCNN	IgG iCLIP zf ZGA rep3	Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls.	zebrafish embryo	Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions.	Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959	Zebrafish embryos were raised from WT AB strain and maintained using standard conditions.	developmental stage:ZGA 1K cell stage\|antibody:anti IgG\|barcode sequence:NNNTGGCNN	GSM1976593	GSM1976593: IgG iCLIP zf ZGA rep3; Danio rerio; OTHER	GSM1976593		1	Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959	GEO Accession:GSM1976593	OTHER	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2000		SRP067641		iCLIP_IgG_zebrafishembryo_wt_1K_IgGcontrol_Dr_NNNTGGCNN_20140613_L4333_4.fq.gz	fastq	82722124.0	1088449.0	GSM1976593 r1	0:76	A:21959870;C:19048567;G:22289272;T:19403630;N:20785	76		21959870	19048567	22289272	19403630	20785	SRX1494244	SRS1217111	SRA320959	GEO	Molecular Biophysics and Biochemistry, Yale University	1	0.08124		0.02181		0.98591		0.59183		76		B		usable mapping rate	illumina	hiseq_era	3prime	other	unknown	bulk	clip	iclip	United States	2015-12-21	Blastula	Embryo	Embryo Imprecise	All anatomical structures
40250	40250	SRR3038048	SRX1494243	SRS1217112	SRP067641	PRJNA306648	Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition	GSE76212	Other	We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined	pubmed:28381614		IgG iCLIP zf ZGA rep2	GSM1976592	tissue:zebrafish embryo\|developmental stage:ZGA 1K cell stage\|antibody:anti IgG\|barcode sequence:NNNCCACNN	IgG iCLIP zf ZGA rep2	Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls.	zebrafish embryo	Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions.	Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959	Zebrafish embryos were raised from WT AB strain and maintained using standard conditions.	developmental stage:ZGA 1K cell stage\|antibody:anti IgG\|barcode sequence:NNNCCACNN	GSM1976592	GSM1976592: IgG iCLIP zf ZGA rep2; Danio rerio; OTHER	GSM1976592		1	Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959	GEO Accession:GSM1976592	OTHER	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2000		SRP067641		iCLIP_IgG_zebrafishembryo_wt_1K_IgGcontrol_Dr_NNNCCACNN_20140613_L4333_2.fq.gz	fastq	50195036.0	660461.0	GSM1976592 r1	0:76	A:14249581;C:12927029;G:12969451;T:10036400;N:12575	76		14249581	12927029	12969451	10036400	12575	SRX1494243	SRS1217112	SRA320959	GEO	Molecular Biophysics and Biochemistry, Yale University	1	0.25447		0.03871		0.94556		0.7523		76		B		usable mapping rate	illumina	hiseq_era	3prime	other	unknown	bulk	clip	iclip	United States	2015-12-21	Blastula	Embryo	Embryo Imprecise	All anatomical structures
40251	40251	SRR3038047	SRX1494242	SRS1217113	SRP067641	PRJNA306648	Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition	GSE76212	Other	We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined	pubmed:28381614		IgG iCLIP zf ZGA rep1	GSM1976591	tissue:zebrafish embryo\|developmental stage:ZGA 1K cell stage\|antibody:anti IgG\|barcode sequence:NNNGGCGNN	IgG iCLIP zf ZGA rep1	Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls.	zebrafish embryo	Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions.	Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959	Zebrafish embryos were raised from WT AB strain and maintained using standard conditions.	developmental stage:ZGA 1K cell stage\|antibody:anti IgG\|barcode sequence:NNNGGCGNN	GSM1976591	GSM1976591: IgG iCLIP zf ZGA rep1; Danio rerio; OTHER	GSM1976591		1	Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959	GEO Accession:GSM1976591	OTHER	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2000		SRP067641		iCLIP_IgG_zebrafishembryo_wt_1K_IgGcontrol_Dr_NNNGGCGNN_20140613_L4333_5.fq.gz	fastq	453449136.0	5966436.0	GSM1976591 r1	0:76	A:124726528;C:101139098;G:135573575;T:91900507;N:109428	76		124726528	101139098	135573575	91900507	109428	SRX1494242	SRS1217113	SRA320959	GEO	Molecular Biophysics and Biochemistry, Yale University	1	0.51353		0.10729		0.88069		0.7159		76		B		usable mapping rate	illumina	hiseq_era	3prime	other	unknown	bulk	clip	iclip	United States	2015-12-21	Blastula	Embryo	Embryo Imprecise	All anatomical structures
40252	40252	SRR3038046	SRX1494241	SRS1217114	SRP067641	PRJNA306648	Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition	GSE76212	Other	We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined	pubmed:28381614		IgG iCLIP zf preZGA rep3	GSM1976590	tissue:zebrafish embryo\|developmental stage:preZGA 32 cell stage\|antibody:anti IgG\|barcode sequence:NNNTGGCNN	IgG iCLIP zf preZGA rep3	Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls.	zebrafish embryo	Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions.	Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959	Zebrafish embryos were raised from WT AB strain and maintained using standard conditions.	developmental stage:preZGA 32 cell stage\|antibody:anti IgG\|barcode sequence:NNNTGGCNN	GSM1976590	GSM1976590: IgG iCLIP zf preZGA rep3; Danio rerio; OTHER	GSM1976590		1	Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959	GEO Accession:GSM1976590	OTHER	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2000		SRP067641		iCLIP_IgG_Drembryo_wt_IgGcontrol_Dr_NNNTGGCNN_20130812_hnRNPA1_4.fq.gz	fastq	600183932.0	7897157.0	GSM1976590 r1	0:76	A:173843237;C:131372689;G:170729621;T:124187689;N:50696	76		173843237	131372689	170729621	124187689	50696	SRX1494241	SRS1217114	SRA320959	GEO	Molecular Biophysics and Biochemistry, Yale University	1	0.14511		0.03659		0.9332		0.651		76		B		usable mapping rate	illumina	hiseq_era	3prime	other	unknown	bulk	clip	iclip	United States	2015-12-21	Cleavage	Embryo	Embryo Imprecise	All anatomical structures
40253	40253	SRR3038045	SRX1494240	SRS1217115	SRP067641	PRJNA306648	Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition	GSE76212	Other	We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined	pubmed:28381614		IgG iCLIP zf preZGA rep2	GSM1976589	tissue:zebrafish embryo\|developmental stage:preZGA 32 cell stage\|antibody:anti IgG\|barcode sequence:NNNCCGGNN	IgG iCLIP zf preZGA rep2	Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls.	zebrafish embryo	Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions.	Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959	Zebrafish embryos were raised from WT AB strain and maintained using standard conditions.	developmental stage:preZGA 32 cell stage\|antibody:anti IgG\|barcode sequence:NNNCCGGNN	GSM1976589	GSM1976589: IgG iCLIP zf preZGA rep2; Danio rerio; OTHER	GSM1976589		1	Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959	GEO Accession:GSM1976589	OTHER	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2000		SRP067641		iCLIP_IgG_Drembryo_wt_IgGcontrol_Dr_NNNCCGGNN_20130812_hnRNPA1_5.fq.gz	fastq	612280168.0	8056318.0	GSM1976589 r1	0:76	A:175101988;C:144456623;G:172272609;T:120400014;N:48934	76		175101988	144456623	172272609	120400014	48934	SRX1494240	SRS1217115	SRA320959	GEO	Molecular Biophysics and Biochemistry, Yale University	1	0.05322		0.01649		0.97656		0.67242		76		B		usable mapping rate	illumina	hiseq_era	3prime	other	unknown	bulk	clip	iclip	United States	2015-12-21	Cleavage	Embryo	Embryo Imprecise	All anatomical structures
40254	40254	SRR3038044	SRX1494239	SRS1217116	SRP067641	PRJNA306648	Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition	GSE76212	Other	We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined	pubmed:28381614		IgG iCLIP zf preZGA rep1	GSM1976588	tissue:zebrafish embryo\|developmental stage:preZGA 32 cell stage\|antibody:anti IgG\|barcode sequence:NNNGGCGNN	IgG iCLIP zf preZGA rep1	Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls.	zebrafish embryo	Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions.	Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959	Zebrafish embryos were raised from WT AB strain and maintained using standard conditions.	developmental stage:preZGA 32 cell stage\|antibody:anti IgG\|barcode sequence:NNNGGCGNN	GSM1976588	GSM1976588: IgG iCLIP zf preZGA rep1; Danio rerio; OTHER	GSM1976588		1	Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959	GEO Accession:GSM1976588	OTHER	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2000		SRP067641		iCLIP_IgG_Drembryo_wt_IgGcontrol_Dr_NNNGGCGNN_20130812_hnRNPA1_1.fq-3.gz	fastq	12806760.0	168510.0	GSM1976588 r1	0:76	A:3652525;C:2758781;G:3842061;T:2552042;N:1351	76		3652525	2758781	3842061	2552042	1351	SRX1494239	SRS1217116	SRA320959	GEO	Molecular Biophysics and Biochemistry, Yale University	1	0.02784		0.01181		0.99813		0.68217		76		B		usable mapping rate	illumina	hiseq_era	3prime	other	unknown	bulk	clip	iclip	United States	2015-12-21	Cleavage	Embryo	Embryo Imprecise	All anatomical structures
40255	40255	SRR3038043	SRX1494238	SRS1217117	SRP067641	PRJNA306648	Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition	GSE76212	Other	We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined	pubmed:28381614		hnRNP A1 iCLIP zf ZGA rep4	GSM1976587	tissue:zebrafish embryo\|developmental stage:ZGA 1K cell stage\|antibody:anti hnRNP A1\|barcode sequence:NNNGGTCNN	hnRNP A1 iCLIP zf ZGA rep4	Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls.	zebrafish embryo	Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions.	Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959	Zebrafish embryos were raised from WT AB strain and maintained using standard conditions.	developmental stage:ZGA 1K cell stage\|antibody:anti hnRNP A1\|barcode sequence:NNNGGTCNN	GSM1976587	GSM1976587: hnRNP A1 iCLIP zf ZGA rep4; Danio rerio; OTHER	GSM1976587		1	Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959	GEO Accession:GSM1976587	OTHER	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2000		SRP067641		iCLIP_hnRNPA1_zebrafishembryo_wt_1K_hnRNPA1_Dr_NNNGGTCNN_20140613_L4333_6.fq.gz	fastq	2884007568.0	37947468.0	GSM1976587 r1	0:76	A:936463452;C:557587142;G:746595510;T:642623181;N:738283	76		936463452	557587142	746595510	642623181	738283	SRX1494238	SRS1217117	SRA320959	GEO	Molecular Biophysics and Biochemistry, Yale University	1	0.38306		0.08291		0.80568		0.62132		76		B		usable mapping rate	illumina	hiseq_era	3prime	other	unknown	bulk	clip	iclip	United States	2015-12-21	Blastula	Embryo	Embryo Imprecise	All anatomical structures
40256	40256	SRR3038042	SRX1494237	SRS1217118	SRP067641	PRJNA306648	Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition	GSE76212	Other	We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined	pubmed:28381614		hnRNP A1 iCLIP zf ZGA rep3	GSM1976586	tissue:zebrafish embryo\|developmental stage:ZGA 1K cell stage\|antibody:anti hnRNP A1\|barcode sequence:NNNCAATNN	hnRNP A1 iCLIP zf ZGA rep3	Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls.	zebrafish embryo	Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions.	Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959	Zebrafish embryos were raised from WT AB strain and maintained using standard conditions.	developmental stage:ZGA 1K cell stage\|antibody:anti hnRNP A1\|barcode sequence:NNNCAATNN	GSM1976586	GSM1976586: hnRNP A1 iCLIP zf ZGA rep3; Danio rerio; OTHER	GSM1976586		1	Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959	GEO Accession:GSM1976586	OTHER	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2000		SRP067641		iCLIP_hnRNPA1_zebrafishembryo_wt_1K_hnRNPA1_Dr_NNNCAATNN_20140613_L4333_3.fq.gz	fastq	3875071508.0	50987783.0	GSM1976586 r1	0:76	A:1328984506;C:775814536;G:956147632;T:813109146;N:1015688	76		1328984506	775814536	956147632	813109146	1015688	SRX1494237	SRS1217118	SRA320959	GEO	Molecular Biophysics and Biochemistry, Yale University	1	0.35787		0.0904		0.81874		0.64706		76		B		usable mapping rate	illumina	hiseq_era	3prime	other	unknown	bulk	clip	iclip	United States	2015-12-21	Blastula	Embryo	Embryo Imprecise	All anatomical structures
40257	40257	SRR3038041	SRX1494236	SRS1217119	SRP067641	PRJNA306648	Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition	GSE76212	Other	We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined	pubmed:28381614		hnRNP A1 iCLIP zf ZGA rep2	GSM1976585	tissue:zebrafish embryo\|developmental stage:ZGA 1K cell stage\|antibody:anti hnRNP A1\|barcode sequence:NNNTTGTNN	hnRNP A1 iCLIP zf ZGA rep2	Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls.	zebrafish embryo	Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions.	Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959	Zebrafish embryos were raised from WT AB strain and maintained using standard conditions.	developmental stage:ZGA 1K cell stage\|antibody:anti hnRNP A1\|barcode sequence:NNNTTGTNN	GSM1976585	GSM1976585: hnRNP A1 iCLIP zf ZGA rep2; Danio rerio; OTHER	GSM1976585		1	Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959	GEO Accession:GSM1976585	OTHER	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2000		SRP067641		iCLIP_hnRNPA1_zebrafishembryo_wt_1K_hnRNPA1_Dr_NNNTTGTNN_20140613_L4333_1.fq.gz	fastq	3482039180.0	45816305.0	GSM1976585 r1	0:76	A:1093877493;C:647486562;G:914636686;T:825135975;N:902464	76		1093877493	647486562	914636686	825135975	902464	SRX1494236	SRS1217119	SRA320959	GEO	Molecular Biophysics and Biochemistry, Yale University	1	0.29908		0.07356		0.83459		0.62976		76		B		usable mapping rate	illumina	hiseq_era	3prime	other	unknown	bulk	clip	iclip	United States	2015-12-21	Blastula	Embryo	Embryo Imprecise	All anatomical structures
40258	40258	SRR3038040	SRX1494235	SRS1217120	SRP067641	PRJNA306648	Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition	GSE76212	Other	We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined	pubmed:28381614		hnRNP A1 iCLIP zf ZGA rep1	GSM1976584	tissue:zebrafish embryo\|developmental stage:ZGA 1K cell stage\|antibody:anti hnRNP A1\|barcode sequence:NNNGGTTNN	hnRNP A1 iCLIP zf ZGA rep1	Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls.	zebrafish embryo	Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions.	Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959	Zebrafish embryos were raised from WT AB strain and maintained using standard conditions.	developmental stage:ZGA 1K cell stage\|antibody:anti hnRNP A1\|barcode sequence:NNNGGTTNN	GSM1976584	GSM1976584: hnRNP A1 iCLIP zf ZGA rep1; Danio rerio; OTHER	GSM1976584		1	Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959	GEO Accession:GSM1976584	OTHER	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2000		SRP067641		iCLIP_hnRNPA1_zebrafishembryo_wt_1K_hnRNPA1_Dr_NNNGGTTNN_20140613_L4333_7.fq.gz	fastq	3547711920.0	46680420.0	GSM1976584 r1	0:76	A:1105542969;C:658172853;G:958654426;T:824422930;N:918742	76		1105542969	658172853	958654426	824422930	918742	SRX1494235	SRS1217120	SRA320959	GEO	Molecular Biophysics and Biochemistry, Yale University	1	0.34257		0.08694		0.83055		0.64965		76		B		usable mapping rate	illumina	hiseq_era	3prime	other	unknown	bulk	clip	iclip	United States	2015-12-21	Blastula	Embryo	Embryo Imprecise	All anatomical structures
40259	40259	SRR3038039	SRX1494234	SRS1217121	SRP067641	PRJNA306648	Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition	GSE76212	Other	We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined	pubmed:28381614		hnRNP A1 iCLIP zf preZGA rep3	GSM1976583	tissue:zebrafish embryo\|developmental stage:preZGA 32 cell stage\|antibody:anti hnRNP A1\|barcode sequence:NNNCAATNN	hnRNP A1 iCLIP zf preZGA rep3	Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls.	zebrafish embryo	Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions.	Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959	Zebrafish embryos were raised from WT AB strain and maintained using standard conditions.	developmental stage:preZGA 32 cell stage\|antibody:anti hnRNP A1\|barcode sequence:NNNCAATNN	GSM1976583	GSM1976583: hnRNP A1 iCLIP zf preZGA rep3; Danio rerio; OTHER	GSM1976583		1	Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959	GEO Accession:GSM1976583	OTHER	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2000		SRP067641		iCLIP_hnRNPA1_Drembryo_wt_hnRNPA1_Dr_NNNCAATNN_20130812_hnRNPA1_3.fq.gz	fastq	1944912200.0	25590950.0	GSM1976583 r1	0:76	A:611172831;C:390755201;G:517844203;T:424973726;N:166239	76		611172831	390755201	517844203	424973726	166239	SRX1494234	SRS1217121	SRA320959	GEO	Molecular Biophysics and Biochemistry, Yale University	1	0.23819		0.06019		0.85318		0.72811		76		B		usable mapping rate	illumina	hiseq_era	3prime	other	unknown	bulk	clip	iclip	United States	2015-12-21	Cleavage	Embryo	Embryo Imprecise	All anatomical structures
40260	40260	SRR3038038	SRX1494233	SRS1217122	SRP067641	PRJNA306648	Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition	GSE76212	Other	We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined	pubmed:28381614		hnRNP A1 iCLIP zf preZGA rep2	GSM1976582	tissue:zebrafish embryo\|developmental stage:preZGA 32 cell stage\|antibody:anti hnRNP A1\|barcode sequence:NNNTTGTNN	hnRNP A1 iCLIP zf preZGA rep2	Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls.	zebrafish embryo	Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions.	Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959	Zebrafish embryos were raised from WT AB strain and maintained using standard conditions.	developmental stage:preZGA 32 cell stage\|antibody:anti hnRNP A1\|barcode sequence:NNNTTGTNN	GSM1976582	GSM1976582: hnRNP A1 iCLIP zf preZGA rep2; Danio rerio; OTHER	GSM1976582		1	Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959	GEO Accession:GSM1976582	OTHER	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2000		SRP067641		iCLIP_hnRNPA1_Drembryo_wt_hnRNPA1_Dr_NNNTTGTNN_20130812_hnRNPA1_6.fq.gz	fastq	1804236124.0	23739949.0	GSM1976582 r1	0:76	A:520750722;C:337743522;G:499109535;T:446481275;N:151070	76		520750722	337743522	499109535	446481275	151070	SRX1494233	SRS1217122	SRA320959	GEO	Molecular Biophysics and Biochemistry, Yale University	1	0.25184		0.06217		0.85687		0.67912		76		B		usable mapping rate	illumina	hiseq_era	3prime	other	unknown	bulk	clip	iclip	United States	2015-12-21	Cleavage	Embryo	Embryo Imprecise	All anatomical structures
40261	40261	SRR3038037	SRX1494232	SRS1217123	SRP067641	PRJNA306648	Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition	GSE76212	Other	We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined	pubmed:28381614		hnRNP A1 iCLIP zf preZGA rep1	GSM1976581	tissue:zebrafish embryo\|developmental stage:preZGA 32 cell stage\|antibody:anti hnRNP A1\|barcode sequence:NNNGGTTNN	hnRNP A1 iCLIP zf preZGA rep1	Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls.	zebrafish embryo	Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions.	Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959	Zebrafish embryos were raised from WT AB strain and maintained using standard conditions.	developmental stage:preZGA 32 cell stage\|antibody:anti hnRNP A1\|barcode sequence:NNNGGTTNN	GSM1976581	GSM1976581: hnRNP A1 iCLIP zf preZGA rep1; Danio rerio; OTHER	GSM1976581		1	Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959	GEO Accession:GSM1976581	OTHER	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2000		SRP067641		iCLIP_hnRNPA1_Drembryo_wt_hnRNPA1_Dr_NNNGGTTNN_20130812_hnRNPA1_2.fq.gz	fastq	2155200476.0	28357901.0	GSM1976581 r1	0:76	A:646739355;C:394864638;G:606938658;T:506474548;N:183277	76		646739355	394864638	606938658	506474548	183277	SRX1494232	SRS1217123	SRA320959	GEO	Molecular Biophysics and Biochemistry, Yale University	1	0.24207		0.05859		0.84747		0.70564		76		B		usable mapping rate	illumina	hiseq_era	3prime	other	unknown	bulk	clip	iclip	United States	2015-12-21	Cleavage	Embryo	Embryo Imprecise	All anatomical structures
41548	41548	SRR5017075	SRX2345570	SRS1796136	SRP093295	PRJNA353372	N6 methyladenosine dynamics during early vertebrate embryogenesis	GSE89815	Other	Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability translation efficiency and effect on miR 430 degradation kinetics. Notably we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages			input shield rep2	GSM2390028	tissue:Embryos\|developmental stage:Shield stage embryos\|strain:AB wild type	input shield rep2	Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5’end and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al. 2013 with options seedSearchStartLmax 15 clip3pNbases 10 clip5pNbases 10 outFilterMultimapNmax 20 outFilterMismatchNoverLmax 0.05 outFilterMatchNminOverLread 0.0 outFilterMatchNmin 15 outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al. 2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage and txt file with raw and normalized read counts for each gene using the input samples	Embryos		We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015.	Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28±1°C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500µS/cm general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean Blacksburg USA 53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting Stavanger Norway dry feed twice a day and live artemia Scanbur Karlslunde Denmark once a day. Health monitoring was by daily inspection use of sentinel fish sent for pathology ZIRC Eugene Oregon and water microbiology analysis NMBU Vetbio Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats Apopka FL. Harvested embryos were kept in autoclaved SW at 28 °C harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009 the EU Directive 2010/63.	developmental stage:Shield stage embryos\|strain:AB wild type	GSM2390028	GSM2390028: input shield rep2; Danio rerio; RIP Seq	GSM2390028		1	We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015.	GEO Accession:GSM2390028	RIP-Seq	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2000		SRP093295		input_shield_rep2.fastq.gz	fastq	6559838034.0	69785511.0	GSM2390028 r1	0:94	A:1785772532;C:1552902091;G:1571407685;T:1649464013;N:291713	94		1785772532	1552902091	1571407685	1649464013	291713	SRX2345570	SRS1796136	SRA492943	GEO	Klungland Lab, Dept of microbiology, Oslo University Hospital	1	0.03627		0.01		0.96676		0.66777		94		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	bulk	unknown	unknown	Norway	2016-11-14	Gastrula	Embryo	Embryo Imprecise	All anatomical structures
41549	41549	SRR5017074	SRX2345569	SRS1796134	SRP093295	PRJNA353372	N6 methyladenosine dynamics during early vertebrate embryogenesis	GSE89815	Other	Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability translation efficiency and effect on miR 430 degradation kinetics. Notably we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages			input shield rep1	GSM2390027	tissue:Embryos\|developmental stage:Shield stage embryos\|strain:AB wild type	input shield rep1	Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5’end and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al. 2013 with options seedSearchStartLmax 15 clip3pNbases 10 clip5pNbases 10 outFilterMultimapNmax 20 outFilterMismatchNoverLmax 0.05 outFilterMatchNminOverLread 0.0 outFilterMatchNmin 15 outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al. 2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage and txt file with raw and normalized read counts for each gene using the input samples	Embryos		We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015.	Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28±1°C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500µS/cm general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean Blacksburg USA 53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting Stavanger Norway dry feed twice a day and live artemia Scanbur Karlslunde Denmark once a day. Health monitoring was by daily inspection use of sentinel fish sent for pathology ZIRC Eugene Oregon and water microbiology analysis NMBU Vetbio Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats Apopka FL. Harvested embryos were kept in autoclaved SW at 28 °C harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009 the EU Directive 2010/63.	developmental stage:Shield stage embryos\|strain:AB wild type	GSM2390027	GSM2390027: input shield rep1; Danio rerio; RIP Seq	GSM2390027		1	We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015.	GEO Accession:GSM2390027	RIP-Seq	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2000		SRP093295		input_shield_rep1.fastq.gz	fastq	3765873214.0	40062481.0	GSM2390027 r1	0:94	A:1002751444;C:902509483;G:908627718;T:951814220;N:170349	94		1002751444	902509483	908627718	951814220	170349	SRX2345569	SRS1796134	SRA492943	GEO	Klungland Lab, Dept of microbiology, Oslo University Hospital	1	0.03936		0.01095		0.96518		0.68725		94		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	bulk	unknown	unknown	Norway	2016-11-14	Gastrula	Embryo	Embryo Imprecise	All anatomical structures
41550	41550	SRR5017073	SRX2345568	SRS1796132	SRP093295	PRJNA353372	N6 methyladenosine dynamics during early vertebrate embryogenesis	GSE89815	Other	Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability translation efficiency and effect on miR 430 degradation kinetics. Notably we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages			ip shield rep2	GSM2390026	tissue:Embryos\|developmental stage:Shield stage embryos\|strain:AB wild type	ip shield rep2	Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5’end and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al. 2013 with options seedSearchStartLmax 15 clip3pNbases 10 clip5pNbases 10 outFilterMultimapNmax 20 outFilterMismatchNoverLmax 0.05 outFilterMatchNminOverLread 0.0 outFilterMatchNmin 15 outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al. 2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage and txt file with raw and normalized read counts for each gene using the input samples	Embryos		We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015.	Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28±1°C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500µS/cm general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean Blacksburg USA 53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting Stavanger Norway dry feed twice a day and live artemia Scanbur Karlslunde Denmark once a day. Health monitoring was by daily inspection use of sentinel fish sent for pathology ZIRC Eugene Oregon and water microbiology analysis NMBU Vetbio Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats Apopka FL. Harvested embryos were kept in autoclaved SW at 28 °C harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009 the EU Directive 2010/63.	developmental stage:Shield stage embryos\|strain:AB wild type	GSM2390026	GSM2390026: ip shield rep2; Danio rerio; RIP Seq	GSM2390026		1	We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015.	GEO Accession:GSM2390026	RIP-Seq	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2000		SRP093295		ip_shield_rep2.fastq	fastq	3855863926.0	41019829.0	GSM2390026 r1	0:94	A:1044010018;C:931492803;G:952890289;T:926349254;N:1121562	94		1044010018	931492803	952890289	926349254	1121562	SRX2345568	SRS1796132	SRA492943	GEO	Klungland Lab, Dept of microbiology, Oslo University Hospital	1	0.03311		0.00481		0.96337		0.68612		94		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	bulk	unknown	unknown	Norway	2016-11-14	Gastrula	Embryo	Embryo Imprecise	All anatomical structures
41551	41551	SRR5017072	SRX2345567	SRS1796131	SRP093295	PRJNA353372	N6 methyladenosine dynamics during early vertebrate embryogenesis	GSE89815	Other	Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability translation efficiency and effect on miR 430 degradation kinetics. Notably we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages			ip shield rep1	GSM2390025	tissue:Embryos\|developmental stage:Shield stage embryos\|strain:AB wild type	ip shield rep1	Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5’end and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al. 2013 with options seedSearchStartLmax 15 clip3pNbases 10 clip5pNbases 10 outFilterMultimapNmax 20 outFilterMismatchNoverLmax 0.05 outFilterMatchNminOverLread 0.0 outFilterMatchNmin 15 outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al. 2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage and txt file with raw and normalized read counts for each gene using the input samples	Embryos		We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015.	Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28±1°C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500µS/cm general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean Blacksburg USA 53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting Stavanger Norway dry feed twice a day and live artemia Scanbur Karlslunde Denmark once a day. Health monitoring was by daily inspection use of sentinel fish sent for pathology ZIRC Eugene Oregon and water microbiology analysis NMBU Vetbio Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats Apopka FL. Harvested embryos were kept in autoclaved SW at 28 °C harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009 the EU Directive 2010/63.	developmental stage:Shield stage embryos\|strain:AB wild type	GSM2390025	GSM2390025: ip shield rep1; Danio rerio; RIP Seq	GSM2390025		1	We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015.	GEO Accession:GSM2390025	RIP-Seq	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2000		SRP093295		ip_shield_rep1.fastq.gz	fastq	4107624502.0	43698133.0	GSM2390025 r1	0:94	A:1087077899;C:996101257;G:1020588721;T:1002667943;N:1188682	94		1087077899	996101257	1020588721	1002667943	1188682	SRX2345567	SRS1796131	SRA492943	GEO	Klungland Lab, Dept of microbiology, Oslo University Hospital	1	0.01898		0.00264		0.97238		0.59809		94		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	bulk	unknown	unknown	Norway	2016-11-14	Gastrula	Embryo	Embryo Imprecise	All anatomical structures
41552	41552	SRR5017071	SRX2345566	SRS1796152	SRP093295	PRJNA353372	N6 methyladenosine dynamics during early vertebrate embryogenesis	GSE89815	Other	Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability translation efficiency and effect on miR 430 degradation kinetics. Notably we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages			input sphere rep2	GSM2390024	tissue:Embryos\|developmental stage:sphere stage embryos\|strain:AB wild type	input sphere rep2	Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5’end and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al. 2013 with options seedSearchStartLmax 15 clip3pNbases 10 clip5pNbases 10 outFilterMultimapNmax 20 outFilterMismatchNoverLmax 0.05 outFilterMatchNminOverLread 0.0 outFilterMatchNmin 15 outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al. 2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage and txt file with raw and normalized read counts for each gene using the input samples	Embryos		We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015.	Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28±1°C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500µS/cm general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean Blacksburg USA 53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting Stavanger Norway dry feed twice a day and live artemia Scanbur Karlslunde Denmark once a day. Health monitoring was by daily inspection use of sentinel fish sent for pathology ZIRC Eugene Oregon and water microbiology analysis NMBU Vetbio Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats Apopka FL. Harvested embryos were kept in autoclaved SW at 28 °C harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009 the EU Directive 2010/63.	developmental stage:sphere stage embryos\|strain:AB wild type	GSM2390024	GSM2390024: input sphere rep2; Danio rerio; RIP Seq	GSM2390024		1	We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015.	GEO Accession:GSM2390024	RIP-Seq	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2000		SRP093295		input_sphere_rep2.fastq.gz	fastq	3684856024.0	39200596.0	GSM2390024 r1	0:94	A:991404019;C:883789087;G:892976599;T:916520929;N:165390	94		991404019	883789087	892976599	916520929	165390	SRX2345566	SRS1796152	SRA492943	GEO	Klungland Lab, Dept of microbiology, Oslo University Hospital	1	0.03619		0.00867		0.96051		0.63934		94		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	bulk	unknown	unknown	Norway	2016-11-14	Blastula	Embryo	Embryo Imprecise	All anatomical structures
41553	41553	SRR5017070	SRX2345565	SRS1796139	SRP093295	PRJNA353372	N6 methyladenosine dynamics during early vertebrate embryogenesis	GSE89815	Other	Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability translation efficiency and effect on miR 430 degradation kinetics. Notably we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages			input sphere rep1	GSM2390023	tissue:Embryos\|developmental stage:sphere stage embryos\|strain:AB wild type	input sphere rep1	Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5’end and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al. 2013 with options seedSearchStartLmax 15 clip3pNbases 10 clip5pNbases 10 outFilterMultimapNmax 20 outFilterMismatchNoverLmax 0.05 outFilterMatchNminOverLread 0.0 outFilterMatchNmin 15 outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al. 2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage and txt file with raw and normalized read counts for each gene using the input samples	Embryos		We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015.	Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28±1°C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500µS/cm general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean Blacksburg USA 53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting Stavanger Norway dry feed twice a day and live artemia Scanbur Karlslunde Denmark once a day. Health monitoring was by daily inspection use of sentinel fish sent for pathology ZIRC Eugene Oregon and water microbiology analysis NMBU Vetbio Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats Apopka FL. Harvested embryos were kept in autoclaved SW at 28 °C harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009 the EU Directive 2010/63.	developmental stage:sphere stage embryos\|strain:AB wild type	GSM2390023	GSM2390023: input sphere rep1; Danio rerio; RIP Seq	GSM2390023		1	We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015.	GEO Accession:GSM2390023	RIP-Seq	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2000		SRP093295		input_sphere_rep1.fastq.gz	fastq	3774515574.0	40154421.0	GSM2390023 r1	0:94	A:1014569244;C:912257296;G:925742711;T:921776107;N:170216	94		1014569244	912257296	925742711	921776107	170216	SRX2345565	SRS1796139	SRA492943	GEO	Klungland Lab, Dept of microbiology, Oslo University Hospital	1	0.04287		0.00892		0.95085		0.50435		94		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	bulk	unknown	unknown	Norway	2016-11-14	Blastula	Embryo	Embryo Imprecise	All anatomical structures
41554	41554	SRR5017069	SRX2345564	SRS1796133	SRP093295	PRJNA353372	N6 methyladenosine dynamics during early vertebrate embryogenesis	GSE89815	Other	Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability translation efficiency and effect on miR 430 degradation kinetics. Notably we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages			ip sphere rep2	GSM2390022	tissue:Embryos\|developmental stage:sphere stage embryos\|strain:AB wild type	ip sphere rep2	Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5’end and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al. 2013 with options seedSearchStartLmax 15 clip3pNbases 10 clip5pNbases 10 outFilterMultimapNmax 20 outFilterMismatchNoverLmax 0.05 outFilterMatchNminOverLread 0.0 outFilterMatchNmin 15 outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al. 2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage and txt file with raw and normalized read counts for each gene using the input samples	Embryos		We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015.	Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28±1°C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500µS/cm general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean Blacksburg USA 53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting Stavanger Norway dry feed twice a day and live artemia Scanbur Karlslunde Denmark once a day. Health monitoring was by daily inspection use of sentinel fish sent for pathology ZIRC Eugene Oregon and water microbiology analysis NMBU Vetbio Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats Apopka FL. Harvested embryos were kept in autoclaved SW at 28 °C harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009 the EU Directive 2010/63.	developmental stage:sphere stage embryos\|strain:AB wild type	GSM2390022	GSM2390022: ip sphere rep2; Danio rerio; RIP Seq	GSM2390022		1	We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015.	GEO Accession:GSM2390022	RIP-Seq	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2000		SRP093295		ip_sphere_rep2.fastq.gz	fastq	3926426624.0	41770496.0	GSM2390022 r1	0:94	A:1037910962;C:957162730;G:963824694;T:966381238;N:1147000	94		1037910962	957162730	963824694	966381238	1147000	SRX2345564	SRS1796133	SRA492943	GEO	Klungland Lab, Dept of microbiology, Oslo University Hospital	1	0.03492		0.00427		0.95026		0.60529		94		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	bulk	unknown	unknown	Norway	2016-11-14	Blastula	Embryo	Embryo Imprecise	All anatomical structures
41555	41555	SRR5017068	SRX2345563	SRS1796143	SRP093295	PRJNA353372	N6 methyladenosine dynamics during early vertebrate embryogenesis	GSE89815	Other	Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability translation efficiency and effect on miR 430 degradation kinetics. Notably we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages			ip sphere rep1	GSM2390021	tissue:Embryos\|developmental stage:sphere stage embryos\|strain:AB wild type	ip sphere rep1	Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5’end and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al. 2013 with options seedSearchStartLmax 15 clip3pNbases 10 clip5pNbases 10 outFilterMultimapNmax 20 outFilterMismatchNoverLmax 0.05 outFilterMatchNminOverLread 0.0 outFilterMatchNmin 15 outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al. 2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage and txt file with raw and normalized read counts for each gene using the input samples	Embryos		We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015.	Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28±1°C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500µS/cm general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean Blacksburg USA 53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting Stavanger Norway dry feed twice a day and live artemia Scanbur Karlslunde Denmark once a day. Health monitoring was by daily inspection use of sentinel fish sent for pathology ZIRC Eugene Oregon and water microbiology analysis NMBU Vetbio Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats Apopka FL. Harvested embryos were kept in autoclaved SW at 28 °C harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009 the EU Directive 2010/63.	developmental stage:sphere stage embryos\|strain:AB wild type	GSM2390021	GSM2390021: ip sphere rep1; Danio rerio; RIP Seq	GSM2390021		1	We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015.	GEO Accession:GSM2390021	RIP-Seq	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2000		SRP093295		ip_sphere_rep1.fastq.gz	fastq	4185867000.0	44530500.0	GSM2390021 r1	0:94	A:1114959829;C:1018236207;G:1019156922;T:1032304051;N:1209991	94		1114959829	1018236207	1019156922	1032304051	1209991	SRX2345563	SRS1796143	SRA492943	GEO	Klungland Lab, Dept of microbiology, Oslo University Hospital	1	0.03035		0.00288		0.94757		0.5787		94		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	bulk	unknown	unknown	Norway	2016-11-14	Blastula	Embryo	Embryo Imprecise	All anatomical structures
41556	41556	SRR5017067	SRX2345562	SRS1796129	SRP093295	PRJNA353372	N6 methyladenosine dynamics during early vertebrate embryogenesis	GSE89815	Other	Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability translation efficiency and effect on miR 430 degradation kinetics. Notably we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages			input 64cell rep2	GSM2390020	tissue:Embryos\|developmental stage:64 cell embryos\|strain:AB wild type	input 64cell rep2	Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5’end and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al. 2013 with options seedSearchStartLmax 15 clip3pNbases 10 clip5pNbases 10 outFilterMultimapNmax 20 outFilterMismatchNoverLmax 0.05 outFilterMatchNminOverLread 0.0 outFilterMatchNmin 15 outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al. 2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage and txt file with raw and normalized read counts for each gene using the input samples	Embryos		We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015.	Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28±1°C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500µS/cm general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean Blacksburg USA 53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting Stavanger Norway dry feed twice a day and live artemia Scanbur Karlslunde Denmark once a day. Health monitoring was by daily inspection use of sentinel fish sent for pathology ZIRC Eugene Oregon and water microbiology analysis NMBU Vetbio Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats Apopka FL. Harvested embryos were kept in autoclaved SW at 28 °C harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009 the EU Directive 2010/63.	developmental stage:64 cell embryos\|strain:AB wild type	GSM2390020	GSM2390020: input 64cell rep2; Danio rerio; RIP Seq	GSM2390020		1	We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015.	GEO Accession:GSM2390020	RIP-Seq	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2000		SRP093295		input_64cell_rep2.fastq.gz	fastq	3598782386.0	38284919.0	GSM2390020 r1	0:94	A:953869445;C:864903757;G:875832539;T:903947732;N:228913	94		953869445	864903757	875832539	903947732	228913	SRX2345562	SRS1796129	SRA492943	GEO	Klungland Lab, Dept of microbiology, Oslo University Hospital	1	0.04289		0.00757		0.9418		0.6078		94		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	bulk	unknown	unknown	Norway	2016-11-14	Cleavage	Embryo	Embryo Imprecise	All anatomical structures
41557	41557	SRR5017066	SRX2345561	SRS1796141	SRP093295	PRJNA353372	N6 methyladenosine dynamics during early vertebrate embryogenesis	GSE89815	Other	Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability translation efficiency and effect on miR 430 degradation kinetics. Notably we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages			input 64cell rep1	GSM2390019	tissue:Embryos\|developmental stage:64 cell embryos\|strain:AB wild type	input 64cell rep1	Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5’end and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al. 2013 with options seedSearchStartLmax 15 clip3pNbases 10 clip5pNbases 10 outFilterMultimapNmax 20 outFilterMismatchNoverLmax 0.05 outFilterMatchNminOverLread 0.0 outFilterMatchNmin 15 outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al. 2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage and txt file with raw and normalized read counts for each gene using the input samples	Embryos		We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015.	Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28±1°C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500µS/cm general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean Blacksburg USA 53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting Stavanger Norway dry feed twice a day and live artemia Scanbur Karlslunde Denmark once a day. Health monitoring was by daily inspection use of sentinel fish sent for pathology ZIRC Eugene Oregon and water microbiology analysis NMBU Vetbio Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats Apopka FL. Harvested embryos were kept in autoclaved SW at 28 °C harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009 the EU Directive 2010/63.	developmental stage:64 cell embryos\|strain:AB wild type	GSM2390019	GSM2390019: input 64cell rep1; Danio rerio; RIP Seq	GSM2390019		1	We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015.	GEO Accession:GSM2390019	RIP-Seq	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2000		SRP093295		input_64cell_rep1.fastq.gz	fastq	3538898746.0	37647859.0	GSM2390019 r1	0:94	A:916878511;C:870431252;G:873611680;T:877750503;N:226800	94		916878511	870431252	873611680	877750503	226800	SRX2345561	SRS1796141	SRA492943	GEO	Klungland Lab, Dept of microbiology, Oslo University Hospital	1	0.03397		0.00616		0.95268		0.62545		94		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	bulk	unknown	unknown	Norway	2016-11-14	Cleavage	Embryo	Embryo Imprecise	All anatomical structures
41558	41558	SRR5017065	SRX2345560	SRS1796153	SRP093295	PRJNA353372	N6 methyladenosine dynamics during early vertebrate embryogenesis	GSE89815	Other	Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability translation efficiency and effect on miR 430 degradation kinetics. Notably we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages			ip 64cell rep2	GSM2390018	tissue:Embryos\|developmental stage:64 cell embryos\|strain:AB wild type	ip 64cell rep2	Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5’end and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al. 2013 with options seedSearchStartLmax 15 clip3pNbases 10 clip5pNbases 10 outFilterMultimapNmax 20 outFilterMismatchNoverLmax 0.05 outFilterMatchNminOverLread 0.0 outFilterMatchNmin 15 outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al. 2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage and txt file with raw and normalized read counts for each gene using the input samples	Embryos		We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015.	Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28±1°C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500µS/cm general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean Blacksburg USA 53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting Stavanger Norway dry feed twice a day and live artemia Scanbur Karlslunde Denmark once a day. Health monitoring was by daily inspection use of sentinel fish sent for pathology ZIRC Eugene Oregon and water microbiology analysis NMBU Vetbio Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats Apopka FL. Harvested embryos were kept in autoclaved SW at 28 °C harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009 the EU Directive 2010/63.	developmental stage:64 cell embryos\|strain:AB wild type	GSM2390018	GSM2390018: ip 64cell rep2; Danio rerio; RIP Seq	GSM2390018		1	We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015.	GEO Accession:GSM2390018	RIP-Seq	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2000		SRP093295		ip_64cell_rep2.fastq.gz	fastq	3530677976.0	37560404.0	GSM2390018 r1	0:94	A:966880666;C:841411144;G:858285224;T:862983808;N:1117134	94		966880666	841411144	858285224	862983808	1117134	SRX2345560	SRS1796153	SRA492943	GEO	Klungland Lab, Dept of microbiology, Oslo University Hospital	1	0.04775		0.00421		0.92845		0.5748		94		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	bulk	unknown	unknown	Norway	2016-11-14	Cleavage	Embryo	Embryo Imprecise	All anatomical structures
41559	41559	SRR5017064	SRX2345559	SRS1796135	SRP093295	PRJNA353372	N6 methyladenosine dynamics during early vertebrate embryogenesis	GSE89815	Other	Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability translation efficiency and effect on miR 430 degradation kinetics. Notably we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages			ip 64cell rep1	GSM2390017	tissue:Embryos\|developmental stage:64 cell embryos\|strain:AB wild type	ip 64cell rep1	Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5’end and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al. 2013 with options seedSearchStartLmax 15 clip3pNbases 10 clip5pNbases 10 outFilterMultimapNmax 20 outFilterMismatchNoverLmax 0.05 outFilterMatchNminOverLread 0.0 outFilterMatchNmin 15 outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al. 2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage and txt file with raw and normalized read counts for each gene using the input samples	Embryos		We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015.	Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28±1°C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500µS/cm general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean Blacksburg USA 53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting Stavanger Norway dry feed twice a day and live artemia Scanbur Karlslunde Denmark once a day. Health monitoring was by daily inspection use of sentinel fish sent for pathology ZIRC Eugene Oregon and water microbiology analysis NMBU Vetbio Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats Apopka FL. Harvested embryos were kept in autoclaved SW at 28 °C harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009 the EU Directive 2010/63.	developmental stage:64 cell embryos\|strain:AB wild type	GSM2390017	GSM2390017: ip 64cell rep1; Danio rerio; RIP Seq	GSM2390017		1	We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015.	GEO Accession:GSM2390017	RIP-Seq	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2000		SRP093295		ip_64cell_rep1.fastq.gz	fastq	3912003734.0	41617061.0	GSM2390017 r1	0:94	A:1040276279;C:945311584;G:953598043;T:971589029;N:1228799	94		1040276279	945311584	953598043	971589029	1228799	SRX2345559	SRS1796135	SRA492943	GEO	Klungland Lab, Dept of microbiology, Oslo University Hospital	1	0.03544		0.00268		0.93914		0.53712		94		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	bulk	unknown	unknown	Norway	2016-11-14	Cleavage	Embryo	Embryo Imprecise	All anatomical structures
41560	41560	SRR5017063	SRX2345558	SRS1796155	SRP093295	PRJNA353372	N6 methyladenosine dynamics during early vertebrate embryogenesis	GSE89815	Other	Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability translation efficiency and effect on miR 430 degradation kinetics. Notably we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages			input 1cell rep2	GSM2390016	tissue:Embryos\|developmental stage:1cell embryos\|strain:AB wild type	input 1cell rep2	Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5’end and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al. 2013 with options seedSearchStartLmax 15 clip3pNbases 10 clip5pNbases 10 outFilterMultimapNmax 20 outFilterMismatchNoverLmax 0.05 outFilterMatchNminOverLread 0.0 outFilterMatchNmin 15 outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al. 2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage and txt file with raw and normalized read counts for each gene using the input samples	Embryos		We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015.	Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28±1°C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500µS/cm general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean Blacksburg USA 53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting Stavanger Norway dry feed twice a day and live artemia Scanbur Karlslunde Denmark once a day. Health monitoring was by daily inspection use of sentinel fish sent for pathology ZIRC Eugene Oregon and water microbiology analysis NMBU Vetbio Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats Apopka FL. Harvested embryos were kept in autoclaved SW at 28 °C harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009 the EU Directive 2010/63.	developmental stage:1cell embryos\|strain:AB wild type	GSM2390016	GSM2390016: input 1cell rep2; Danio rerio; RIP Seq	GSM2390016		1	We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015.	GEO Accession:GSM2390016	RIP-Seq	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2000		SRP093295		input_1cell_rep2.fastq.gz	fastq	3379762010.0	35954915.0	GSM2390016 r1	0:94	A:898920912;C:816234808;G:823428476;T:840956466;N:221348	94		898920912	816234808	823428476	840956466	221348	SRX2345558	SRS1796155	SRA492943	GEO	Klungland Lab, Dept of microbiology, Oslo University Hospital	1	0.04513		0.00864		0.95085		0.51692		94		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	bulk	unknown	unknown	Norway	2016-11-14	Zygote	Embryo	Embryo Imprecise	All anatomical structures
41561	41561	SRR5017062	SRX2345557	SRS1796128	SRP093295	PRJNA353372	N6 methyladenosine dynamics during early vertebrate embryogenesis	GSE89815	Other	Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability translation efficiency and effect on miR 430 degradation kinetics. Notably we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages			input 1cell rep1	GSM2390015	tissue:Embryos\|developmental stage:1cell embryos\|strain:AB wild type	input 1cell rep1	Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5’end and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al. 2013 with options seedSearchStartLmax 15 clip3pNbases 10 clip5pNbases 10 outFilterMultimapNmax 20 outFilterMismatchNoverLmax 0.05 outFilterMatchNminOverLread 0.0 outFilterMatchNmin 15 outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al. 2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage and txt file with raw and normalized read counts for each gene using the input samples	Embryos		We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015.	Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28±1°C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500µS/cm general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean Blacksburg USA 53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting Stavanger Norway dry feed twice a day and live artemia Scanbur Karlslunde Denmark once a day. Health monitoring was by daily inspection use of sentinel fish sent for pathology ZIRC Eugene Oregon and water microbiology analysis NMBU Vetbio Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats Apopka FL. Harvested embryos were kept in autoclaved SW at 28 °C harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009 the EU Directive 2010/63.	developmental stage:1cell embryos\|strain:AB wild type	GSM2390015	GSM2390015: input 1cell rep1; Danio rerio; RIP Seq	GSM2390015		1	We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015.	GEO Accession:GSM2390015	RIP-Seq	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2000		SRP093295		input_1cell_rep1.fastq.gz	fastq	3650321646.0	38833209.0	GSM2390015 r1	0:94	A:951411355;C:878458528;G:890250453;T:929968044;N:233266	94		951411355	878458528	890250453	929968044	233266	SRX2345557	SRS1796128	SRA492943	GEO	Klungland Lab, Dept of microbiology, Oslo University Hospital	1	0.03728		0.00668		0.94901		0.60038		94		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	bulk	unknown	unknown	Norway	2016-11-14	Zygote	Embryo	Embryo Imprecise	All anatomical structures
41562	41562	SRR5017061	SRX2345556	SRS1796127	SRP093295	PRJNA353372	N6 methyladenosine dynamics during early vertebrate embryogenesis	GSE89815	Other	Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability translation efficiency and effect on miR 430 degradation kinetics. Notably we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages			ip 1cell rep2	GSM2390014	tissue:Embryos\|developmental stage:1cell embryos\|strain:AB wild type	ip 1cell rep2	Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5’end and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al. 2013 with options seedSearchStartLmax 15 clip3pNbases 10 clip5pNbases 10 outFilterMultimapNmax 20 outFilterMismatchNoverLmax 0.05 outFilterMatchNminOverLread 0.0 outFilterMatchNmin 15 outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al. 2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage and txt file with raw and normalized read counts for each gene using the input samples	Embryos		We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015.	Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28±1°C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500µS/cm general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean Blacksburg USA 53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting Stavanger Norway dry feed twice a day and live artemia Scanbur Karlslunde Denmark once a day. Health monitoring was by daily inspection use of sentinel fish sent for pathology ZIRC Eugene Oregon and water microbiology analysis NMBU Vetbio Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats Apopka FL. Harvested embryos were kept in autoclaved SW at 28 °C harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009 the EU Directive 2010/63.	developmental stage:1cell embryos\|strain:AB wild type	GSM2390014	GSM2390014: ip 1cell rep2; Danio rerio; RIP Seq	GSM2390014		1	We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015.	GEO Accession:GSM2390014	RIP-Seq	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2000		SRP093295		ip_1cell_rep2.fastq.gz	fastq	3485432580.0	37079070.0	GSM2390014 r1	0:94	A:953699047;C:835179152;G:846963064;T:848487912;N:1103405	94		953699047	835179152	846963064	848487912	1103405	SRX2345556	SRS1796127	SRA492943	GEO	Klungland Lab, Dept of microbiology, Oslo University Hospital	1	0.02534		0.00219		0.95891		0.5975		94		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	bulk	unknown	unknown	Norway	2016-11-14	Zygote	Embryo	Embryo Imprecise	All anatomical structures
41563	41563	SRR5017060	SRX2345555	SRS1796130	SRP093295	PRJNA353372	N6 methyladenosine dynamics during early vertebrate embryogenesis	GSE89815	Other	Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability translation efficiency and effect on miR 430 degradation kinetics. Notably we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages			ip 1cell rep1	GSM2390013	tissue:Embryos\|developmental stage:1cell embryos\|strain:AB wild type	ip 1cell rep1	Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5’end and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al. 2013 with options seedSearchStartLmax 15 clip3pNbases 10 clip5pNbases 10 outFilterMultimapNmax 20 outFilterMismatchNoverLmax 0.05 outFilterMatchNminOverLread 0.0 outFilterMatchNmin 15 outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al. 2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage and txt file with raw and normalized read counts for each gene using the input samples	Embryos		We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015.	Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28±1°C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500µS/cm general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean Blacksburg USA 53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting Stavanger Norway dry feed twice a day and live artemia Scanbur Karlslunde Denmark once a day. Health monitoring was by daily inspection use of sentinel fish sent for pathology ZIRC Eugene Oregon and water microbiology analysis NMBU Vetbio Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats Apopka FL. Harvested embryos were kept in autoclaved SW at 28 °C harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009 the EU Directive 2010/63.	developmental stage:1cell embryos\|strain:AB wild type	GSM2390013	GSM2390013: ip 1cell rep1; Danio rerio; RIP Seq	GSM2390013		1	We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015.	GEO Accession:GSM2390013	RIP-Seq	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2000		SRP093295		ip_1cell_rep1.fastq.gz	fastq	3610167102.0	38406033.0	GSM2390013 r1	0:94	A:961438376;C:875781200;G:891055201;T:880749228;N:1143097	94		961438376	875781200	891055201	880749228	1143097	SRX2345555	SRS1796130	SRA492943	GEO	Klungland Lab, Dept of microbiology, Oslo University Hospital	1	0.01939		0.00159		0.96457		0.53652		94		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	bulk	unknown	unknown	Norway	2016-11-14	Zygote	Embryo	Embryo Imprecise	All anatomical structures
42000	42000	SRR5379364	SRX2674572	SRS2073700	SRP102513	PRJNA380609	Transcriptome analysis on wild type and ddx39a mutant zebrafish embryos by Next Generation Sequencing	GSE97067	Other	DEAD box RNA helicase DDX39A has been shown to regulate RNA metabolism; however its role in vertebrate development has not previously been examined. To determine the impact of loss of ddx39a on transcriptome during vertebrate early development we pursued transcriptome analysis RNA Seq on wild type and ddx39a mutant zebrafish embryos at 24 hpf And by using RIP seq to identify targeted RNA which were DDX39A binded. Overall design: Using RNA seq to identify the changes in the transcriptomic landscape in ddx39a mutants. Using RIP seq to identify DDX39A binding RNAs.	pubmed:29636379		ddx39a 24hpf RIPseq	GSM2550918	source name:embryos\|genotype:ddx39a mutant\|tissue:embryo\|developmental stage:24hpf	ddx39a 24hpf RIPseq	Illumina bcl2fastq2 v 2.16.0.10 software was used for base calling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence. Read quality was checked for each sample by using FastQC v 0.11.5. High quality reads were alligned to GRCz10 whole genome using tophat V2.2.1 and bowtie2 v2.2.3 with parameters q p 8 no novel juncs G o. Raw counts of sequencing reads were generated by using HTSeq v 0.6.1p1. Genome build: GRCz10 Supplementary files format and content: tab delimited text files include raw counts for each Sample	embryos		Microinjection ddx39a Flag mRNA in ddx39a mutant embryos at one cell stage. Lysates were clarified from 24hpf embryos were isolated with anti Flag beads. RNA was harvested using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit was used with 1 ug of total RNA for the construction of sequencing libraries. Magnetic beads with oligodT were used to enrich the mRNAs and then Frag/Prime buffer was added to fragment the mRNAs. The short mRNA fragments were used as templates and random hexamers were used to synthesize first strand cDNA. Then double stranded cDNA was synthesized by adding buffer solution dNTPs and DNA polymeraseΙ. The double stranded cDNAs were purified by DNA clean beads according to the manufacturer’s instructions then repaired at the tail ends polyA added and enriched by PCR amplification. Finally we tested the inserts sizes in the cDNA libraries on an Agilent 2100 Bioanalyzer.		genotype:ddx39a mutant\|tissue:embryo\|developmental stage:24hpf	GSM2550918	GSM2550918: ddx39a 24hpf RIPseq; Danio rerio; RIP Seq	GSM2550918		1	Microinjection ddx39a Flag mRNA in ddx39a mutant embryos at one cell stage. Lysates were clarified from 24hpf embryos were isolated with anti Flag beads. RNA was harvested using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit was used with 1 ug of total RNA for the construction of sequencing libraries. Magnetic beads with oligodT were used to enrich the mRNAs and then Frag/Prime buffer was added to fragment the mRNAs. The short mRNA fragments were used as templates and random hexamers were used to synthesize first strand cDNA. Then double stranded cDNA was synthesized by adding buffer solution dNTPs and DNA polymeraseΙ. The double stranded cDNAs were purified by DNA clean beads according to the manufacturer’s instructions then repaired at the tail ends polyA added and enriched by PCR amplification. Finally we tested the inserts sizes in the cDNA libraries on an Agilent 2100 Bioanalyzer.	GEO Accession:GSM2550918	RIP-Seq	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina HiSeq 4000		SRP102513		RDWHDANwwwCAABRAAPEI-206_1.fq.gz RDWHDANwwwCAABRAAPEI-206_2.fq.gz	fastq fastq	3819239400.0	19096197.0	GSM2550918 r1	0:100 1:100	A:751858949;C:1169790479;G:1139713624;T:756987876;N:888472	100	100	751858949	1169790479	1139713624	756987876	888472	SRX2674572	SRS2073700	SRA549449	GEO	Xin Lou Lab, Medical School, Nanjing University	2	0.98659	0.98572	0.28836	0.28975	0.89422	0.89558	0.75396	0.78553	100	100	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	China	2017-03-27	Pharyngula	Embryo	Embryo Imprecise	All anatomical structures
42001	42001	SRR5379363	SRX2674571	SRS2073697	SRP102513	PRJNA380609	Transcriptome analysis on wild type and ddx39a mutant zebrafish embryos by Next Generation Sequencing	GSE97067	Other	DEAD box RNA helicase DDX39A has been shown to regulate RNA metabolism; however its role in vertebrate development has not previously been examined. To determine the impact of loss of ddx39a on transcriptome during vertebrate early development we pursued transcriptome analysis RNA Seq on wild type and ddx39a mutant zebrafish embryos at 24 hpf And by using RIP seq to identify targeted RNA which were DDX39A binded. Overall design: Using RNA seq to identify the changes in the transcriptomic landscape in ddx39a mutants. Using RIP seq to identify DDX39A binding RNAs.	pubmed:29636379		WT 24hpf RIPseq	GSM2550917	source name:embryos\|genotype:wild type\|tissue:embryo\|developmental stage:24hpf	WT 24hpf RIPseq	Illumina bcl2fastq2 v 2.16.0.10 software was used for base calling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence. Read quality was checked for each sample by using FastQC v 0.11.5. High quality reads were alligned to GRCz10 whole genome using tophat V2.2.1 and bowtie2 v2.2.3 with parameters q p 8 no novel juncs G o. Raw counts of sequencing reads were generated by using HTSeq v 0.6.1p1. Genome build: GRCz10 Supplementary files format and content: tab delimited text files include raw counts for each Sample	embryos		Microinjection ddx39a Flag mRNA in ddx39a mutant embryos at one cell stage. Lysates were clarified from 24hpf embryos were isolated with anti Flag beads. RNA was harvested using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit was used with 1 ug of total RNA for the construction of sequencing libraries. Magnetic beads with oligodT were used to enrich the mRNAs and then Frag/Prime buffer was added to fragment the mRNAs. The short mRNA fragments were used as templates and random hexamers were used to synthesize first strand cDNA. Then double stranded cDNA was synthesized by adding buffer solution dNTPs and DNA polymeraseΙ. The double stranded cDNAs were purified by DNA clean beads according to the manufacturer’s instructions then repaired at the tail ends polyA added and enriched by PCR amplification. Finally we tested the inserts sizes in the cDNA libraries on an Agilent 2100 Bioanalyzer.		genotype:wild type\|tissue:embryo\|developmental stage:24hpf	GSM2550917	GSM2550917: WT 24hpf RIPseq; Danio rerio; RIP Seq	GSM2550917		1	Microinjection ddx39a Flag mRNA in ddx39a mutant embryos at one cell stage. Lysates were clarified from 24hpf embryos were isolated with anti Flag beads. RNA was harvested using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit was used with 1 ug of total RNA for the construction of sequencing libraries. Magnetic beads with oligodT were used to enrich the mRNAs and then Frag/Prime buffer was added to fragment the mRNAs. The short mRNA fragments were used as templates and random hexamers were used to synthesize first strand cDNA. Then double stranded cDNA was synthesized by adding buffer solution dNTPs and DNA polymeraseΙ. The double stranded cDNAs were purified by DNA clean beads according to the manufacturer’s instructions then repaired at the tail ends polyA added and enriched by PCR amplification. Finally we tested the inserts sizes in the cDNA libraries on an Agilent 2100 Bioanalyzer.	GEO Accession:GSM2550917	RIP-Seq	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina HiSeq 4000		SRP102513		RDWHDANwwwCAAARAAPEI-205_2.fq.gz RDWHDANwwwCAAARAAPEI-205_1.fq.gz	fastq fastq	3802882200.0	19014411.0	GSM2550917 r1	0:100 1:100	A:733911232;C:1178365174;G:1154031422;T:735690235;N:884137	100	100	733911232	1178365174	1154031422	735690235	884137	SRX2674571	SRS2073697	SRA549449	GEO	Xin Lou Lab, Medical School, Nanjing University	2	0.9866	0.98469	0.30567	0.30486	0.90796	0.90928	0.82926	0.83029	100	100	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	China	2017-03-27	Pharyngula	Embryo	Embryo Imprecise	All anatomical structures
43402	43402	SRR5931544	SRX3091819	SRS2429165	SRP115388	PRJNA397956	Danio rerio strain:AB wild type \| isolate:CK Ddifenoconazole \| breed:zebrafish \| cultivar:zebrafish embryo Raw sequence reads	PRJNA397956	Whole Genome Sequencing	To evaluate underlying environmental risks of difenoconazole in aquatic organisms		To evaluate underlying environmental risks of difenoconazole in zebrafish embryo	Model organism or animal sample from Danio rerio	Zebrafish	strain:AB wild type\|isolate:CK Ddifenoconazole\|breed:zebrafish\|cultivar:zebrafish embryo\|dev stage:embryo\|sex:not applicable\|tissue:with difenoconazole and without xxx\|BioSampleModel:Model organism or animal									with difenoconazole	397969	397969	to evulate the environmental risks of difenoconazole in zebrafish embryo			RNA-Seq	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2500		SRP115388				4755826950.0	31705513.0	D 500 1 2.fq.gz	0:0 1:150	A:1274207449;C:1094727902;G:1122524378;T:1264331427;N:35794	0	150	1274207449	1094727902	1122524378	1264331427	35794	SRX3091819	SRS2429165	SRA598900	China Agricultural University\|College of Sciences	China Agricultural University	1	0.91191		0.10926		0.68341		0.47196		150		B		usable mapping rate	illumina	hiseq_era	unknown	other	unknown	bulk	unknown	unknown	China	2017-08-14	Undetermined	Embryo	Embryo Imprecise	All anatomical structures
43403	43403	SRR5931545	SRX3091818	SRS2429165	SRP115388	PRJNA397956	Danio rerio strain:AB wild type \| isolate:CK Ddifenoconazole \| breed:zebrafish \| cultivar:zebrafish embryo Raw sequence reads	PRJNA397956	Whole Genome Sequencing	To evaluate underlying environmental risks of difenoconazole in aquatic organisms		To evaluate underlying environmental risks of difenoconazole in zebrafish embryo	Model organism or animal sample from Danio rerio	Zebrafish	strain:AB wild type\|isolate:CK Ddifenoconazole\|breed:zebrafish\|cultivar:zebrafish embryo\|dev stage:embryo\|sex:not applicable\|tissue:with difenoconazole and without xxx\|BioSampleModel:Model organism or animal									with difenoconazole	397968	397968	to evulate the environmental risks of difenoconazole in zebrafish embryo			RNA-Seq	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2500		SRP115388				4755826950.0	31705513.0	D 500 1 1.fq.gz	0:150 1:0	A:1276129214;C:1100761964;G:1115345594;T:1263574047;N:16131	150	0	1276129214	1100761964	1115345594	1263574047	16131	SRX3091818	SRS2429165	SRA598900	China Agricultural University\|College of Sciences	China Agricultural University	1	0.91044		0.10895		0.67659		0.46952		150		B		usable mapping rate	illumina	hiseq_era	unknown	other	unknown	bulk	unknown	unknown	China	2017-08-14	Undetermined	Embryo	Embryo Imprecise	All anatomical structures
43404	43404	SRR5931546	SRX3091817	SRS2429165	SRP115388	PRJNA397956	Danio rerio strain:AB wild type \| isolate:CK Ddifenoconazole \| breed:zebrafish \| cultivar:zebrafish embryo Raw sequence reads	PRJNA397956	Whole Genome Sequencing	To evaluate underlying environmental risks of difenoconazole in aquatic organisms		To evaluate underlying environmental risks of difenoconazole in zebrafish embryo	Model organism or animal sample from Danio rerio	Zebrafish	strain:AB wild type\|isolate:CK Ddifenoconazole\|breed:zebrafish\|cultivar:zebrafish embryo\|dev stage:embryo\|sex:not applicable\|tissue:with difenoconazole and without xxx\|BioSampleModel:Model organism or animal									with difenoconazole	397967	397967	to evulate the environmental risks of difenoconazole in zebrafish embryo			RNA-Seq	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2500		SRP115388				4584658950.0	30564393.0	D 50 3 2.fq.gz	0:0 1:150	A:1214232270;C:1065003267;G:1091428812;T:1213867330;N:127271	0	150	1214232270	1065003267	1091428812	1213867330	127271	SRX3091817	SRS2429165	SRA598900	China Agricultural University\|College of Sciences	China Agricultural University	1	0.92229		0.10554		0.68667		0.4535		150		B		usable mapping rate	illumina	hiseq_era	unknown	other	unknown	bulk	unknown	unknown	China	2017-08-14	Undetermined	Embryo	Embryo Imprecise	All anatomical structures
43405	43405	SRR5931547	SRX3091816	SRS2429165	SRP115388	PRJNA397956	Danio rerio strain:AB wild type \| isolate:CK Ddifenoconazole \| breed:zebrafish \| cultivar:zebrafish embryo Raw sequence reads	PRJNA397956	Whole Genome Sequencing	To evaluate underlying environmental risks of difenoconazole in aquatic organisms		To evaluate underlying environmental risks of difenoconazole in zebrafish embryo	Model organism or animal sample from Danio rerio	Zebrafish	strain:AB wild type\|isolate:CK Ddifenoconazole\|breed:zebrafish\|cultivar:zebrafish embryo\|dev stage:embryo\|sex:not applicable\|tissue:with difenoconazole and without xxx\|BioSampleModel:Model organism or animal									with difenoconazole	397966	397966	to evulate the environmental risks of difenoconazole in zebrafish embryo			RNA-Seq	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2500		SRP115388				4584658950.0	30564393.0	D 50 3 1.fq.gz	0:150 1:0	A:1219702088;C:1067643780;G:1085480895;T:1211806100;N:26087	150	0	1219702088	1067643780	1085480895	1211806100	26087	SRX3091816	SRS2429165	SRA598900	China Agricultural University\|College of Sciences	China Agricultural University	1	0.92126		0.10598		0.68398		0.44901		150		B		usable mapping rate	illumina	hiseq_era	unknown	other	unknown	bulk	unknown	unknown	China	2017-08-14	Undetermined	Embryo	Embryo Imprecise	All anatomical structures
43406	43406	SRR5931548	SRX3091815	SRS2429165	SRP115388	PRJNA397956	Danio rerio strain:AB wild type \| isolate:CK Ddifenoconazole \| breed:zebrafish \| cultivar:zebrafish embryo Raw sequence reads	PRJNA397956	Whole Genome Sequencing	To evaluate underlying environmental risks of difenoconazole in aquatic organisms		To evaluate underlying environmental risks of difenoconazole in zebrafish embryo	Model organism or animal sample from Danio rerio	Zebrafish	strain:AB wild type\|isolate:CK Ddifenoconazole\|breed:zebrafish\|cultivar:zebrafish embryo\|dev stage:embryo\|sex:not applicable\|tissue:with difenoconazole and without xxx\|BioSampleModel:Model organism or animal									with difenoconazole	397973	397973	to evulate the environmental risks of difenoconazole in zebrafish embryo			RNA-Seq	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2500		SRP115388				4705867200.0	31372448.0	D 500 3 2.fq.gz	0:0 1:150	A:1240294141;C:1111008282;G:1125861755;T:1228667971;N:35051	0	150	1240294141	1111008282	1125861755	1228667971	35051	SRX3091815	SRS2429165	SRA598900	China Agricultural University\|College of Sciences	China Agricultural University	1	0.92297		0.09739		0.6856		0.47451		150		B		usable mapping rate	illumina	hiseq_era	unknown	other	unknown	bulk	unknown	unknown	China	2017-08-14	Undetermined	Embryo	Embryo Imprecise	All anatomical structures
43407	43407	SRR5931549	SRX3091814	SRS2429165	SRP115388	PRJNA397956	Danio rerio strain:AB wild type \| isolate:CK Ddifenoconazole \| breed:zebrafish \| cultivar:zebrafish embryo Raw sequence reads	PRJNA397956	Whole Genome Sequencing	To evaluate underlying environmental risks of difenoconazole in aquatic organisms		To evaluate underlying environmental risks of difenoconazole in zebrafish embryo	Model organism or animal sample from Danio rerio	Zebrafish	strain:AB wild type\|isolate:CK Ddifenoconazole\|breed:zebrafish\|cultivar:zebrafish embryo\|dev stage:embryo\|sex:not applicable\|tissue:with difenoconazole and without xxx\|BioSampleModel:Model organism or animal									with difenoconazole	397972	397972	to evulate the environmental risks of difenoconazole in zebrafish embryo			RNA-Seq	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2500		SRP115388				4705867200.0	31372448.0	D 500 3 1.fq.gz	0:150 1:0	A:1241514886;C:1108723884;G:1123339576;T:1232273510;N:15344	150	0	1241514886	1108723884	1123339576	1232273510	15344	SRX3091814	SRS2429165	SRA598900	China Agricultural University\|College of Sciences	China Agricultural University	1	0.92062		0.09796		0.67856		0.47388		150		B		usable mapping rate	illumina	hiseq_era	unknown	other	unknown	bulk	unknown	unknown	China	2017-08-14	Undetermined	Embryo	Embryo Imprecise	All anatomical structures
43408	43408	SRR5931550	SRX3091813	SRS2429165	SRP115388	PRJNA397956	Danio rerio strain:AB wild type \| isolate:CK Ddifenoconazole \| breed:zebrafish \| cultivar:zebrafish embryo Raw sequence reads	PRJNA397956	Whole Genome Sequencing	To evaluate underlying environmental risks of difenoconazole in aquatic organisms		To evaluate underlying environmental risks of difenoconazole in zebrafish embryo	Model organism or animal sample from Danio rerio	Zebrafish	strain:AB wild type\|isolate:CK Ddifenoconazole\|breed:zebrafish\|cultivar:zebrafish embryo\|dev stage:embryo\|sex:not applicable\|tissue:with difenoconazole and without xxx\|BioSampleModel:Model organism or animal									with difenoconazole	397971	397971	to evulate the environmental risks of difenoconazole in zebrafish embryo			RNA-Seq	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina HiSeq 2500		SRP115388				4750951350.0	31673009.0	D 500 2 2.fq.gz	0:0 1:150	A:1286144024;C:1079544004;G:1112952985;T:1272274928;N:35409	0	150	1286144024	1079544004	1112952985	1272274928	35409	SRX3091813	SRS2429165	SRA598900	China Agricultural University\|College of Sciences	China Agricultural University	1	0.90446		0.13747		0.68639		0.46726		150		B		usable mapping rate	illumina	hiseq_era	unknown	other	unknown	bulk	unknown	unknown	China	2017-08-14	Undetermined	Embryo	Embryo Imprecise	All anatomical structures

Advanced export

JSON shape: default, array, newline-delimited

CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;