run_metadata
216 rows where experiment.library_selection = "other", technology = "unknown" and tissue_curation = "Embryo Imprecise"
This data as json, CSV (advanced)
| Link | rowid ▼ | run.accession | experiment.accession | sample.accession | study.accession | bioproject | study.title | study.alias | study.type | study.abstract | study.attributes | study.PMIDs | sample.description | sample.title | sample.alias | sample.centername | sample.attributes | GEOsample.title | GEOsample.dataprocessing | GEOsample.source | GEOsample.treatmentprotocol | GEOsample.extractprotocol | GEOsample.growthprotocol | GEOsample.characteristics | GEOsample.accession | experiment.title | experiment.alias | experiment.library_name | experiment.design_description | experiment.library_construction_protocol | experiment.attributes | experiment.library_strategy | experiment.library_source | experiment.library_selection | experiment.library_layout | experiment.platform | experiment.instrument_model | experiment.spot_descriptor | experiment.study_ref | run.title | run.attributes | run.filename | run.semantic_name | run.total_bases | run.total_spots | run.alias | run.read_lengths | run.base_counts | run.r1_length | run.r2_length | run.r3_length | run.r4_length | run.Acount | run.Ccount | run.Gcount | run.Tcount | run.Ncount | run.experiment | run.pool_member | submission.accession | submission.srasource | submission.bioprojectsource | seqdetective.n_mates | seqdetective.mapping_rate.mate1 | seqdetective.mapping_rate.mate2 | seqdetective.nofeature_rate.mate1 | seqdetective.nofeature_rate.mate2 | seqdetective.sparsity.mate1 | seqdetective.sparsity.mate2 | seqdetective.pos_strand_rate.mate1 | seqdetective.pos_strand_rate.mate2 | seqdetective.readlen.mate1 | seqdetective.readlen.mate2 | seqdetective.judgement.mate1 | seqdetective.judgement.mate2 | seqdetective.judgement.reason | platform_family | instrument_generation | read_bias | selection_class | prep_kit | sc_or_bulk | tech_class | technology | tech_variant | submission.bioprojectsource.country | earliest_date | devstage_curation | devstage_curation_coarse | tissue_curation | tissue_curation_coarse |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 33990 | 33990 | SRR31030860 | SRX26416598 | SRS22936450 | SRP539182 | PRJNA1174121 | Quantification of subcellular RNA localization through direct detection of RNA oxidation | GSE279714 | Other | Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software. | pubmed:39605352;pubmed:40037712 | ZF NES GAPDH Rep4 minus | GSM8578751 | source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF|geo loc name:missing|collection date:missing | ZF NES GAPDH Rep4 minus | OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN. | 2 dpf embryos | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium. | tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF | GSM8578751 | GSM8578751: ZF NES GAPDH Rep4 minus; Danio rerio; OTHER | GSM8578751 r1 | GSM8578751 | 1 | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | OTHER | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539182 | ZF_NES_GAPDH_Rep4_minus.R1.fq.gz ZF_NES_GAPDH_Rep4_minus.R2.fq.gz | fastq fastq | 1100578200.0 | 3668594.0 | GSM8578751 r1 | 0:150 1:150 | A:287878221;C:249390946;G:265835736;T:297454600;N:18697 | 150 | 150 | 287878221 | 249390946 | 265835736 | 297454600 | 18697 | SRX26416598 | SRS22936450 | SRA1993027 | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | B | B | biological fallback assumption | illumina | novaseq_era | full_length | random_priming | lexogen | bulk | unknown | unknown | United States | 2024-10-17 | Hatching | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||
| 33991 | 33991 | SRR31030861 | SRX26416597 | SRS22936451 | SRP539182 | PRJNA1174121 | Quantification of subcellular RNA localization through direct detection of RNA oxidation | GSE279714 | Other | Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software. | pubmed:39605352;pubmed:40037712 | ZF NES GAPDH Rep3 plus | GSM8578750 | source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF|geo loc name:missing|collection date:missing | ZF NES GAPDH Rep3 plus | OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN. | 2 dpf embryos | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium. | tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF | GSM8578750 | GSM8578750: ZF NES GAPDH Rep3 plus; Danio rerio; OTHER | GSM8578750 r1 | GSM8578750 | 1 | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | OTHER | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539182 | ZF_NES_GAPDH_Rep3_plus.R1.fq.gz ZF_NES_GAPDH_Rep3_plus.R2.fq.gz | fastq fastq | 1231779300.0 | 4105931.0 | GSM8578750 r1 | 0:150 1:150 | A:322256597;C:278991471;G:297394980;T:333116282;N:19970 | 150 | 150 | 322256597 | 278991471 | 297394980 | 333116282 | 19970 | SRX26416597 | SRS22936451 | SRA1993027 | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | B | B | biological fallback assumption | illumina | novaseq_era | full_length | random_priming | lexogen | bulk | unknown | unknown | United States | 2024-10-17 | Hatching | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||
| 33992 | 33992 | SRR31030862 | SRX26416596 | SRS22936449 | SRP539182 | PRJNA1174121 | Quantification of subcellular RNA localization through direct detection of RNA oxidation | GSE279714 | Other | Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software. | pubmed:39605352;pubmed:40037712 | ZF NES GAPDH Rep3 minus | GSM8578749 | source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF|geo loc name:missing|collection date:missing | ZF NES GAPDH Rep3 minus | OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN. | 2 dpf embryos | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium. | tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF | GSM8578749 | GSM8578749: ZF NES GAPDH Rep3 minus; Danio rerio; OTHER | GSM8578749 r1 | GSM8578749 | 1 | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | OTHER | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539182 | ZF_NES_GAPDH_Rep3_minus.R1.fq.gz ZF_NES_GAPDH_Rep3_minus.R2.fq.gz | fastq fastq | 1002124500.0 | 3340415.0 | GSM8578749 r1 | 0:150 1:150 | A:262024969;C:227163761;G:242157218;T:270761424;N:17128 | 150 | 150 | 262024969 | 227163761 | 242157218 | 270761424 | 17128 | SRX26416596 | SRS22936449 | SRA1993027 | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | B | B | biological fallback assumption | illumina | novaseq_era | full_length | random_priming | lexogen | bulk | unknown | unknown | United States | 2024-10-17 | Hatching | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||
| 33993 | 33993 | SRR31030863 | SRX26416595 | SRS22936448 | SRP539182 | PRJNA1174121 | Quantification of subcellular RNA localization through direct detection of RNA oxidation | GSE279714 | Other | Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software. | pubmed:39605352;pubmed:40037712 | ZF NES GAPDH Rep2 plus | GSM8578748 | source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF|geo loc name:missing|collection date:missing | ZF NES GAPDH Rep2 plus | OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN. | 2 dpf embryos | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium. | tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF | GSM8578748 | GSM8578748: ZF NES GAPDH Rep2 plus; Danio rerio; OTHER | GSM8578748 r1 | GSM8578748 | 1 | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | OTHER | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539182 | ZF_NES_GAPDH_Rep2_plus.R1.fq.gz ZF_NES_GAPDH_Rep2_plus.R2.fq.gz | fastq fastq | 1051565100.0 | 3505217.0 | GSM8578748 r1 | 0:150 1:150 | A:275784945;C:237523425;G:253300749;T:284937948;N:18033 | 150 | 150 | 275784945 | 237523425 | 253300749 | 284937948 | 18033 | SRX26416595 | SRS22936448 | SRA1993027 | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | B | B | biological fallback assumption | illumina | novaseq_era | full_length | random_priming | lexogen | bulk | unknown | unknown | United States | 2024-10-17 | Hatching | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||
| 33994 | 33994 | SRR31030864 | SRX26416594 | SRS22936447 | SRP539182 | PRJNA1174121 | Quantification of subcellular RNA localization through direct detection of RNA oxidation | GSE279714 | Other | Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software. | pubmed:39605352;pubmed:40037712 | ZF NES GAPDH Rep2 minus | GSM8578747 | source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF|geo loc name:missing|collection date:missing | ZF NES GAPDH Rep2 minus | OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN. | 2 dpf embryos | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium. | tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF | GSM8578747 | GSM8578747: ZF NES GAPDH Rep2 minus; Danio rerio; OTHER | GSM8578747 r1 | GSM8578747 | 1 | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | OTHER | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539182 | ZF_NES_GAPDH_Rep2_minus.R1.fq.gz ZF_NES_GAPDH_Rep2_minus.R2.fq.gz | fastq fastq | 1021837200.0 | 3406124.0 | GSM8578747 r1 | 0:150 1:150 | A:268290250;C:230525208;G:245949056;T:277056045;N:16641 | 150 | 150 | 268290250 | 230525208 | 245949056 | 277056045 | 16641 | SRX26416594 | SRS22936447 | SRA1993027 | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | B | B | biological fallback assumption | illumina | novaseq_era | full_length | random_priming | lexogen | bulk | unknown | unknown | United States | 2024-10-17 | Hatching | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||
| 33995 | 33995 | SRR31030865 | SRX26416593 | SRS22936446 | SRP539182 | PRJNA1174121 | Quantification of subcellular RNA localization through direct detection of RNA oxidation | GSE279714 | Other | Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software. | pubmed:39605352;pubmed:40037712 | ZF NES GAPDH Rep1 plus | GSM8578746 | source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF|geo loc name:missing|collection date:missing | ZF NES GAPDH Rep1 plus | OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN. | 2 dpf embryos | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium. | tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF | GSM8578746 | GSM8578746: ZF NES GAPDH Rep1 plus; Danio rerio; OTHER | GSM8578746 r1 | GSM8578746 | 1 | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | OTHER | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539182 | ZF_NES_GAPDH_Rep1_plus.R1.fq.gz ZF_NES_GAPDH_Rep1_plus.R2.fq.gz | fastq fastq | 1093620300.0 | 3645401.0 | GSM8578746 r1 | 0:150 1:150 | A:285989719;C:247805250;G:264181043;T:295625946;N:18342 | 150 | 150 | 285989719 | 247805250 | 264181043 | 295625946 | 18342 | SRX26416593 | SRS22936446 | SRA1993027 | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | B | B | biological fallback assumption | illumina | novaseq_era | full_length | random_priming | lexogen | bulk | unknown | unknown | United States | 2024-10-17 | Hatching | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||
| 33996 | 33996 | SRR31030866 | SRX26416592 | SRS22936445 | SRP539182 | PRJNA1174121 | Quantification of subcellular RNA localization through direct detection of RNA oxidation | GSE279714 | Other | Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software. | pubmed:39605352;pubmed:40037712 | ZF NES GAPDH Rep1 minus | GSM8578745 | source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF|geo loc name:missing|collection date:missing | ZF NES GAPDH Rep1 minus | OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN. | 2 dpf embryos | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium. | tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF | GSM8578745 | GSM8578745: ZF NES GAPDH Rep1 minus; Danio rerio; OTHER | GSM8578745 r1 | GSM8578745 | 1 | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | OTHER | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539182 | ZF_NES_GAPDH_Rep1_minus.R1.fq.gz ZF_NES_GAPDH_Rep1_minus.R2.fq.gz | fastq fastq | 911747100.0 | 3039157.0 | GSM8578745 r1 | 0:150 1:150 | A:239833349;C:205185786;G:218897710;T:247814511;N:15744 | 150 | 150 | 239833349 | 205185786 | 218897710 | 247814511 | 15744 | SRX26416592 | SRS22936445 | SRA1993027 | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | B | B | biological fallback assumption | illumina | novaseq_era | full_length | random_priming | lexogen | bulk | unknown | unknown | United States | 2024-10-17 | Hatching | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||
| 33997 | 33997 | SRR31030867 | SRX26416591 | SRS22936444 | SRP539182 | PRJNA1174121 | Quantification of subcellular RNA localization through direct detection of RNA oxidation | GSE279714 | Other | Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software. | pubmed:39605352;pubmed:40037712 | ZF H2B MALAT1 Rep4 plus | GSM8578744 | source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF|geo loc name:missing|collection date:missing | ZF H2B MALAT1 Rep4 plus | OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN. | 2 dpf embryos | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium. | tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF | GSM8578744 | GSM8578744: ZF H2B MALAT1 Rep4 plus; Danio rerio; OTHER | GSM8578744 r1 | GSM8578744 | 1 | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | OTHER | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539182 | ZF_H2B_MALAT1_Rep4_plus.R1.fq.gz ZF_H2B_MALAT1_Rep4_plus.R2.fq.gz | fastq fastq | 842103300.0 | 2807011.0 | GSM8578744 r1 | 0:150 1:150 | A:204870477;C:222752099;G:215404135;T:199062275;N:14314 | 150 | 150 | 204870477 | 222752099 | 215404135 | 199062275 | 14314 | SRX26416591 | SRS22936444 | SRA1993027 | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | B | B | biological fallback assumption | illumina | novaseq_era | full_length | random_priming | lexogen | bulk | unknown | unknown | United States | 2024-10-17 | Hatching | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||
| 33998 | 33998 | SRR31030868 | SRX26416590 | SRS22936442 | SRP539182 | PRJNA1174121 | Quantification of subcellular RNA localization through direct detection of RNA oxidation | GSE279714 | Other | Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software. | pubmed:39605352;pubmed:40037712 | ZF H2B MALAT1 Rep4 minus | GSM8578743 | source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF|geo loc name:missing|collection date:missing | ZF H2B MALAT1 Rep4 minus | OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN. | 2 dpf embryos | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium. | tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF | GSM8578743 | GSM8578743: ZF H2B MALAT1 Rep4 minus; Danio rerio; OTHER | GSM8578743 r1 | GSM8578743 | 1 | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | OTHER | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539182 | ZF_H2B_MALAT1_Rep4_minus.R1.fq.gz ZF_H2B_MALAT1_Rep4_minus.R2.fq.gz | fastq fastq | 1166375100.0 | 3887917.0 | GSM8578743 r1 | 0:150 1:150 | A:283781955;C:308660466;G:298298204;T:275614377;N:20098 | 150 | 150 | 283781955 | 308660466 | 298298204 | 275614377 | 20098 | SRX26416590 | SRS22936442 | SRA1993027 | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | B | B | biological fallback assumption | illumina | novaseq_era | full_length | random_priming | lexogen | bulk | unknown | unknown | United States | 2024-10-17 | Hatching | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||
| 33999 | 33999 | SRR31030869 | SRX26416589 | SRS22936443 | SRP539182 | PRJNA1174121 | Quantification of subcellular RNA localization through direct detection of RNA oxidation | GSE279714 | Other | Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software. | pubmed:39605352;pubmed:40037712 | ZF H2B MALAT1 Rep3 plus | GSM8578742 | source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF|geo loc name:missing|collection date:missing | ZF H2B MALAT1 Rep3 plus | OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN. | 2 dpf embryos | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium. | tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF | GSM8578742 | GSM8578742: ZF H2B MALAT1 Rep3 plus; Danio rerio; OTHER | GSM8578742 r1 | GSM8578742 | 1 | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | OTHER | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539182 | ZF_H2B_MALAT1_Rep3_plus.R1.fq.gz ZF_H2B_MALAT1_Rep3_plus.R2.fq.gz | fastq fastq | 1159439400.0 | 3864798.0 | GSM8578742 r1 | 0:150 1:150 | A:282055391;C:306842216;G:296569227;T:273952570;N:19996 | 150 | 150 | 282055391 | 306842216 | 296569227 | 273952570 | 19996 | SRX26416589 | SRS22936443 | SRA1993027 | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | B | B | biological fallback assumption | illumina | novaseq_era | full_length | random_priming | lexogen | bulk | unknown | unknown | United States | 2024-10-17 | Hatching | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||
| 34000 | 34000 | SRR31030870 | SRX26416588 | SRS22936440 | SRP539182 | PRJNA1174121 | Quantification of subcellular RNA localization through direct detection of RNA oxidation | GSE279714 | Other | Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software. | pubmed:39605352;pubmed:40037712 | ZF H2B MALAT1 Rep3 minus | GSM8578741 | source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF|geo loc name:missing|collection date:missing | ZF H2B MALAT1 Rep3 minus | OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN. | 2 dpf embryos | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium. | tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF | GSM8578741 | GSM8578741: ZF H2B MALAT1 Rep3 minus; Danio rerio; OTHER | GSM8578741 r1 | GSM8578741 | 1 | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | OTHER | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539182 | ZF_H2B_MALAT1_Rep3_minus.R1.fq.gz ZF_H2B_MALAT1_Rep3_minus.R2.fq.gz | fastq fastq | 1008297600.0 | 3360992.0 | GSM8578741 r1 | 0:150 1:150 | A:245277585;C:266840408;G:257911846;T:238251305;N:16456 | 150 | 150 | 245277585 | 266840408 | 257911846 | 238251305 | 16456 | SRX26416588 | SRS22936440 | SRA1993027 | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | B | B | biological fallback assumption | illumina | novaseq_era | full_length | random_priming | lexogen | bulk | unknown | unknown | United States | 2024-10-17 | Hatching | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||
| 34001 | 34001 | SRR31030871 | SRX26416587 | SRS22936441 | SRP539182 | PRJNA1174121 | Quantification of subcellular RNA localization through direct detection of RNA oxidation | GSE279714 | Other | Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software. | pubmed:39605352;pubmed:40037712 | ZF H2B MALAT1 Rep2 plus | GSM8578740 | source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF|geo loc name:missing|collection date:missing | ZF H2B MALAT1 Rep2 plus | OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN. | 2 dpf embryos | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium. | tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF | GSM8578740 | GSM8578740: ZF H2B MALAT1 Rep2 plus; Danio rerio; OTHER | GSM8578740 r1 | GSM8578740 | 1 | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | OTHER | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539182 | ZF_H2B_MALAT1_Rep2_plus.R1.fq.gz ZF_H2B_MALAT1_Rep2_plus.R2.fq.gz | fastq fastq | 1419263400.0 | 4730878.0 | GSM8578740 r1 | 0:150 1:150 | A:345302268;C:375591885;G:362956395;T:335387828;N:25024 | 150 | 150 | 345302268 | 375591885 | 362956395 | 335387828 | 25024 | SRX26416587 | SRS22936441 | SRA1993027 | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | B | B | biological fallback assumption | illumina | novaseq_era | full_length | random_priming | lexogen | bulk | unknown | unknown | United States | 2024-10-17 | Hatching | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||
| 34002 | 34002 | SRR31030872 | SRX26416586 | SRS22936439 | SRP539182 | PRJNA1174121 | Quantification of subcellular RNA localization through direct detection of RNA oxidation | GSE279714 | Other | Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software. | pubmed:39605352;pubmed:40037712 | ZF H2B MALAT1 Rep2 minus | GSM8578739 | source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF|geo loc name:missing|collection date:missing | ZF H2B MALAT1 Rep2 minus | OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN. | 2 dpf embryos | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium. | tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF | GSM8578739 | GSM8578739: ZF H2B MALAT1 Rep2 minus; Danio rerio; OTHER | GSM8578739 r1 | GSM8578739 | 1 | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | OTHER | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539182 | ZF_H2B_MALAT1_Rep2_minus.R1.fq.gz ZF_H2B_MALAT1_Rep2_minus.R2.fq.gz | fastq fastq | 1249910700.0 | 4166369.0 | GSM8578739 r1 | 0:150 1:150 | A:304074828;C:330741431;G:319677748;T:295395235;N:21458 | 150 | 150 | 304074828 | 330741431 | 319677748 | 295395235 | 21458 | SRX26416586 | SRS22936439 | SRA1993027 | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | B | B | biological fallback assumption | illumina | novaseq_era | full_length | random_priming | lexogen | bulk | unknown | unknown | United States | 2024-10-17 | Hatching | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||
| 34003 | 34003 | SRR31030873 | SRX26416585 | SRS22936438 | SRP539182 | PRJNA1174121 | Quantification of subcellular RNA localization through direct detection of RNA oxidation | GSE279714 | Other | Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software. | pubmed:39605352;pubmed:40037712 | ZF H2B MALAT1 Rep1 plus | GSM8578738 | source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF|geo loc name:missing|collection date:missing | ZF H2B MALAT1 Rep1 plus | OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN. | 2 dpf embryos | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium. | tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF | GSM8578738 | GSM8578738: ZF H2B MALAT1 Rep1 plus; Danio rerio; OTHER | GSM8578738 r1 | GSM8578738 | 1 | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | OTHER | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539182 | ZF_H2B_MALAT1_Rep1_plus.R1.fq.gz ZF_H2B_MALAT1_Rep1_plus.R2.fq.gz | fastq fastq | 1257872700.0 | 4192909.0 | GSM8578738 r1 | 0:150 1:150 | A:306022947;C:332851039;G:321699513;T:297277788;N:21413 | 150 | 150 | 306022947 | 332851039 | 321699513 | 297277788 | 21413 | SRX26416585 | SRS22936438 | SRA1993027 | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | B | B | biological fallback assumption | illumina | novaseq_era | full_length | random_priming | lexogen | bulk | unknown | unknown | United States | 2024-10-17 | Hatching | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||
| 34004 | 34004 | SRR31030874 | SRX26416584 | SRS22936437 | SRP539182 | PRJNA1174121 | Quantification of subcellular RNA localization through direct detection of RNA oxidation | GSE279714 | Other | Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software. | pubmed:39605352;pubmed:40037712 | ZF H2B MALAT1 Rep1 minus | GSM8578737 | source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF|geo loc name:missing|collection date:missing | ZF H2B MALAT1 Rep1 minus | OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN. | 2 dpf embryos | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium. | tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF | GSM8578737 | GSM8578737: ZF H2B MALAT1 Rep1 minus; Danio rerio; OTHER | GSM8578737 r1 | GSM8578737 | 1 | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | OTHER | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539182 | ZF_H2B_MALAT1_Rep1_minus.R1.fq.gz ZF_H2B_MALAT1_Rep1_minus.R2.fq.gz | fastq fastq | 1377040200.0 | 4590134.0 | GSM8578737 r1 | 0:150 1:150 | A:335021330;C:364359707;G:352178356;T:325457746;N:23061 | 150 | 150 | 335021330 | 364359707 | 352178356 | 325457746 | 23061 | SRX26416584 | SRS22936437 | SRA1993027 | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | B | B | biological fallback assumption | illumina | novaseq_era | full_length | random_priming | lexogen | bulk | unknown | unknown | United States | 2024-10-17 | Hatching | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||
| 34005 | 34005 | SRR31030875 | SRX26416583 | SRS22936435 | SRP539182 | PRJNA1174121 | Quantification of subcellular RNA localization through direct detection of RNA oxidation | GSE279714 | Other | Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software. | pubmed:39605352;pubmed:40037712 | ZF H2B GAPDH Rep4 plus | GSM8578736 | source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF|geo loc name:missing|collection date:missing | ZF H2B GAPDH Rep4 plus | OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN. | 2 dpf embryos | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium. | tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF | GSM8578736 | GSM8578736: ZF H2B GAPDH Rep4 plus; Danio rerio; OTHER | GSM8578736 r1 | GSM8578736 | 1 | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | OTHER | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539182 | ZF_H2B_GAPDH_Rep4_plus.R1.fq.gz ZF_H2B_GAPDH_Rep4_plus.R2.fq.gz | fastq fastq | 1051103100.0 | 3503677.0 | GSM8578736 r1 | 0:150 1:150 | A:274220771;C:238733668;G:254670769;T:283460283;N:17609 | 150 | 150 | 274220771 | 238733668 | 254670769 | 283460283 | 17609 | SRX26416583 | SRS22936435 | SRA1993027 | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | B | B | mate1-mate2 similar by mapping diff | illumina | novaseq_era | full_length | random_priming | lexogen | bulk | unknown | unknown | United States | 2024-10-17 | Hatching | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||
| 34006 | 34006 | SRR31030876 | SRX26416582 | SRS22936436 | SRP539182 | PRJNA1174121 | Quantification of subcellular RNA localization through direct detection of RNA oxidation | GSE279714 | Other | Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software. | pubmed:39605352;pubmed:40037712 | ZF H2B GAPDH Rep4 minus | GSM8578735 | source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF|geo loc name:missing|collection date:missing | ZF H2B GAPDH Rep4 minus | OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN. | 2 dpf embryos | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium. | tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF | GSM8578735 | GSM8578735: ZF H2B GAPDH Rep4 minus; Danio rerio; OTHER | GSM8578735 r1 | GSM8578735 | 1 | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | OTHER | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539182 | ZF_H2B_GAPDH_Rep4_minus.R1.fq.gz ZF_H2B_GAPDH_Rep4_minus.R2.fq.gz | fastq fastq | 1206485700.0 | 4021619.0 | GSM8578735 r1 | 0:150 1:150 | A:314740194;C:274101014;G:292357972;T:325267132;N:19388 | 150 | 150 | 314740194 | 274101014 | 292357972 | 325267132 | 19388 | SRX26416582 | SRS22936436 | SRA1993027 | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | B | B | mate1-mate2 similar by mapping diff | illumina | novaseq_era | full_length | random_priming | lexogen | bulk | unknown | unknown | United States | 2024-10-17 | Hatching | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||
| 34007 | 34007 | SRR31030877 | SRX26416581 | SRS22936434 | SRP539182 | PRJNA1174121 | Quantification of subcellular RNA localization through direct detection of RNA oxidation | GSE279714 | Other | Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software. | pubmed:39605352;pubmed:40037712 | ZF H2B GAPDH Rep3 plus | GSM8578734 | source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF|geo loc name:missing|collection date:missing | ZF H2B GAPDH Rep3 plus | OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN. | 2 dpf embryos | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium. | tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF | GSM8578734 | GSM8578734: ZF H2B GAPDH Rep3 plus; Danio rerio; OTHER | GSM8578734 r1 | GSM8578734 | 1 | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | OTHER | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539182 | ZF_H2B_GAPDH_Rep3_plus.R1.fq.gz ZF_H2B_GAPDH_Rep3_plus.R2.fq.gz | fastq fastq | 1140550200.0 | 3801834.0 | GSM8578734 r1 | 0:150 1:150 | A:297636297;C:258828826;G:276373993;T:307692213;N:18871 | 150 | 150 | 297636297 | 258828826 | 276373993 | 307692213 | 18871 | SRX26416581 | SRS22936434 | SRA1993027 | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | B | B | mate1-mate2 similar by mapping diff | illumina | novaseq_era | full_length | random_priming | lexogen | bulk | unknown | unknown | United States | 2024-10-17 | Hatching | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||
| 34008 | 34008 | SRR31030878 | SRX26416580 | SRS22936433 | SRP539182 | PRJNA1174121 | Quantification of subcellular RNA localization through direct detection of RNA oxidation | GSE279714 | Other | Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software. | pubmed:39605352;pubmed:40037712 | ZF H2B GAPDH Rep3 minus | GSM8578733 | source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF|geo loc name:missing|collection date:missing | ZF H2B GAPDH Rep3 minus | OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN. | 2 dpf embryos | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium. | tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF | GSM8578733 | GSM8578733: ZF H2B GAPDH Rep3 minus; Danio rerio; OTHER | GSM8578733 r1 | GSM8578733 | 1 | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | OTHER | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539182 | ZF_H2B_GAPDH_Rep3_minus.R1.fq.gz ZF_H2B_GAPDH_Rep3_minus.R2.fq.gz | fastq fastq | 782406600.0 | 2608022.0 | GSM8578733 r1 | 0:150 1:150 | A:204132316;C:177696721;G:189675433;T:210888939;N:13191 | 150 | 150 | 204132316 | 177696721 | 189675433 | 210888939 | 13191 | SRX26416580 | SRS22936433 | SRA1993027 | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | B | B | mate1-mate2 similar by mapping diff | illumina | novaseq_era | full_length | random_priming | lexogen | bulk | unknown | unknown | United States | 2024-10-17 | Hatching | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||
| 34009 | 34009 | SRR31030879 | SRX26416579 | SRS22936431 | SRP539182 | PRJNA1174121 | Quantification of subcellular RNA localization through direct detection of RNA oxidation | GSE279714 | Other | Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software. | pubmed:39605352;pubmed:40037712 | ZF H2B GAPDH Rep2 plus | GSM8578732 | source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF|geo loc name:missing|collection date:missing | ZF H2B GAPDH Rep2 plus | OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN. | 2 dpf embryos | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium. | tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF | GSM8578732 | GSM8578732: ZF H2B GAPDH Rep2 plus; Danio rerio; OTHER | GSM8578732 r1 | GSM8578732 | 1 | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | OTHER | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539182 | ZF_H2B_GAPDH_Rep2_plus.R1.fq.gz ZF_H2B_GAPDH_Rep2_plus.R2.fq.gz | fastq fastq | 958297200.0 | 3194324.0 | GSM8578732 r1 | 0:150 1:150 | A:250011335;C:217600823;G:232206339;T:258462392;N:16311 | 150 | 150 | 250011335 | 217600823 | 232206339 | 258462392 | 16311 | SRX26416579 | SRS22936431 | SRA1993027 | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | B | B | mate1-mate2 similar by mapping diff | illumina | novaseq_era | full_length | random_priming | lexogen | bulk | unknown | unknown | United States | 2024-10-17 | Hatching | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||
| 34010 | 34010 | SRR31030880 | SRX26416578 | SRS22936432 | SRP539182 | PRJNA1174121 | Quantification of subcellular RNA localization through direct detection of RNA oxidation | GSE279714 | Other | Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software. | pubmed:39605352;pubmed:40037712 | ZF H2B GAPDH Rep2 minus | GSM8578731 | source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF|geo loc name:missing|collection date:missing | ZF H2B GAPDH Rep2 minus | OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN. | 2 dpf embryos | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium. | tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF | GSM8578731 | GSM8578731: ZF H2B GAPDH Rep2 minus; Danio rerio; OTHER | GSM8578731 r1 | GSM8578731 | 1 | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | OTHER | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539182 | ZF_H2B_GAPDH_Rep2_minus.R1.fq.gz ZF_H2B_GAPDH_Rep2_minus.R2.fq.gz | fastq fastq | 1020926700.0 | 3403089.0 | GSM8578731 r1 | 0:150 1:150 | A:266429488;C:231749424;G:247353147;T:275377720;N:16921 | 150 | 150 | 266429488 | 231749424 | 247353147 | 275377720 | 16921 | SRX26416578 | SRS22936432 | SRA1993027 | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | B | B | mate1-mate2 similar by mapping diff | illumina | novaseq_era | full_length | random_priming | lexogen | bulk | unknown | unknown | United States | 2024-10-17 | Hatching | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||
| 34011 | 34011 | SRR31030881 | SRX26416577 | SRS22936430 | SRP539182 | PRJNA1174121 | Quantification of subcellular RNA localization through direct detection of RNA oxidation | GSE279714 | Other | Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software. | pubmed:39605352;pubmed:40037712 | ZF H2B GAPDH Rep1 plus | GSM8578730 | source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF|geo loc name:missing|collection date:missing | ZF H2B GAPDH Rep1 plus | OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN. | 2 dpf embryos | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium. | tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF | GSM8578730 | GSM8578730: ZF H2B GAPDH Rep1 plus; Danio rerio; OTHER | GSM8578730 r1 | GSM8578730 | 1 | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | OTHER | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539182 | ZF_H2B_GAPDH_Rep1_plus.R1.fq.gz ZF_H2B_GAPDH_Rep1_plus.R2.fq.gz | fastq fastq | 1134318600.0 | 3781062.0 | GSM8578730 r1 | 0:150 1:150 | A:295931335;C:257596481;G:274848790;T:305922827;N:19167 | 150 | 150 | 295931335 | 257596481 | 274848790 | 305922827 | 19167 | SRX26416577 | SRS22936430 | SRA1993027 | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | B | B | mate1-mate2 similar by mapping diff | illumina | novaseq_era | full_length | random_priming | lexogen | bulk | unknown | unknown | United States | 2024-10-17 | Hatching | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||
| 34012 | 34012 | SRR31030882 | SRX26416576 | SRS22936429 | SRP539182 | PRJNA1174121 | Quantification of subcellular RNA localization through direct detection of RNA oxidation | GSE279714 | Other | Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software. | pubmed:39605352;pubmed:40037712 | ZF H2B GAPDH Rep1 minus | GSM8578729 | source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF|geo loc name:missing|collection date:missing | ZF H2B GAPDH Rep1 minus | OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN. | 2 dpf embryos | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium. | tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF | GSM8578729 | GSM8578729: ZF H2B GAPDH Rep1 minus; Danio rerio; OTHER | GSM8578729 r1 | GSM8578729 | 1 | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | OTHER | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539182 | ZF_H2B_GAPDH_Rep1_minus.R1.fq.gz ZF_H2B_GAPDH_Rep1_minus.R2.fq.gz | fastq fastq | 752638800.0 | 2508796.0 | GSM8578729 r1 | 0:150 1:150 | A:196331185;C:170899863;G:182460258;T:202935049;N:12445 | 150 | 150 | 196331185 | 170899863 | 182460258 | 202935049 | 12445 | SRX26416576 | SRS22936429 | SRA1993027 | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | B | B | mate1-mate2 similar by mapping diff | illumina | novaseq_era | full_length | random_priming | lexogen | bulk | unknown | unknown | United States | 2024-10-17 | Hatching | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||
| 34013 | 34013 | SRR31031004 | SRX26416454 | SRS22936307 | SRP539182 | PRJNA1174121 | Quantification of subcellular RNA localization through direct detection of RNA oxidation | GSE279714 | Other | Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software. | pubmed:39605352;pubmed:40037712 | Zeb WT pDBF Rep3 | GSM8578770 | source name:2 dpf embryos|tissue:2 dpf embryos|genotype:wildtype|treatment:plus DBF|geo loc name:missing|collection date:missing | Zeb WT pDBF Rep3 | OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN. | 2 dpf embryos | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium. | tissue:2 dpf embryos|genotype:wildtype|treatment:plus DBF | GSM8578770 | GSM8578770: Zeb WT pDBF Rep3; Danio rerio; OTHER | GSM8578770 r1 | GSM8578770 | 1 | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | OTHER | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539182 | Zeb_WT_pDBF_Rep3.R1.fq.gz Zeb_WT_pDBF_Rep3.R2.fq.gz | fastq fastq | 23216831100.0 | 77389437.0 | GSM8578770 r1 | 0:150 1:150 | A:7577896837;C:3508911439;G:4823311862;T:7306393244;N:317718 | 150 | 150 | 7577896837 | 3508911439 | 4823311862 | 7306393244 | 317718 | SRX26416454 | SRS22936307 | SRA1993027 | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | B | B | mate2-mate1 similar by mapping diff | illumina | novaseq_era | full_length | random_priming | lexogen | bulk | unknown | unknown | United States | 2024-10-17 | Hatching | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||
| 34014 | 34014 | SRR31031005 | SRX26416453 | SRS22936305 | SRP539182 | PRJNA1174121 | Quantification of subcellular RNA localization through direct detection of RNA oxidation | GSE279714 | Other | Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software. | pubmed:39605352;pubmed:40037712 | Zeb WT pDBF Rep2 | GSM8578769 | source name:2 dpf embryos|tissue:2 dpf embryos|genotype:wildtype|treatment:plus DBF|geo loc name:missing|collection date:missing | Zeb WT pDBF Rep2 | OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN. | 2 dpf embryos | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium. | tissue:2 dpf embryos|genotype:wildtype|treatment:plus DBF | GSM8578769 | GSM8578769: Zeb WT pDBF Rep2; Danio rerio; OTHER | GSM8578769 r1 | GSM8578769 | 1 | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | OTHER | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539182 | Zeb_WT_pDBF_Rep2.R1.fq.gz Zeb_WT_pDBF_Rep2.R2.fq.gz | fastq fastq | 27237049500.0 | 90790165.0 | GSM8578769 r1 | 0:150 1:150 | A:8800724632;C:4062692793;G:5651432074;T:8721823175;N:376826 | 150 | 150 | 8800724632 | 4062692793 | 5651432074 | 8721823175 | 376826 | SRX26416453 | SRS22936305 | SRA1993027 | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | B | B | mate2-mate1 similar by mapping diff | illumina | novaseq_era | full_length | random_priming | lexogen | bulk | unknown | unknown | United States | 2024-10-17 | Hatching | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||
| 34015 | 34015 | SRR31031006 | SRX26416452 | SRS22936306 | SRP539182 | PRJNA1174121 | Quantification of subcellular RNA localization through direct detection of RNA oxidation | GSE279714 | Other | Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software. | pubmed:39605352;pubmed:40037712 | Zeb WT pDBF Rep1 | GSM8578768 | source name:2 dpf embryos|tissue:2 dpf embryos|genotype:wildtype|treatment:plus DBF|geo loc name:missing|collection date:missing | Zeb WT pDBF Rep1 | OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN. | 2 dpf embryos | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium. | tissue:2 dpf embryos|genotype:wildtype|treatment:plus DBF | GSM8578768 | GSM8578768: Zeb WT pDBF Rep1; Danio rerio; OTHER | GSM8578768 r1 | GSM8578768 | 1 | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | OTHER | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539182 | Zeb_WT_pDBF_Rep1.R1.fq.gz Zeb_WT_pDBF_Rep1.R2.fq.gz | fastq fastq | 22364115300.0 | 74547051.0 | GSM8578768 r1 | 0:150 1:150 | A:7336106577;C:3346831944;G:4451536371;T:7229335436;N:304972 | 150 | 150 | 7336106577 | 3346831944 | 4451536371 | 7229335436 | 304972 | SRX26416452 | SRS22936306 | SRA1993027 | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | B | B | mate2-mate1 similar by mapping diff | illumina | novaseq_era | full_length | random_priming | lexogen | bulk | unknown | unknown | United States | 2024-10-17 | Hatching | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||
| 34016 | 34016 | SRR31031007 | SRX26416451 | SRS22936304 | SRP539182 | PRJNA1174121 | Quantification of subcellular RNA localization through direct detection of RNA oxidation | GSE279714 | Other | Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software. | pubmed:39605352;pubmed:40037712 | Zeb WT mDBF Rep3 | GSM8578767 | source name:2 dpf embryos|tissue:2 dpf embryos|genotype:wildtype|treatment:minus DBF|geo loc name:missing|collection date:missing | Zeb WT mDBF Rep3 | OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN. | 2 dpf embryos | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium. | tissue:2 dpf embryos|genotype:wildtype|treatment:minus DBF | GSM8578767 | GSM8578767: Zeb WT mDBF Rep3; Danio rerio; OTHER | GSM8578767 r1 | GSM8578767 | 1 | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | OTHER | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539182 | Zeb_WT_mDBF_Rep3.R1.fq.gz Zeb_WT_mDBF_Rep3.R2.fq.gz | fastq fastq | 20112719100.0 | 67042397.0 | GSM8578767 r1 | 0:150 1:150 | A:6537370232;C:2924919118;G:3973928235;T:6676228153;N:273362 | 150 | 150 | 6537370232 | 2924919118 | 3973928235 | 6676228153 | 273362 | SRX26416451 | SRS22936304 | SRA1993027 | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | B | B | mate2-mate1 similar by mapping diff | illumina | novaseq_era | full_length | random_priming | lexogen | bulk | unknown | unknown | United States | 2024-10-17 | Hatching | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||
| 34017 | 34017 | SRR31031008 | SRX26416450 | SRS22936303 | SRP539182 | PRJNA1174121 | Quantification of subcellular RNA localization through direct detection of RNA oxidation | GSE279714 | Other | Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software. | pubmed:39605352;pubmed:40037712 | Zeb WT mDBF Rep2 | GSM8578766 | source name:2 dpf embryos|tissue:2 dpf embryos|genotype:wildtype|treatment:minus DBF|geo loc name:missing|collection date:missing | Zeb WT mDBF Rep2 | OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN. | 2 dpf embryos | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium. | tissue:2 dpf embryos|genotype:wildtype|treatment:minus DBF | GSM8578766 | GSM8578766: Zeb WT mDBF Rep2; Danio rerio; OTHER | GSM8578766 r1 | GSM8578766 | 1 | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | OTHER | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539182 | Zeb_WT_mDBF_Rep2.R1.fq.gz Zeb_WT_mDBF_Rep2.R2.fq.gz | fastq fastq | 24839552100.0 | 82798507.0 | GSM8578766 r1 | 0:150 1:150 | A:8176074473;C:3715794630;G:4984816273;T:7962528150;N:338574 | 150 | 150 | 8176074473 | 3715794630 | 4984816273 | 7962528150 | 338574 | SRX26416450 | SRS22936303 | SRA1993027 | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | B | B | mate2-mate1 similar by mapping diff | illumina | novaseq_era | full_length | random_priming | lexogen | bulk | unknown | unknown | United States | 2024-10-17 | Hatching | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||
| 34018 | 34018 | SRR31031009 | SRX26416449 | SRS22936302 | SRP539182 | PRJNA1174121 | Quantification of subcellular RNA localization through direct detection of RNA oxidation | GSE279714 | Other | Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software. | pubmed:39605352;pubmed:40037712 | Zeb WT mDBF Rep1 | GSM8578765 | source name:2 dpf embryos|tissue:2 dpf embryos|genotype:wildtype|treatment:minus DBF|geo loc name:missing|collection date:missing | Zeb WT mDBF Rep1 | OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN. | 2 dpf embryos | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium. | tissue:2 dpf embryos|genotype:wildtype|treatment:minus DBF | GSM8578765 | GSM8578765: Zeb WT mDBF Rep1; Danio rerio; OTHER | GSM8578765 r1 | GSM8578765 | 1 | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | OTHER | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539182 | Zeb_WT_mDBF_Rep1.R1.fq.gz Zeb_WT_mDBF_Rep1.R2.fq.gz | fastq fastq | 23029785600.0 | 76765952.0 | GSM8578765 r1 | 0:150 1:150 | A:7509388471;C:3438475939;G:4820328116;T:7261277960;N:315114 | 150 | 150 | 7509388471 | 3438475939 | 4820328116 | 7261277960 | 315114 | SRX26416449 | SRS22936302 | SRA1993027 | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | B | B | mate2-mate1 similar by mapping diff | illumina | novaseq_era | full_length | random_priming | lexogen | bulk | unknown | unknown | United States | 2024-10-17 | Hatching | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||
| 34019 | 34019 | SRR31031010 | SRX26416448 | SRS22936301 | SRP539182 | PRJNA1174121 | Quantification of subcellular RNA localization through direct detection of RNA oxidation | GSE279714 | Other | Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software. | pubmed:39605352;pubmed:40037712 | Zeb NES pDBF Rep2 | GSM8578764 | source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF|geo loc name:missing|collection date:missing | Zeb NES pDBF Rep2 | OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN. | 2 dpf embryos | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium. | tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF | GSM8578764 | GSM8578764: Zeb NES pDBF Rep2; Danio rerio; OTHER | GSM8578764 r1 | GSM8578764 | 1 | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | OTHER | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539182 | Zeb_NES_pDBF_Rep2.R1.fq.gz Zeb_NES_pDBF_Rep2.R2.fq.gz | fastq fastq | 25465584900.0 | 84885283.0 | GSM8578764 r1 | 0:150 1:150 | A:7944190976;C:4330095891;G:5473069331;T:7718120992;N:107710 | 150 | 150 | 7944190976 | 4330095891 | 5473069331 | 7718120992 | 107710 | SRX26416448 | SRS22936301 | SRA1993027 | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | B | B | mate2-mate1 similar by mapping diff | illumina | novaseq_era | full_length | random_priming | lexogen | bulk | unknown | unknown | United States | 2024-10-17 | Hatching | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||
| 34020 | 34020 | SRR31031011 | SRX26416447 | SRS22936300 | SRP539182 | PRJNA1174121 | Quantification of subcellular RNA localization through direct detection of RNA oxidation | GSE279714 | Other | Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software. | pubmed:39605352;pubmed:40037712 | Zeb NES pDBF Rep1 | GSM8578763 | source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF|geo loc name:missing|collection date:missing | Zeb NES pDBF Rep1 | OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN. | 2 dpf embryos | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium. | tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF | GSM8578763 | GSM8578763: Zeb NES pDBF Rep1; Danio rerio; OTHER | GSM8578763 r1 | GSM8578763 | 1 | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | OTHER | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539182 | Zeb_NES_pDBF_Rep1.R1.fq.gz Zeb_NES_pDBF_Rep1.R2.fq.gz | fastq fastq | 21107351400.0 | 70357838.0 | GSM8578763 r1 | 0:150 1:150 | A:6528579219;C:3620666961;G:4496642830;T:6461373643;N:88747 | 150 | 150 | 6528579219 | 3620666961 | 4496642830 | 6461373643 | 88747 | SRX26416447 | SRS22936300 | SRA1993027 | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | B | B | mate2-mate1 similar by mapping diff | illumina | novaseq_era | full_length | random_priming | lexogen | bulk | unknown | unknown | United States | 2024-10-17 | Hatching | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||
| 34021 | 34021 | SRR31031012 | SRX26416446 | SRS22936299 | SRP539182 | PRJNA1174121 | Quantification of subcellular RNA localization through direct detection of RNA oxidation | GSE279714 | Other | Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software. | pubmed:39605352;pubmed:40037712 | Zeb NES mDBF Rep2 | GSM8578762 | source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF|geo loc name:missing|collection date:missing | Zeb NES mDBF Rep2 | OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN. | 2 dpf embryos | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium. | tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF | GSM8578762 | GSM8578762: Zeb NES mDBF Rep2; Danio rerio; OTHER | GSM8578762 r1 | GSM8578762 | 1 | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | OTHER | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539182 | Zeb_NES_mDBF_Rep2.R1.fq.gz Zeb_NES_mDBF_Rep2.R2.fq.gz | fastq fastq | 21542967300.0 | 71809891.0 | GSM8578762 r1 | 0:150 1:150 | A:6722613760;C:3654507931;G:4628076548;T:6537678084;N:90977 | 150 | 150 | 6722613760 | 3654507931 | 4628076548 | 6537678084 | 90977 | SRX26416446 | SRS22936299 | SRA1993027 | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | B | B | mate2-mate1 similar by mapping diff | illumina | novaseq_era | full_length | random_priming | lexogen | bulk | unknown | unknown | United States | 2024-10-17 | Hatching | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||
| 34022 | 34022 | SRR31031013 | SRX26416445 | SRS22936297 | SRP539182 | PRJNA1174121 | Quantification of subcellular RNA localization through direct detection of RNA oxidation | GSE279714 | Other | Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software. | pubmed:39605352;pubmed:40037712 | Zeb NES mDBF Rep1 | GSM8578761 | source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF|geo loc name:missing|collection date:missing | Zeb NES mDBF Rep1 | OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN. | 2 dpf embryos | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium. | tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF | GSM8578761 | GSM8578761: Zeb NES mDBF Rep1; Danio rerio; OTHER | GSM8578761 r1 | GSM8578761 | 1 | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | OTHER | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539182 | Zeb_NES_mDBF_Rep1.R1.fq.gz Zeb_NES_mDBF_Rep1.R2.fq.gz | fastq fastq | 23038870800.0 | 76796236.0 | GSM8578761 r1 | 0:150 1:150 | A:7216059153;C:3815899397;G:4909028200;T:7097787584;N:96466 | 150 | 150 | 7216059153 | 3815899397 | 4909028200 | 7097787584 | 96466 | SRX26416445 | SRS22936297 | SRA1993027 | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | B | B | mate2-mate1 similar by mapping diff | illumina | novaseq_era | full_length | random_priming | lexogen | bulk | unknown | unknown | United States | 2024-10-17 | Hatching | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||
| 34023 | 34023 | SRR31031014 | SRX26416444 | SRS22936298 | SRP539182 | PRJNA1174121 | Quantification of subcellular RNA localization through direct detection of RNA oxidation | GSE279714 | Other | Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software. | pubmed:39605352;pubmed:40037712 | ZF NES MALAT1 Rep4 plus | GSM8578760 | source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF|geo loc name:missing|collection date:missing | ZF NES MALAT1 Rep4 plus | OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN. | 2 dpf embryos | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium. | tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF | GSM8578760 | GSM8578760: ZF NES MALAT1 Rep4 plus; Danio rerio; OTHER | GSM8578760 r1 | GSM8578760 | 1 | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | OTHER | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539182 | ZF_NES_MALAT1_Rep4_plus.R1.fq.gz ZF_NES_MALAT1_Rep4_plus.R2.fq.gz | fastq fastq | 1091293200.0 | 3637644.0 | GSM8578760 r1 | 0:150 1:150 | A:265519561;C:288647650;G:279105515;T:258001510;N:18964 | 150 | 150 | 265519561 | 288647650 | 279105515 | 258001510 | 18964 | SRX26416444 | SRS22936298 | SRA1993027 | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | B | B | biological fallback assumption | illumina | novaseq_era | full_length | random_priming | lexogen | bulk | unknown | unknown | United States | 2024-10-17 | Hatching | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||
| 34024 | 34024 | SRR31031015 | SRX26416443 | SRS22936296 | SRP539182 | PRJNA1174121 | Quantification of subcellular RNA localization through direct detection of RNA oxidation | GSE279714 | Other | Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software. | pubmed:39605352;pubmed:40037712 | ZF NES MALAT1 Rep4 minus | GSM8578759 | source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF|geo loc name:missing|collection date:missing | ZF NES MALAT1 Rep4 minus | OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN. | 2 dpf embryos | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium. | tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF | GSM8578759 | GSM8578759: ZF NES MALAT1 Rep4 minus; Danio rerio; OTHER | GSM8578759 r1 | GSM8578759 | 1 | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | OTHER | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539182 | ZF_NES_MALAT1_Rep4_minus.R1.fq.gz ZF_NES_MALAT1_Rep4_minus.R2.fq.gz | fastq fastq | 1395963600.0 | 4653212.0 | GSM8578759 r1 | 0:150 1:150 | A:339654289;C:369433701;G:356957685;T:329893853;N:24072 | 150 | 150 | 339654289 | 369433701 | 356957685 | 329893853 | 24072 | SRX26416443 | SRS22936296 | SRA1993027 | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | B | B | biological fallback assumption | illumina | novaseq_era | full_length | random_priming | lexogen | bulk | unknown | unknown | United States | 2024-10-17 | Hatching | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||
| 34025 | 34025 | SRR31031016 | SRX26416442 | SRS22936295 | SRP539182 | PRJNA1174121 | Quantification of subcellular RNA localization through direct detection of RNA oxidation | GSE279714 | Other | Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software. | pubmed:39605352;pubmed:40037712 | ZF NES MALAT1 Rep3 plus | GSM8578758 | source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF|geo loc name:missing|collection date:missing | ZF NES MALAT1 Rep3 plus | OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN. | 2 dpf embryos | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium. | tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF | GSM8578758 | GSM8578758: ZF NES MALAT1 Rep3 plus; Danio rerio; OTHER | GSM8578758 r1 | GSM8578758 | 1 | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | OTHER | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539182 | ZF_NES_MALAT1_Rep3_plus.R1.fq.gz ZF_NES_MALAT1_Rep3_plus.R2.fq.gz | fastq fastq | 1556195100.0 | 5187317.0 | GSM8578758 r1 | 0:150 1:150 | A:378553535;C:411730281;G:398086882;T:367797563;N:26839 | 150 | 150 | 378553535 | 411730281 | 398086882 | 367797563 | 26839 | SRX26416442 | SRS22936295 | SRA1993027 | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | B | B | biological fallback assumption | illumina | novaseq_era | full_length | random_priming | lexogen | bulk | unknown | unknown | United States | 2024-10-17 | Hatching | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||
| 34026 | 34026 | SRR31031017 | SRX26416441 | SRS22936294 | SRP539182 | PRJNA1174121 | Quantification of subcellular RNA localization through direct detection of RNA oxidation | GSE279714 | Other | Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software. | pubmed:39605352;pubmed:40037712 | ZF NES MALAT1 Rep3 minus | GSM8578757 | source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF|geo loc name:missing|collection date:missing | ZF NES MALAT1 Rep3 minus | OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN. | 2 dpf embryos | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium. | tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF | GSM8578757 | GSM8578757: ZF NES MALAT1 Rep3 minus; Danio rerio; OTHER | GSM8578757 r1 | GSM8578757 | 1 | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | OTHER | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539182 | ZF_NES_MALAT1_Rep3_minus.R1.fq.gz ZF_NES_MALAT1_Rep3_minus.R2.fq.gz | fastq fastq | 1511328900.0 | 5037763.0 | GSM8578757 r1 | 0:150 1:150 | A:367639521;C:400036694;G:386523395;T:357103340;N:25950 | 150 | 150 | 367639521 | 400036694 | 386523395 | 357103340 | 25950 | SRX26416441 | SRS22936294 | SRA1993027 | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | B | B | biological fallback assumption | illumina | novaseq_era | full_length | random_priming | lexogen | bulk | unknown | unknown | United States | 2024-10-17 | Hatching | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||
| 34027 | 34027 | SRR31031018 | SRX26416440 | SRS22936293 | SRP539182 | PRJNA1174121 | Quantification of subcellular RNA localization through direct detection of RNA oxidation | GSE279714 | Other | Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software. | pubmed:39605352;pubmed:40037712 | ZF NES MALAT1 Rep2 plus | GSM8578756 | source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF|geo loc name:missing|collection date:missing | ZF NES MALAT1 Rep2 plus | OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN. | 2 dpf embryos | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium. | tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF | GSM8578756 | GSM8578756: ZF NES MALAT1 Rep2 plus; Danio rerio; OTHER | GSM8578756 r1 | GSM8578756 | 1 | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | OTHER | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539182 | ZF_NES_MALAT1_Rep2_plus.R1.fq.gz ZF_NES_MALAT1_Rep2_plus.R2.fq.gz | fastq fastq | 1451137800.0 | 4837126.0 | GSM8578756 r1 | 0:150 1:150 | A:353052445;C:383981771;G:371154128;T:342925275;N:24181 | 150 | 150 | 353052445 | 383981771 | 371154128 | 342925275 | 24181 | SRX26416440 | SRS22936293 | SRA1993027 | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | B | B | biological fallback assumption | illumina | novaseq_era | full_length | random_priming | lexogen | bulk | unknown | unknown | United States | 2024-10-17 | Hatching | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||
| 34028 | 34028 | SRR31031019 | SRX26416439 | SRS22936292 | SRP539182 | PRJNA1174121 | Quantification of subcellular RNA localization through direct detection of RNA oxidation | GSE279714 | Other | Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software. | pubmed:39605352;pubmed:40037712 | ZF NES MALAT1 Rep2 minus | GSM8578755 | source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF|geo loc name:missing|collection date:missing | ZF NES MALAT1 Rep2 minus | OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN. | 2 dpf embryos | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium. | tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF | GSM8578755 | GSM8578755: ZF NES MALAT1 Rep2 minus; Danio rerio; OTHER | GSM8578755 r1 | GSM8578755 | 1 | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | OTHER | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539182 | ZF_NES_MALAT1_Rep2_minus.R1.fq.gz ZF_NES_MALAT1_Rep2_minus.R2.fq.gz | fastq fastq | 1286489400.0 | 4288298.0 | GSM8578755 r1 | 0:150 1:150 | A:312986127;C:340482608;G:329001591;T:303997982;N:21092 | 150 | 150 | 312986127 | 340482608 | 329001591 | 303997982 | 21092 | SRX26416439 | SRS22936292 | SRA1993027 | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | B | B | biological fallback assumption | illumina | novaseq_era | full_length | random_priming | lexogen | bulk | unknown | unknown | United States | 2024-10-17 | Hatching | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||
| 34029 | 34029 | SRR31031020 | SRX26416438 | SRS22936291 | SRP539182 | PRJNA1174121 | Quantification of subcellular RNA localization through direct detection of RNA oxidation | GSE279714 | Other | Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software. | pubmed:39605352;pubmed:40037712 | ZF NES MALAT1 Rep1 plus | GSM8578754 | source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF|geo loc name:missing|collection date:missing | ZF NES MALAT1 Rep1 plus | OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN. | 2 dpf embryos | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium. | tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF | GSM8578754 | GSM8578754: ZF NES MALAT1 Rep1 plus; Danio rerio; OTHER | GSM8578754 r1 | GSM8578754 | 1 | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | OTHER | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539182 | ZF_NES_MALAT1_Rep1_plus.R1.fq.gz ZF_NES_MALAT1_Rep1_plus.R2.fq.gz | fastq fastq | 1146380100.0 | 3821267.0 | GSM8578754 r1 | 0:150 1:150 | A:278826422;C:303464534;G:293239572;T:270830265;N:19307 | 150 | 150 | 278826422 | 303464534 | 293239572 | 270830265 | 19307 | SRX26416438 | SRS22936291 | SRA1993027 | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | B | B | biological fallback assumption | illumina | novaseq_era | full_length | random_priming | lexogen | bulk | unknown | unknown | United States | 2024-10-17 | Hatching | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||
| 34030 | 34030 | SRR31031021 | SRX26416437 | SRS22936289 | SRP539182 | PRJNA1174121 | Quantification of subcellular RNA localization through direct detection of RNA oxidation | GSE279714 | Other | Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software. | pubmed:39605352;pubmed:40037712 | ZF NES MALAT1 Rep1 minus | GSM8578753 | source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF|geo loc name:missing|collection date:missing | ZF NES MALAT1 Rep1 minus | OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN. | 2 dpf embryos | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium. | tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF | GSM8578753 | GSM8578753: ZF NES MALAT1 Rep1 minus; Danio rerio; OTHER | GSM8578753 r1 | GSM8578753 | 1 | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | OTHER | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539182 | ZF_NES_MALAT1_Rep1_minus.R1.fq.gz ZF_NES_MALAT1_Rep1_minus.R2.fq.gz | fastq fastq | 1149087000.0 | 3830290.0 | GSM8578753 r1 | 0:150 1:150 | A:279487473;C:304130198;G:293947979;T:271501018;N:20332 | 150 | 150 | 279487473 | 304130198 | 293947979 | 271501018 | 20332 | SRX26416437 | SRS22936289 | SRA1993027 | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | B | B | biological fallback assumption | illumina | novaseq_era | full_length | random_priming | lexogen | bulk | unknown | unknown | United States | 2024-10-17 | Hatching | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||
| 34031 | 34031 | SRR31031022 | SRX26416436 | SRS22936290 | SRP539182 | PRJNA1174121 | Quantification of subcellular RNA localization through direct detection of RNA oxidation | GSE279714 | Other | Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software. | pubmed:39605352;pubmed:40037712 | ZF NES GAPDH Rep4 plus | GSM8578752 | source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF|geo loc name:missing|collection date:missing | ZF NES GAPDH Rep4 plus | OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN. | 2 dpf embryos | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium. | tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF | GSM8578752 | GSM8578752: ZF NES GAPDH Rep4 plus; Danio rerio; OTHER | GSM8578752 r1 | GSM8578752 | 1 | RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits. | OTHER | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP539182 | ZF_NES_GAPDH_Rep4_plus.R1.fq.gz ZF_NES_GAPDH_Rep4_plus.R2.fq.gz | fastq fastq | 1010253300.0 | 3367511.0 | GSM8578752 r1 | 0:150 1:150 | A:264284161;C:228880831;G:244038984;T:273032130;N:17194 | 150 | 150 | 264284161 | 228880831 | 244038984 | 273032130 | 17194 | SRX26416436 | SRS22936290 | SRA1993027 | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus | B | B | biological fallback assumption | illumina | novaseq_era | full_length | random_priming | lexogen | bulk | unknown | unknown | United States | 2024-10-17 | Hatching | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||
| 36265 | 36265 | SRR058073 | SRX022206 | SRS084221 | SRP002640 | PRJNA128943 | Expanding the MicroRNA Targeting Code: A Novel Type of Site with Centered Pairing | GSE22068 | Other | We present “centered sites ” a class of microRNA target sites that lacks both perfect seed pairing and three prime compensatory pairing and instead has 11–12 contiguous Watson–Crick pairs to the center of the microRNA. In elevated Mg2+ centered sites impart mRNA cleavage but in cells centered sites repress protein output without xxx Agronaute catalyzed cleavage. Our study also identified novel extensively paired sites that are cleavage substrates in cultured cells and human brain. This expanded repertoire of cleavage targets and the identification of the centered site type help explain why central regions of many microRNAs are evolutionarily conserved. Overall design: To study centered sites and identify miRNA cleavage targets mRNA degradomes were sequenced from human brain and HeLa cells and smallRNAs were sequenced from human brain and zebrafish embryo at 24 hpf. Replicates were combined before the analysis. Fastq files are not available for GSM548638 and GSM548639. | pubmed:20620952 | Zebrafish Embryo small RNAs | GSM548640 | source name:Embryo Cells|data type:small RNAs|tissue:embryo | Zebrafish Embryo small RNAs | Small RNA sequences from same total RNA samples were mapped to the human genome hg18 requiring a perfect match and reads co localizing to annotated miRNA loci miRBase version 11.0 were counted. sequence reads are summarized as frequency counts | Embryo Cells | The small RNA cDNA libraries were made as described Grimson et al. 2008 except for the three prime adaptor ligation which was five prime adenylated pTCGTATGCCGTCTTCTGCTTGidT. For a detailed protocol see http://web.wi.mit.edu/bartel/pub/protocols.html. | data type:small RNAs|tissue:embryo | GSM548640 | GSM548640: Zebrafish Embryo small RNAs | GSM548640: Zebrafish Embryo small RNAs | GSM548640: Zebrafish Embryo small RNAs | 1 | GEO Accession:GSM548640 | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina Genome Analyzer | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP002640 | quality book char:@|quality scoring system:log odds | Zebrafish_embryo_24h.fastq | fastq | 62213148.0 | 1728143.0 | GSM548640 1 | 0:36 | A:13550515;C:14269249;G:15670049;T:18673533;N:49802 | 36 | 13550515 | 14269249 | 15670049 | 18673533 | 49802 | SRX022206 | SRS084221 | SRA020539 | GEO | Bartel lab, Whitehead Institute | 1 | 0.02298 | 0.02186 | 0.9988 | 0.3246 | 36 | B | usable mapping rate | illumina | early_illumina | unknown | small_rna | unknown | bulk | unknown | unknown | United States | 2010-06-01 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 40214 | 40214 | SRR2982513 | SRX1471725 | SRS1197481 | SRP067139 | PRJNA305418 | RiboZero mRNA seq across zebrafish development for study of uORFs | PRJNA305418 | Other | Untranslated mRNA regionsUTRs are key mediators of post transcriptional regulation. Previous studies have predicted thousands of ORFs in five prime'UTRs the vast majority of which have unknown function. We present a systematic analysis of the translation and function of upstream open reading framesuORFs across vertebrates. Combining high resolution ribosome footprinting and phasing we find that i uORFs are pervasive within vertebrate transcriptomes ii the majority show signatures of active translation and iii uORFs act as potent regulators of translation and RNA levels with a similar magnitude to miRNAs. Evolution has targeted sequence features to mitigate the effects of constitutively repressive uORFs. Finally we observe that the regulatory potential of uORFs on individual genes is conserved across species. These results provide insight into the regulatory code within mRNA leader sequences and their capacity to modulate translation across vertebrates.The mRNA seq data contained in this archive were used along with ribosome profiling data to calculate translation efficiency values. | 48hpf | AG00751 mrna r0 48h | strain:TUAB|age:48hpf|sex:pooled male and female|tissue:embryo|genotype:wt|BioSampleModel:Model organism or animal | AG00751 mrna r0 48h | 48h mRNA R0 | 1 | Twenty embryos per condition were collected from the same clutch from where the ribosome profiling timeseries was conducted.Bazzini et al 2014 Total RNA was isolated using 1mL of Trizol following manufacturer instructions. Ribosomal RNAs were depleted using Ribo Zero Epicentre/Illumina. Strand specific single end library was constructed according to the Illumina Sample Preparation Kit protocol using standard TruSeq adapters Libraries were prepared and sequenced in an Illumina Hi SEQ single end 75nt reads | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>75</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP067139 | AG00751_SEQ0112_R1.fastq.gz | fastq | 1859082512.0 | 24461612.0 | 48h mRNA R0 run1 | 0:76 | A:488142494;C:422062452;G:411293722;T:537489879;N:93965 | 76 | 488142494 | 422062452 | 411293722 | 537489879 | 93965 | SRX1471725 | SRS1197481 | SRA314809 | Yale University|Giraldez Lab | Yale University | 1 | 0.8583 | 0.37297 | 0.6956 | 0.46541 | 76 | B | usable mapping rate | illumina | hiseq_era | unknown | rrna_depletion | trueseq | bulk | unknown | unknown | United States | 2015-12-08 | Hatching | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||
| 40215 | 40215 | SRR2982514 | SRX1471724 | SRS1197482 | SRP067139 | PRJNA305418 | RiboZero mRNA seq across zebrafish development for study of uORFs | PRJNA305418 | Other | Untranslated mRNA regionsUTRs are key mediators of post transcriptional regulation. Previous studies have predicted thousands of ORFs in five prime'UTRs the vast majority of which have unknown function. We present a systematic analysis of the translation and function of upstream open reading framesuORFs across vertebrates. Combining high resolution ribosome footprinting and phasing we find that i uORFs are pervasive within vertebrate transcriptomes ii the majority show signatures of active translation and iii uORFs act as potent regulators of translation and RNA levels with a similar magnitude to miRNAs. Evolution has targeted sequence features to mitigate the effects of constitutively repressive uORFs. Finally we observe that the regulatory potential of uORFs on individual genes is conserved across species. These results provide insight into the regulatory code within mRNA leader sequences and their capacity to modulate translation across vertebrates.The mRNA seq data contained in this archive were used along with ribosome profiling data to calculate translation efficiency values. | 24hpf | AG00750 mrna r0 24h | strain:TUAB|age:24hpf|sex:pooled male and female|tissue:embryo|genotype:wt|BioSampleModel:Model organism or animal | AG00750 mrna r0 24h | 24h mRNA R0 | 1 | Twenty embryos per condition were collected from the same clutch from where the ribosome profiling timeseries was conducted.Bazzini et al 2014 Total RNA was isolated using 1mL of Trizol following manufacturer instructions. Ribosomal RNAs were depleted using Ribo Zero Epicentre/Illumina. Strand specific single end library was constructed according to the Illumina Sample Preparation Kit protocol using standard TruSeq adapters Libraries were prepared and sequenced in an Illumina Hi SEQ single end 75nt reads | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>75</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP067139 | AG00750_SEQ0114_R1.fastq.gz | fastq | 2124277824.0 | 27951024.0 | 24h mRNA R0 run1 | 0:76 | A:537946274;C:496576029;G:477023623;T:612576823;N:155075 | 76 | 537946274 | 496576029 | 477023623 | 612576823 | 155075 | SRX1471724 | SRS1197482 | SRA314809 | Yale University|Giraldez Lab | Yale University | 1 | 0.86054 | 0.27207 | 0.69877 | 0.47063 | 76 | B | usable mapping rate | illumina | hiseq_era | unknown | rrna_depletion | trueseq | bulk | unknown | unknown | United States | 2015-12-08 | Pharyngula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||
| 40216 | 40216 | SRR2982511 | SRX1471723 | SRS1197479 | SRP067139 | PRJNA305418 | RiboZero mRNA seq across zebrafish development for study of uORFs | PRJNA305418 | Other | Untranslated mRNA regionsUTRs are key mediators of post transcriptional regulation. Previous studies have predicted thousands of ORFs in five prime'UTRs the vast majority of which have unknown function. We present a systematic analysis of the translation and function of upstream open reading framesuORFs across vertebrates. Combining high resolution ribosome footprinting and phasing we find that i uORFs are pervasive within vertebrate transcriptomes ii the majority show signatures of active translation and iii uORFs act as potent regulators of translation and RNA levels with a similar magnitude to miRNAs. Evolution has targeted sequence features to mitigate the effects of constitutively repressive uORFs. Finally we observe that the regulatory potential of uORFs on individual genes is conserved across species. These results provide insight into the regulatory code within mRNA leader sequences and their capacity to modulate translation across vertebrates.The mRNA seq data contained in this archive were used along with ribosome profiling data to calculate translation efficiency values. | 12hpf | AG00434 mrna r0 12h | strain:TUAB|age:12hpf|sex:pooled male and female|tissue:embryo|genotype:wt|BioSampleModel:Model organism or animal | AG00434 mrna r0 12h | 12h mRNA R0 | 1 | Twenty embryos per condition were collected from the same clutch from where the ribosome profiling timeseries was conducted.Bazzini et al 2014 Total RNA was isolated using 1mL of Trizol following manufacturer instructions. Ribosomal RNAs were depleted using Ribo Zero Epicentre/Illumina. Strand specific single end library was constructed according to the Illumina Sample Preparation Kit protocol using standard TruSeq adapters Libraries were prepared and sequenced in an Illumina Hi SEQ single end 75nt reads | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>75</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP067139 | AG00434_SEQ0071_R1.fastq.gz | fastq | 1990422368.0 | 26189768.0 | 12h mRNA R0 run1 | 0:76 | A:512242204;C:469314942;G:452176134;T:556618667;N:70421 | 76 | 512242204 | 469314942 | 452176134 | 556618667 | 70421 | SRX1471723 | SRS1197479 | SRA314809 | Yale University|Giraldez Lab | Yale University | 1 | 0.88085 | 0.297 | 0.71711 | 0.46053 | 76 | B | usable mapping rate | illumina | hiseq_era | unknown | rrna_depletion | trueseq | bulk | unknown | unknown | United States | 2015-12-08 | Segmentation | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||
| 40217 | 40217 | SRR2982512 | SRX1471722 | SRS1197480 | SRP067139 | PRJNA305418 | RiboZero mRNA seq across zebrafish development for study of uORFs | PRJNA305418 | Other | Untranslated mRNA regionsUTRs are key mediators of post transcriptional regulation. Previous studies have predicted thousands of ORFs in five prime'UTRs the vast majority of which have unknown function. We present a systematic analysis of the translation and function of upstream open reading framesuORFs across vertebrates. Combining high resolution ribosome footprinting and phasing we find that i uORFs are pervasive within vertebrate transcriptomes ii the majority show signatures of active translation and iii uORFs act as potent regulators of translation and RNA levels with a similar magnitude to miRNAs. Evolution has targeted sequence features to mitigate the effects of constitutively repressive uORFs. Finally we observe that the regulatory potential of uORFs on individual genes is conserved across species. These results provide insight into the regulatory code within mRNA leader sequences and their capacity to modulate translation across vertebrates.The mRNA seq data contained in this archive were used along with ribosome profiling data to calculate translation efficiency values. | 5hpf | AG00749 mrna r0 5h | strain:TUAB|age:5hpf|sex:pooled male and female|tissue:embryo|genotype:wt|BioSampleModel:Model organism or animal | AG00749 mrna r0 5h | 5h mRNA R0 | 1 | Twenty embryos per condition were collected from the same clutch from where the ribosome profiling timeseries was conducted.Bazzini et al 2014 Total RNA was isolated using 1mL of Trizol following manufacturer instructions. Ribosomal RNAs were depleted using Ribo Zero Epicentre/Illumina. Strand specific single end library was constructed according to the Illumina Sample Preparation Kit protocol using standard TruSeq adapters Libraries were prepared and sequenced in an Illumina Hi SEQ single end 75nt reads | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>75</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP067139 | AG00749_SEQ0114_R1.fastq.gz | fastq | 3163721996.0 | 41627921.0 | 5h mRNA R0 run1 | 0:76 | A:724093110;C:806620205;G:798759186;T:834042462;N:207033 | 76 | 724093110 | 806620205 | 798759186 | 834042462 | 207033 | SRX1471722 | SRS1197480 | SRA314809 | Yale University|Giraldez Lab | Yale University | 1 | 0.75274 | 0.23572 | 0.75448 | 0.47885 | 76 | B | usable mapping rate | illumina | hiseq_era | unknown | rrna_depletion | trueseq | bulk | unknown | unknown | United States | 2015-12-08 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||
| 40218 | 40218 | SRR2982510 | SRX1471511 | SRS1197399 | SRP067139 | PRJNA305418 | RiboZero mRNA seq across zebrafish development for study of uORFs | PRJNA305418 | Other | Untranslated mRNA regionsUTRs are key mediators of post transcriptional regulation. Previous studies have predicted thousands of ORFs in five prime'UTRs the vast majority of which have unknown function. We present a systematic analysis of the translation and function of upstream open reading framesuORFs across vertebrates. Combining high resolution ribosome footprinting and phasing we find that i uORFs are pervasive within vertebrate transcriptomes ii the majority show signatures of active translation and iii uORFs act as potent regulators of translation and RNA levels with a similar magnitude to miRNAs. Evolution has targeted sequence features to mitigate the effects of constitutively repressive uORFs. Finally we observe that the regulatory potential of uORFs on individual genes is conserved across species. These results provide insight into the regulatory code within mRNA leader sequences and their capacity to modulate translation across vertebrates.The mRNA seq data contained in this archive were used along with ribosome profiling data to calculate translation efficiency values. | 2hpf | AG00244 mrna r0 2h | strain:TUAB|age:2hpf|sex:pooled male and female|tissue:embryo|genotype:wt|BioSampleModel:Model organism or animal | AG00244 mrna r0 2h | 2h mRNA R0 | 1 | Twenty embryos per condition were collected from the same clutch from where the ribosome profiling timeseries was conducted.Bazzini et al 2014 Total RNA was isolated using 1mL of Trizol following manufacturer instructions. Ribosomal RNAs were depleted using Ribo Zero Epicentre/Illumina. Strand specific single end library was constructed according to the Illumina Sample Preparation Kit protocol using standard TruSeq adapters Libraries were prepared and sequenced in an Illumina Hi SEQ single end 75nt reads | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>75</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP067139 | AG00244_SEQ0039_R1.fastq.gz | fastq | 1010085524.0 | 13290599.0 | 2h mRNA R0 run1 | 0:76 | A:196715560;C:309406513;G:286228000;T:217670217;N:65234 | 76 | 196715560 | 309406513 | 286228000 | 217670217 | 65234 | SRX1471511 | SRS1197399 | SRA314809 | Yale University|Giraldez Lab | Yale University | 1 | 0.89974 | 0.14215 | 0.79488 | 0.72171 | 76 | B | usable mapping rate | illumina | hiseq_era | unknown | rrna_depletion | trueseq | bulk | unknown | unknown | United States | 2015-12-08 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||
| 41548 | 41548 | SRR5017075 | SRX2345570 | SRS1796136 | SRP093295 | PRJNA353372 | N6 methyladenosine dynamics during early vertebrate embryogenesis | GSE89815 | Other | Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability translation efficiency and effect on miR 430 degradation kinetics. Notably we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages | input shield rep2 | GSM2390028 | tissue:Embryos|developmental stage:Shield stage embryos|strain:AB wild type | input shield rep2 | Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5’end and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al. 2013 with options seedSearchStartLmax 15 clip3pNbases 10 clip5pNbases 10 outFilterMultimapNmax 20 outFilterMismatchNoverLmax 0.05 outFilterMatchNminOverLread 0.0 outFilterMatchNmin 15 outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al. 2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage and txt file with raw and normalized read counts for each gene using the input samples | Embryos | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28±1°C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500µS/cm general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean Blacksburg USA 53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting Stavanger Norway dry feed twice a day and live artemia Scanbur Karlslunde Denmark once a day. Health monitoring was by daily inspection use of sentinel fish sent for pathology ZIRC Eugene Oregon and water microbiology analysis NMBU Vetbio Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats Apopka FL. Harvested embryos were kept in autoclaved SW at 28 °C harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009 the EU Directive 2010/63. | developmental stage:Shield stage embryos|strain:AB wild type | GSM2390028 | GSM2390028: input shield rep2; Danio rerio; RIP Seq | GSM2390028 | 1 | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | GEO Accession:GSM2390028 | RIP-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP093295 | input_shield_rep2.fastq.gz | fastq | 6559838034.0 | 69785511.0 | GSM2390028 r1 | 0:94 | A:1785772532;C:1552902091;G:1571407685;T:1649464013;N:291713 | 94 | 1785772532 | 1552902091 | 1571407685 | 1649464013 | 291713 | SRX2345570 | SRS1796136 | SRA492943 | GEO | Klungland Lab, Dept of microbiology, Oslo University Hospital | 1 | 0.03627 | 0.01 | 0.96676 | 0.66777 | 94 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | Norway | 2016-11-14 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 41549 | 41549 | SRR5017074 | SRX2345569 | SRS1796134 | SRP093295 | PRJNA353372 | N6 methyladenosine dynamics during early vertebrate embryogenesis | GSE89815 | Other | Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability translation efficiency and effect on miR 430 degradation kinetics. Notably we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages | input shield rep1 | GSM2390027 | tissue:Embryos|developmental stage:Shield stage embryos|strain:AB wild type | input shield rep1 | Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5’end and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al. 2013 with options seedSearchStartLmax 15 clip3pNbases 10 clip5pNbases 10 outFilterMultimapNmax 20 outFilterMismatchNoverLmax 0.05 outFilterMatchNminOverLread 0.0 outFilterMatchNmin 15 outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al. 2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage and txt file with raw and normalized read counts for each gene using the input samples | Embryos | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28±1°C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500µS/cm general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean Blacksburg USA 53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting Stavanger Norway dry feed twice a day and live artemia Scanbur Karlslunde Denmark once a day. Health monitoring was by daily inspection use of sentinel fish sent for pathology ZIRC Eugene Oregon and water microbiology analysis NMBU Vetbio Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats Apopka FL. Harvested embryos were kept in autoclaved SW at 28 °C harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009 the EU Directive 2010/63. | developmental stage:Shield stage embryos|strain:AB wild type | GSM2390027 | GSM2390027: input shield rep1; Danio rerio; RIP Seq | GSM2390027 | 1 | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | GEO Accession:GSM2390027 | RIP-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP093295 | input_shield_rep1.fastq.gz | fastq | 3765873214.0 | 40062481.0 | GSM2390027 r1 | 0:94 | A:1002751444;C:902509483;G:908627718;T:951814220;N:170349 | 94 | 1002751444 | 902509483 | 908627718 | 951814220 | 170349 | SRX2345569 | SRS1796134 | SRA492943 | GEO | Klungland Lab, Dept of microbiology, Oslo University Hospital | 1 | 0.03936 | 0.01095 | 0.96518 | 0.68725 | 94 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | Norway | 2016-11-14 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 41550 | 41550 | SRR5017073 | SRX2345568 | SRS1796132 | SRP093295 | PRJNA353372 | N6 methyladenosine dynamics during early vertebrate embryogenesis | GSE89815 | Other | Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability translation efficiency and effect on miR 430 degradation kinetics. Notably we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages | ip shield rep2 | GSM2390026 | tissue:Embryos|developmental stage:Shield stage embryos|strain:AB wild type | ip shield rep2 | Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5’end and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al. 2013 with options seedSearchStartLmax 15 clip3pNbases 10 clip5pNbases 10 outFilterMultimapNmax 20 outFilterMismatchNoverLmax 0.05 outFilterMatchNminOverLread 0.0 outFilterMatchNmin 15 outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al. 2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage and txt file with raw and normalized read counts for each gene using the input samples | Embryos | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28±1°C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500µS/cm general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean Blacksburg USA 53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting Stavanger Norway dry feed twice a day and live artemia Scanbur Karlslunde Denmark once a day. Health monitoring was by daily inspection use of sentinel fish sent for pathology ZIRC Eugene Oregon and water microbiology analysis NMBU Vetbio Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats Apopka FL. Harvested embryos were kept in autoclaved SW at 28 °C harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009 the EU Directive 2010/63. | developmental stage:Shield stage embryos|strain:AB wild type | GSM2390026 | GSM2390026: ip shield rep2; Danio rerio; RIP Seq | GSM2390026 | 1 | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | GEO Accession:GSM2390026 | RIP-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP093295 | ip_shield_rep2.fastq | fastq | 3855863926.0 | 41019829.0 | GSM2390026 r1 | 0:94 | A:1044010018;C:931492803;G:952890289;T:926349254;N:1121562 | 94 | 1044010018 | 931492803 | 952890289 | 926349254 | 1121562 | SRX2345568 | SRS1796132 | SRA492943 | GEO | Klungland Lab, Dept of microbiology, Oslo University Hospital | 1 | 0.03311 | 0.00481 | 0.96337 | 0.68612 | 94 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | Norway | 2016-11-14 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 41551 | 41551 | SRR5017072 | SRX2345567 | SRS1796131 | SRP093295 | PRJNA353372 | N6 methyladenosine dynamics during early vertebrate embryogenesis | GSE89815 | Other | Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability translation efficiency and effect on miR 430 degradation kinetics. Notably we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages | ip shield rep1 | GSM2390025 | tissue:Embryos|developmental stage:Shield stage embryos|strain:AB wild type | ip shield rep1 | Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5’end and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al. 2013 with options seedSearchStartLmax 15 clip3pNbases 10 clip5pNbases 10 outFilterMultimapNmax 20 outFilterMismatchNoverLmax 0.05 outFilterMatchNminOverLread 0.0 outFilterMatchNmin 15 outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al. 2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage and txt file with raw and normalized read counts for each gene using the input samples | Embryos | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28±1°C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500µS/cm general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean Blacksburg USA 53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting Stavanger Norway dry feed twice a day and live artemia Scanbur Karlslunde Denmark once a day. Health monitoring was by daily inspection use of sentinel fish sent for pathology ZIRC Eugene Oregon and water microbiology analysis NMBU Vetbio Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats Apopka FL. Harvested embryos were kept in autoclaved SW at 28 °C harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009 the EU Directive 2010/63. | developmental stage:Shield stage embryos|strain:AB wild type | GSM2390025 | GSM2390025: ip shield rep1; Danio rerio; RIP Seq | GSM2390025 | 1 | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | GEO Accession:GSM2390025 | RIP-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP093295 | ip_shield_rep1.fastq.gz | fastq | 4107624502.0 | 43698133.0 | GSM2390025 r1 | 0:94 | A:1087077899;C:996101257;G:1020588721;T:1002667943;N:1188682 | 94 | 1087077899 | 996101257 | 1020588721 | 1002667943 | 1188682 | SRX2345567 | SRS1796131 | SRA492943 | GEO | Klungland Lab, Dept of microbiology, Oslo University Hospital | 1 | 0.01898 | 0.00264 | 0.97238 | 0.59809 | 94 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | Norway | 2016-11-14 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 41552 | 41552 | SRR5017071 | SRX2345566 | SRS1796152 | SRP093295 | PRJNA353372 | N6 methyladenosine dynamics during early vertebrate embryogenesis | GSE89815 | Other | Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability translation efficiency and effect on miR 430 degradation kinetics. Notably we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages | input sphere rep2 | GSM2390024 | tissue:Embryos|developmental stage:sphere stage embryos|strain:AB wild type | input sphere rep2 | Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5’end and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al. 2013 with options seedSearchStartLmax 15 clip3pNbases 10 clip5pNbases 10 outFilterMultimapNmax 20 outFilterMismatchNoverLmax 0.05 outFilterMatchNminOverLread 0.0 outFilterMatchNmin 15 outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al. 2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage and txt file with raw and normalized read counts for each gene using the input samples | Embryos | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28±1°C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500µS/cm general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean Blacksburg USA 53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting Stavanger Norway dry feed twice a day and live artemia Scanbur Karlslunde Denmark once a day. Health monitoring was by daily inspection use of sentinel fish sent for pathology ZIRC Eugene Oregon and water microbiology analysis NMBU Vetbio Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats Apopka FL. Harvested embryos were kept in autoclaved SW at 28 °C harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009 the EU Directive 2010/63. | developmental stage:sphere stage embryos|strain:AB wild type | GSM2390024 | GSM2390024: input sphere rep2; Danio rerio; RIP Seq | GSM2390024 | 1 | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | GEO Accession:GSM2390024 | RIP-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP093295 | input_sphere_rep2.fastq.gz | fastq | 3684856024.0 | 39200596.0 | GSM2390024 r1 | 0:94 | A:991404019;C:883789087;G:892976599;T:916520929;N:165390 | 94 | 991404019 | 883789087 | 892976599 | 916520929 | 165390 | SRX2345566 | SRS1796152 | SRA492943 | GEO | Klungland Lab, Dept of microbiology, Oslo University Hospital | 1 | 0.03619 | 0.00867 | 0.96051 | 0.63934 | 94 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | Norway | 2016-11-14 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 41553 | 41553 | SRR5017070 | SRX2345565 | SRS1796139 | SRP093295 | PRJNA353372 | N6 methyladenosine dynamics during early vertebrate embryogenesis | GSE89815 | Other | Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability translation efficiency and effect on miR 430 degradation kinetics. Notably we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages | input sphere rep1 | GSM2390023 | tissue:Embryos|developmental stage:sphere stage embryos|strain:AB wild type | input sphere rep1 | Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5’end and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al. 2013 with options seedSearchStartLmax 15 clip3pNbases 10 clip5pNbases 10 outFilterMultimapNmax 20 outFilterMismatchNoverLmax 0.05 outFilterMatchNminOverLread 0.0 outFilterMatchNmin 15 outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al. 2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage and txt file with raw and normalized read counts for each gene using the input samples | Embryos | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28±1°C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500µS/cm general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean Blacksburg USA 53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting Stavanger Norway dry feed twice a day and live artemia Scanbur Karlslunde Denmark once a day. Health monitoring was by daily inspection use of sentinel fish sent for pathology ZIRC Eugene Oregon and water microbiology analysis NMBU Vetbio Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats Apopka FL. Harvested embryos were kept in autoclaved SW at 28 °C harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009 the EU Directive 2010/63. | developmental stage:sphere stage embryos|strain:AB wild type | GSM2390023 | GSM2390023: input sphere rep1; Danio rerio; RIP Seq | GSM2390023 | 1 | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | GEO Accession:GSM2390023 | RIP-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP093295 | input_sphere_rep1.fastq.gz | fastq | 3774515574.0 | 40154421.0 | GSM2390023 r1 | 0:94 | A:1014569244;C:912257296;G:925742711;T:921776107;N:170216 | 94 | 1014569244 | 912257296 | 925742711 | 921776107 | 170216 | SRX2345565 | SRS1796139 | SRA492943 | GEO | Klungland Lab, Dept of microbiology, Oslo University Hospital | 1 | 0.04287 | 0.00892 | 0.95085 | 0.50435 | 94 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | Norway | 2016-11-14 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 41554 | 41554 | SRR5017069 | SRX2345564 | SRS1796133 | SRP093295 | PRJNA353372 | N6 methyladenosine dynamics during early vertebrate embryogenesis | GSE89815 | Other | Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability translation efficiency and effect on miR 430 degradation kinetics. Notably we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages | ip sphere rep2 | GSM2390022 | tissue:Embryos|developmental stage:sphere stage embryos|strain:AB wild type | ip sphere rep2 | Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5’end and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al. 2013 with options seedSearchStartLmax 15 clip3pNbases 10 clip5pNbases 10 outFilterMultimapNmax 20 outFilterMismatchNoverLmax 0.05 outFilterMatchNminOverLread 0.0 outFilterMatchNmin 15 outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al. 2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage and txt file with raw and normalized read counts for each gene using the input samples | Embryos | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28±1°C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500µS/cm general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean Blacksburg USA 53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting Stavanger Norway dry feed twice a day and live artemia Scanbur Karlslunde Denmark once a day. Health monitoring was by daily inspection use of sentinel fish sent for pathology ZIRC Eugene Oregon and water microbiology analysis NMBU Vetbio Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats Apopka FL. Harvested embryos were kept in autoclaved SW at 28 °C harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009 the EU Directive 2010/63. | developmental stage:sphere stage embryos|strain:AB wild type | GSM2390022 | GSM2390022: ip sphere rep2; Danio rerio; RIP Seq | GSM2390022 | 1 | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | GEO Accession:GSM2390022 | RIP-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP093295 | ip_sphere_rep2.fastq.gz | fastq | 3926426624.0 | 41770496.0 | GSM2390022 r1 | 0:94 | A:1037910962;C:957162730;G:963824694;T:966381238;N:1147000 | 94 | 1037910962 | 957162730 | 963824694 | 966381238 | 1147000 | SRX2345564 | SRS1796133 | SRA492943 | GEO | Klungland Lab, Dept of microbiology, Oslo University Hospital | 1 | 0.03492 | 0.00427 | 0.95026 | 0.60529 | 94 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | Norway | 2016-11-14 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 41555 | 41555 | SRR5017068 | SRX2345563 | SRS1796143 | SRP093295 | PRJNA353372 | N6 methyladenosine dynamics during early vertebrate embryogenesis | GSE89815 | Other | Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability translation efficiency and effect on miR 430 degradation kinetics. Notably we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages | ip sphere rep1 | GSM2390021 | tissue:Embryos|developmental stage:sphere stage embryos|strain:AB wild type | ip sphere rep1 | Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5’end and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al. 2013 with options seedSearchStartLmax 15 clip3pNbases 10 clip5pNbases 10 outFilterMultimapNmax 20 outFilterMismatchNoverLmax 0.05 outFilterMatchNminOverLread 0.0 outFilterMatchNmin 15 outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al. 2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage and txt file with raw and normalized read counts for each gene using the input samples | Embryos | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28±1°C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500µS/cm general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean Blacksburg USA 53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting Stavanger Norway dry feed twice a day and live artemia Scanbur Karlslunde Denmark once a day. Health monitoring was by daily inspection use of sentinel fish sent for pathology ZIRC Eugene Oregon and water microbiology analysis NMBU Vetbio Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats Apopka FL. Harvested embryos were kept in autoclaved SW at 28 °C harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009 the EU Directive 2010/63. | developmental stage:sphere stage embryos|strain:AB wild type | GSM2390021 | GSM2390021: ip sphere rep1; Danio rerio; RIP Seq | GSM2390021 | 1 | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | GEO Accession:GSM2390021 | RIP-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP093295 | ip_sphere_rep1.fastq.gz | fastq | 4185867000.0 | 44530500.0 | GSM2390021 r1 | 0:94 | A:1114959829;C:1018236207;G:1019156922;T:1032304051;N:1209991 | 94 | 1114959829 | 1018236207 | 1019156922 | 1032304051 | 1209991 | SRX2345563 | SRS1796143 | SRA492943 | GEO | Klungland Lab, Dept of microbiology, Oslo University Hospital | 1 | 0.03035 | 0.00288 | 0.94757 | 0.5787 | 94 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | Norway | 2016-11-14 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 41556 | 41556 | SRR5017067 | SRX2345562 | SRS1796129 | SRP093295 | PRJNA353372 | N6 methyladenosine dynamics during early vertebrate embryogenesis | GSE89815 | Other | Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability translation efficiency and effect on miR 430 degradation kinetics. Notably we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages | input 64cell rep2 | GSM2390020 | tissue:Embryos|developmental stage:64 cell embryos|strain:AB wild type | input 64cell rep2 | Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5’end and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al. 2013 with options seedSearchStartLmax 15 clip3pNbases 10 clip5pNbases 10 outFilterMultimapNmax 20 outFilterMismatchNoverLmax 0.05 outFilterMatchNminOverLread 0.0 outFilterMatchNmin 15 outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al. 2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage and txt file with raw and normalized read counts for each gene using the input samples | Embryos | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28±1°C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500µS/cm general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean Blacksburg USA 53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting Stavanger Norway dry feed twice a day and live artemia Scanbur Karlslunde Denmark once a day. Health monitoring was by daily inspection use of sentinel fish sent for pathology ZIRC Eugene Oregon and water microbiology analysis NMBU Vetbio Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats Apopka FL. Harvested embryos were kept in autoclaved SW at 28 °C harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009 the EU Directive 2010/63. | developmental stage:64 cell embryos|strain:AB wild type | GSM2390020 | GSM2390020: input 64cell rep2; Danio rerio; RIP Seq | GSM2390020 | 1 | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | GEO Accession:GSM2390020 | RIP-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP093295 | input_64cell_rep2.fastq.gz | fastq | 3598782386.0 | 38284919.0 | GSM2390020 r1 | 0:94 | A:953869445;C:864903757;G:875832539;T:903947732;N:228913 | 94 | 953869445 | 864903757 | 875832539 | 903947732 | 228913 | SRX2345562 | SRS1796129 | SRA492943 | GEO | Klungland Lab, Dept of microbiology, Oslo University Hospital | 1 | 0.04289 | 0.00757 | 0.9418 | 0.6078 | 94 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | Norway | 2016-11-14 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 41557 | 41557 | SRR5017066 | SRX2345561 | SRS1796141 | SRP093295 | PRJNA353372 | N6 methyladenosine dynamics during early vertebrate embryogenesis | GSE89815 | Other | Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability translation efficiency and effect on miR 430 degradation kinetics. Notably we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages | input 64cell rep1 | GSM2390019 | tissue:Embryos|developmental stage:64 cell embryos|strain:AB wild type | input 64cell rep1 | Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5’end and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al. 2013 with options seedSearchStartLmax 15 clip3pNbases 10 clip5pNbases 10 outFilterMultimapNmax 20 outFilterMismatchNoverLmax 0.05 outFilterMatchNminOverLread 0.0 outFilterMatchNmin 15 outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al. 2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage and txt file with raw and normalized read counts for each gene using the input samples | Embryos | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28±1°C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500µS/cm general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean Blacksburg USA 53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting Stavanger Norway dry feed twice a day and live artemia Scanbur Karlslunde Denmark once a day. Health monitoring was by daily inspection use of sentinel fish sent for pathology ZIRC Eugene Oregon and water microbiology analysis NMBU Vetbio Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats Apopka FL. Harvested embryos were kept in autoclaved SW at 28 °C harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009 the EU Directive 2010/63. | developmental stage:64 cell embryos|strain:AB wild type | GSM2390019 | GSM2390019: input 64cell rep1; Danio rerio; RIP Seq | GSM2390019 | 1 | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | GEO Accession:GSM2390019 | RIP-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP093295 | input_64cell_rep1.fastq.gz | fastq | 3538898746.0 | 37647859.0 | GSM2390019 r1 | 0:94 | A:916878511;C:870431252;G:873611680;T:877750503;N:226800 | 94 | 916878511 | 870431252 | 873611680 | 877750503 | 226800 | SRX2345561 | SRS1796141 | SRA492943 | GEO | Klungland Lab, Dept of microbiology, Oslo University Hospital | 1 | 0.03397 | 0.00616 | 0.95268 | 0.62545 | 94 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | Norway | 2016-11-14 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 41558 | 41558 | SRR5017065 | SRX2345560 | SRS1796153 | SRP093295 | PRJNA353372 | N6 methyladenosine dynamics during early vertebrate embryogenesis | GSE89815 | Other | Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability translation efficiency and effect on miR 430 degradation kinetics. Notably we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages | ip 64cell rep2 | GSM2390018 | tissue:Embryos|developmental stage:64 cell embryos|strain:AB wild type | ip 64cell rep2 | Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5’end and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al. 2013 with options seedSearchStartLmax 15 clip3pNbases 10 clip5pNbases 10 outFilterMultimapNmax 20 outFilterMismatchNoverLmax 0.05 outFilterMatchNminOverLread 0.0 outFilterMatchNmin 15 outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al. 2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage and txt file with raw and normalized read counts for each gene using the input samples | Embryos | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28±1°C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500µS/cm general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean Blacksburg USA 53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting Stavanger Norway dry feed twice a day and live artemia Scanbur Karlslunde Denmark once a day. Health monitoring was by daily inspection use of sentinel fish sent for pathology ZIRC Eugene Oregon and water microbiology analysis NMBU Vetbio Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats Apopka FL. Harvested embryos were kept in autoclaved SW at 28 °C harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009 the EU Directive 2010/63. | developmental stage:64 cell embryos|strain:AB wild type | GSM2390018 | GSM2390018: ip 64cell rep2; Danio rerio; RIP Seq | GSM2390018 | 1 | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | GEO Accession:GSM2390018 | RIP-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP093295 | ip_64cell_rep2.fastq.gz | fastq | 3530677976.0 | 37560404.0 | GSM2390018 r1 | 0:94 | A:966880666;C:841411144;G:858285224;T:862983808;N:1117134 | 94 | 966880666 | 841411144 | 858285224 | 862983808 | 1117134 | SRX2345560 | SRS1796153 | SRA492943 | GEO | Klungland Lab, Dept of microbiology, Oslo University Hospital | 1 | 0.04775 | 0.00421 | 0.92845 | 0.5748 | 94 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | Norway | 2016-11-14 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 41559 | 41559 | SRR5017064 | SRX2345559 | SRS1796135 | SRP093295 | PRJNA353372 | N6 methyladenosine dynamics during early vertebrate embryogenesis | GSE89815 | Other | Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability translation efficiency and effect on miR 430 degradation kinetics. Notably we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages | ip 64cell rep1 | GSM2390017 | tissue:Embryos|developmental stage:64 cell embryos|strain:AB wild type | ip 64cell rep1 | Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5’end and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al. 2013 with options seedSearchStartLmax 15 clip3pNbases 10 clip5pNbases 10 outFilterMultimapNmax 20 outFilterMismatchNoverLmax 0.05 outFilterMatchNminOverLread 0.0 outFilterMatchNmin 15 outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al. 2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage and txt file with raw and normalized read counts for each gene using the input samples | Embryos | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28±1°C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500µS/cm general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean Blacksburg USA 53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting Stavanger Norway dry feed twice a day and live artemia Scanbur Karlslunde Denmark once a day. Health monitoring was by daily inspection use of sentinel fish sent for pathology ZIRC Eugene Oregon and water microbiology analysis NMBU Vetbio Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats Apopka FL. Harvested embryos were kept in autoclaved SW at 28 °C harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009 the EU Directive 2010/63. | developmental stage:64 cell embryos|strain:AB wild type | GSM2390017 | GSM2390017: ip 64cell rep1; Danio rerio; RIP Seq | GSM2390017 | 1 | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | GEO Accession:GSM2390017 | RIP-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP093295 | ip_64cell_rep1.fastq.gz | fastq | 3912003734.0 | 41617061.0 | GSM2390017 r1 | 0:94 | A:1040276279;C:945311584;G:953598043;T:971589029;N:1228799 | 94 | 1040276279 | 945311584 | 953598043 | 971589029 | 1228799 | SRX2345559 | SRS1796135 | SRA492943 | GEO | Klungland Lab, Dept of microbiology, Oslo University Hospital | 1 | 0.03544 | 0.00268 | 0.93914 | 0.53712 | 94 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | Norway | 2016-11-14 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 41560 | 41560 | SRR5017063 | SRX2345558 | SRS1796155 | SRP093295 | PRJNA353372 | N6 methyladenosine dynamics during early vertebrate embryogenesis | GSE89815 | Other | Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability translation efficiency and effect on miR 430 degradation kinetics. Notably we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages | input 1cell rep2 | GSM2390016 | tissue:Embryos|developmental stage:1cell embryos|strain:AB wild type | input 1cell rep2 | Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5’end and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al. 2013 with options seedSearchStartLmax 15 clip3pNbases 10 clip5pNbases 10 outFilterMultimapNmax 20 outFilterMismatchNoverLmax 0.05 outFilterMatchNminOverLread 0.0 outFilterMatchNmin 15 outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al. 2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage and txt file with raw and normalized read counts for each gene using the input samples | Embryos | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28±1°C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500µS/cm general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean Blacksburg USA 53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting Stavanger Norway dry feed twice a day and live artemia Scanbur Karlslunde Denmark once a day. Health monitoring was by daily inspection use of sentinel fish sent for pathology ZIRC Eugene Oregon and water microbiology analysis NMBU Vetbio Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats Apopka FL. Harvested embryos were kept in autoclaved SW at 28 °C harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009 the EU Directive 2010/63. | developmental stage:1cell embryos|strain:AB wild type | GSM2390016 | GSM2390016: input 1cell rep2; Danio rerio; RIP Seq | GSM2390016 | 1 | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | GEO Accession:GSM2390016 | RIP-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP093295 | input_1cell_rep2.fastq.gz | fastq | 3379762010.0 | 35954915.0 | GSM2390016 r1 | 0:94 | A:898920912;C:816234808;G:823428476;T:840956466;N:221348 | 94 | 898920912 | 816234808 | 823428476 | 840956466 | 221348 | SRX2345558 | SRS1796155 | SRA492943 | GEO | Klungland Lab, Dept of microbiology, Oslo University Hospital | 1 | 0.04513 | 0.00864 | 0.95085 | 0.51692 | 94 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | Norway | 2016-11-14 | Zygote | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 41561 | 41561 | SRR5017062 | SRX2345557 | SRS1796128 | SRP093295 | PRJNA353372 | N6 methyladenosine dynamics during early vertebrate embryogenesis | GSE89815 | Other | Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability translation efficiency and effect on miR 430 degradation kinetics. Notably we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages | input 1cell rep1 | GSM2390015 | tissue:Embryos|developmental stage:1cell embryos|strain:AB wild type | input 1cell rep1 | Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5’end and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al. 2013 with options seedSearchStartLmax 15 clip3pNbases 10 clip5pNbases 10 outFilterMultimapNmax 20 outFilterMismatchNoverLmax 0.05 outFilterMatchNminOverLread 0.0 outFilterMatchNmin 15 outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al. 2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage and txt file with raw and normalized read counts for each gene using the input samples | Embryos | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28±1°C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500µS/cm general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean Blacksburg USA 53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting Stavanger Norway dry feed twice a day and live artemia Scanbur Karlslunde Denmark once a day. Health monitoring was by daily inspection use of sentinel fish sent for pathology ZIRC Eugene Oregon and water microbiology analysis NMBU Vetbio Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats Apopka FL. Harvested embryos were kept in autoclaved SW at 28 °C harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009 the EU Directive 2010/63. | developmental stage:1cell embryos|strain:AB wild type | GSM2390015 | GSM2390015: input 1cell rep1; Danio rerio; RIP Seq | GSM2390015 | 1 | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | GEO Accession:GSM2390015 | RIP-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP093295 | input_1cell_rep1.fastq.gz | fastq | 3650321646.0 | 38833209.0 | GSM2390015 r1 | 0:94 | A:951411355;C:878458528;G:890250453;T:929968044;N:233266 | 94 | 951411355 | 878458528 | 890250453 | 929968044 | 233266 | SRX2345557 | SRS1796128 | SRA492943 | GEO | Klungland Lab, Dept of microbiology, Oslo University Hospital | 1 | 0.03728 | 0.00668 | 0.94901 | 0.60038 | 94 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | Norway | 2016-11-14 | Zygote | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 41562 | 41562 | SRR5017061 | SRX2345556 | SRS1796127 | SRP093295 | PRJNA353372 | N6 methyladenosine dynamics during early vertebrate embryogenesis | GSE89815 | Other | Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability translation efficiency and effect on miR 430 degradation kinetics. Notably we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages | ip 1cell rep2 | GSM2390014 | tissue:Embryos|developmental stage:1cell embryos|strain:AB wild type | ip 1cell rep2 | Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5’end and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al. 2013 with options seedSearchStartLmax 15 clip3pNbases 10 clip5pNbases 10 outFilterMultimapNmax 20 outFilterMismatchNoverLmax 0.05 outFilterMatchNminOverLread 0.0 outFilterMatchNmin 15 outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al. 2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage and txt file with raw and normalized read counts for each gene using the input samples | Embryos | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28±1°C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500µS/cm general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean Blacksburg USA 53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting Stavanger Norway dry feed twice a day and live artemia Scanbur Karlslunde Denmark once a day. Health monitoring was by daily inspection use of sentinel fish sent for pathology ZIRC Eugene Oregon and water microbiology analysis NMBU Vetbio Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats Apopka FL. Harvested embryos were kept in autoclaved SW at 28 °C harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009 the EU Directive 2010/63. | developmental stage:1cell embryos|strain:AB wild type | GSM2390014 | GSM2390014: ip 1cell rep2; Danio rerio; RIP Seq | GSM2390014 | 1 | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | GEO Accession:GSM2390014 | RIP-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP093295 | ip_1cell_rep2.fastq.gz | fastq | 3485432580.0 | 37079070.0 | GSM2390014 r1 | 0:94 | A:953699047;C:835179152;G:846963064;T:848487912;N:1103405 | 94 | 953699047 | 835179152 | 846963064 | 848487912 | 1103405 | SRX2345556 | SRS1796127 | SRA492943 | GEO | Klungland Lab, Dept of microbiology, Oslo University Hospital | 1 | 0.02534 | 0.00219 | 0.95891 | 0.5975 | 94 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | Norway | 2016-11-14 | Zygote | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 41563 | 41563 | SRR5017060 | SRX2345555 | SRS1796130 | SRP093295 | PRJNA353372 | N6 methyladenosine dynamics during early vertebrate embryogenesis | GSE89815 | Other | Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability translation efficiency and effect on miR 430 degradation kinetics. Notably we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages | ip 1cell rep1 | GSM2390013 | tissue:Embryos|developmental stage:1cell embryos|strain:AB wild type | ip 1cell rep1 | Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5’end and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al. 2013 with options seedSearchStartLmax 15 clip3pNbases 10 clip5pNbases 10 outFilterMultimapNmax 20 outFilterMismatchNoverLmax 0.05 outFilterMatchNminOverLread 0.0 outFilterMatchNmin 15 outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al. 2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage and txt file with raw and normalized read counts for each gene using the input samples | Embryos | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28±1°C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500µS/cm general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean Blacksburg USA 53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting Stavanger Norway dry feed twice a day and live artemia Scanbur Karlslunde Denmark once a day. Health monitoring was by daily inspection use of sentinel fish sent for pathology ZIRC Eugene Oregon and water microbiology analysis NMBU Vetbio Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats Apopka FL. Harvested embryos were kept in autoclaved SW at 28 °C harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009 the EU Directive 2010/63. | developmental stage:1cell embryos|strain:AB wild type | GSM2390013 | GSM2390013: ip 1cell rep1; Danio rerio; RIP Seq | GSM2390013 | 1 | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | GEO Accession:GSM2390013 | RIP-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP093295 | ip_1cell_rep1.fastq.gz | fastq | 3610167102.0 | 38406033.0 | GSM2390013 r1 | 0:94 | A:961438376;C:875781200;G:891055201;T:880749228;N:1143097 | 94 | 961438376 | 875781200 | 891055201 | 880749228 | 1143097 | SRX2345555 | SRS1796130 | SRA492943 | GEO | Klungland Lab, Dept of microbiology, Oslo University Hospital | 1 | 0.01939 | 0.00159 | 0.96457 | 0.53652 | 94 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | Norway | 2016-11-14 | Zygote | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 42000 | 42000 | SRR5379364 | SRX2674572 | SRS2073700 | SRP102513 | PRJNA380609 | Transcriptome analysis on wild type and ddx39a mutant zebrafish embryos by Next Generation Sequencing | GSE97067 | Other | DEAD box RNA helicase DDX39A has been shown to regulate RNA metabolism; however its role in vertebrate development has not previously been examined. To determine the impact of loss of ddx39a on transcriptome during vertebrate early development we pursued transcriptome analysis RNA Seq on wild type and ddx39a mutant zebrafish embryos at 24 hpf And by using RIP seq to identify targeted RNA which were DDX39A binded. Overall design: Using RNA seq to identify the changes in the transcriptomic landscape in ddx39a mutants. Using RIP seq to identify DDX39A binding RNAs. | pubmed:29636379 | ddx39a 24hpf RIPseq | GSM2550918 | source name:embryos|genotype:ddx39a mutant|tissue:embryo|developmental stage:24hpf | ddx39a 24hpf RIPseq | Illumina bcl2fastq2 v 2.16.0.10 software was used for base calling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence. Read quality was checked for each sample by using FastQC v 0.11.5. High quality reads were alligned to GRCz10 whole genome using tophat V2.2.1 and bowtie2 v2.2.3 with parameters q p 8 no novel juncs G o. Raw counts of sequencing reads were generated by using HTSeq v 0.6.1p1. Genome build: GRCz10 Supplementary files format and content: tab delimited text files include raw counts for each Sample | embryos | Microinjection ddx39a Flag mRNA in ddx39a mutant embryos at one cell stage. Lysates were clarified from 24hpf embryos were isolated with anti Flag beads. RNA was harvested using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit was used with 1 ug of total RNA for the construction of sequencing libraries. Magnetic beads with oligodT were used to enrich the mRNAs and then Frag/Prime buffer was added to fragment the mRNAs. The short mRNA fragments were used as templates and random hexamers were used to synthesize first strand cDNA. Then double stranded cDNA was synthesized by adding buffer solution dNTPs and DNA polymeraseΙ. The double stranded cDNAs were purified by DNA clean beads according to the manufacturer’s instructions then repaired at the tail ends polyA added and enriched by PCR amplification. Finally we tested the inserts sizes in the cDNA libraries on an Agilent 2100 Bioanalyzer. | genotype:ddx39a mutant|tissue:embryo|developmental stage:24hpf | GSM2550918 | GSM2550918: ddx39a 24hpf RIPseq; Danio rerio; RIP Seq | GSM2550918 | 1 | Microinjection ddx39a Flag mRNA in ddx39a mutant embryos at one cell stage. Lysates were clarified from 24hpf embryos were isolated with anti Flag beads. RNA was harvested using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit was used with 1 ug of total RNA for the construction of sequencing libraries. Magnetic beads with oligodT were used to enrich the mRNAs and then Frag/Prime buffer was added to fragment the mRNAs. The short mRNA fragments were used as templates and random hexamers were used to synthesize first strand cDNA. Then double stranded cDNA was synthesized by adding buffer solution dNTPs and DNA polymeraseΙ. The double stranded cDNAs were purified by DNA clean beads according to the manufacturer’s instructions then repaired at the tail ends polyA added and enriched by PCR amplification. Finally we tested the inserts sizes in the cDNA libraries on an Agilent 2100 Bioanalyzer. | GEO Accession:GSM2550918 | RIP-Seq | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina HiSeq 4000 | SRP102513 | RDWHDANwwwCAABRAAPEI-206_1.fq.gz RDWHDANwwwCAABRAAPEI-206_2.fq.gz | fastq fastq | 3819239400.0 | 19096197.0 | GSM2550918 r1 | 0:100 1:100 | A:751858949;C:1169790479;G:1139713624;T:756987876;N:888472 | 100 | 100 | 751858949 | 1169790479 | 1139713624 | 756987876 | 888472 | SRX2674572 | SRS2073700 | SRA549449 | GEO | Xin Lou Lab, Medical School, Nanjing University | 2 | 0.98659 | 0.98572 | 0.28836 | 0.28975 | 0.89422 | 0.89558 | 0.75396 | 0.78553 | 100 | 100 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | trueseq | bulk | unknown | unknown | China | 2017-03-27 | Pharyngula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||
| 42001 | 42001 | SRR5379363 | SRX2674571 | SRS2073697 | SRP102513 | PRJNA380609 | Transcriptome analysis on wild type and ddx39a mutant zebrafish embryos by Next Generation Sequencing | GSE97067 | Other | DEAD box RNA helicase DDX39A has been shown to regulate RNA metabolism; however its role in vertebrate development has not previously been examined. To determine the impact of loss of ddx39a on transcriptome during vertebrate early development we pursued transcriptome analysis RNA Seq on wild type and ddx39a mutant zebrafish embryos at 24 hpf And by using RIP seq to identify targeted RNA which were DDX39A binded. Overall design: Using RNA seq to identify the changes in the transcriptomic landscape in ddx39a mutants. Using RIP seq to identify DDX39A binding RNAs. | pubmed:29636379 | WT 24hpf RIPseq | GSM2550917 | source name:embryos|genotype:wild type|tissue:embryo|developmental stage:24hpf | WT 24hpf RIPseq | Illumina bcl2fastq2 v 2.16.0.10 software was used for base calling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence. Read quality was checked for each sample by using FastQC v 0.11.5. High quality reads were alligned to GRCz10 whole genome using tophat V2.2.1 and bowtie2 v2.2.3 with parameters q p 8 no novel juncs G o. Raw counts of sequencing reads were generated by using HTSeq v 0.6.1p1. Genome build: GRCz10 Supplementary files format and content: tab delimited text files include raw counts for each Sample | embryos | Microinjection ddx39a Flag mRNA in ddx39a mutant embryos at one cell stage. Lysates were clarified from 24hpf embryos were isolated with anti Flag beads. RNA was harvested using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit was used with 1 ug of total RNA for the construction of sequencing libraries. Magnetic beads with oligodT were used to enrich the mRNAs and then Frag/Prime buffer was added to fragment the mRNAs. The short mRNA fragments were used as templates and random hexamers were used to synthesize first strand cDNA. Then double stranded cDNA was synthesized by adding buffer solution dNTPs and DNA polymeraseΙ. The double stranded cDNAs were purified by DNA clean beads according to the manufacturer’s instructions then repaired at the tail ends polyA added and enriched by PCR amplification. Finally we tested the inserts sizes in the cDNA libraries on an Agilent 2100 Bioanalyzer. | genotype:wild type|tissue:embryo|developmental stage:24hpf | GSM2550917 | GSM2550917: WT 24hpf RIPseq; Danio rerio; RIP Seq | GSM2550917 | 1 | Microinjection ddx39a Flag mRNA in ddx39a mutant embryos at one cell stage. Lysates were clarified from 24hpf embryos were isolated with anti Flag beads. RNA was harvested using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit was used with 1 ug of total RNA for the construction of sequencing libraries. Magnetic beads with oligodT were used to enrich the mRNAs and then Frag/Prime buffer was added to fragment the mRNAs. The short mRNA fragments were used as templates and random hexamers were used to synthesize first strand cDNA. Then double stranded cDNA was synthesized by adding buffer solution dNTPs and DNA polymeraseΙ. The double stranded cDNAs were purified by DNA clean beads according to the manufacturer’s instructions then repaired at the tail ends polyA added and enriched by PCR amplification. Finally we tested the inserts sizes in the cDNA libraries on an Agilent 2100 Bioanalyzer. | GEO Accession:GSM2550917 | RIP-Seq | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina HiSeq 4000 | SRP102513 | RDWHDANwwwCAAARAAPEI-205_2.fq.gz RDWHDANwwwCAAARAAPEI-205_1.fq.gz | fastq fastq | 3802882200.0 | 19014411.0 | GSM2550917 r1 | 0:100 1:100 | A:733911232;C:1178365174;G:1154031422;T:735690235;N:884137 | 100 | 100 | 733911232 | 1178365174 | 1154031422 | 735690235 | 884137 | SRX2674571 | SRS2073697 | SRA549449 | GEO | Xin Lou Lab, Medical School, Nanjing University | 2 | 0.9866 | 0.98469 | 0.30567 | 0.30486 | 0.90796 | 0.90928 | 0.82926 | 0.83029 | 100 | 100 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | trueseq | bulk | unknown | unknown | China | 2017-03-27 | Pharyngula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||
| 43402 | 43402 | SRR5931544 | SRX3091819 | SRS2429165 | SRP115388 | PRJNA397956 | Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads | PRJNA397956 | Whole Genome Sequencing | To evaluate underlying environmental risks of difenoconazole in aquatic organisms | To evaluate underlying environmental risks of difenoconazole in zebrafish embryo | Model organism or animal sample from Danio rerio | Zebrafish | strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal | with difenoconazole | 397969 | 397969 | to evulate the environmental risks of difenoconazole in zebrafish embryo | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP115388 | 4755826950.0 | 31705513.0 | D 500 1 2.fq.gz | 0:0 1:150 | A:1274207449;C:1094727902;G:1122524378;T:1264331427;N:35794 | 0 | 150 | 1274207449 | 1094727902 | 1122524378 | 1264331427 | 35794 | SRX3091819 | SRS2429165 | SRA598900 | China Agricultural University|College of Sciences | China Agricultural University | 1 | 0.91191 | 0.10926 | 0.68341 | 0.47196 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | China | 2017-08-14 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43403 | 43403 | SRR5931545 | SRX3091818 | SRS2429165 | SRP115388 | PRJNA397956 | Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads | PRJNA397956 | Whole Genome Sequencing | To evaluate underlying environmental risks of difenoconazole in aquatic organisms | To evaluate underlying environmental risks of difenoconazole in zebrafish embryo | Model organism or animal sample from Danio rerio | Zebrafish | strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal | with difenoconazole | 397968 | 397968 | to evulate the environmental risks of difenoconazole in zebrafish embryo | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP115388 | 4755826950.0 | 31705513.0 | D 500 1 1.fq.gz | 0:150 1:0 | A:1276129214;C:1100761964;G:1115345594;T:1263574047;N:16131 | 150 | 0 | 1276129214 | 1100761964 | 1115345594 | 1263574047 | 16131 | SRX3091818 | SRS2429165 | SRA598900 | China Agricultural University|College of Sciences | China Agricultural University | 1 | 0.91044 | 0.10895 | 0.67659 | 0.46952 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | China | 2017-08-14 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43404 | 43404 | SRR5931546 | SRX3091817 | SRS2429165 | SRP115388 | PRJNA397956 | Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads | PRJNA397956 | Whole Genome Sequencing | To evaluate underlying environmental risks of difenoconazole in aquatic organisms | To evaluate underlying environmental risks of difenoconazole in zebrafish embryo | Model organism or animal sample from Danio rerio | Zebrafish | strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal | with difenoconazole | 397967 | 397967 | to evulate the environmental risks of difenoconazole in zebrafish embryo | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP115388 | 4584658950.0 | 30564393.0 | D 50 3 2.fq.gz | 0:0 1:150 | A:1214232270;C:1065003267;G:1091428812;T:1213867330;N:127271 | 0 | 150 | 1214232270 | 1065003267 | 1091428812 | 1213867330 | 127271 | SRX3091817 | SRS2429165 | SRA598900 | China Agricultural University|College of Sciences | China Agricultural University | 1 | 0.92229 | 0.10554 | 0.68667 | 0.4535 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | China | 2017-08-14 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43405 | 43405 | SRR5931547 | SRX3091816 | SRS2429165 | SRP115388 | PRJNA397956 | Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads | PRJNA397956 | Whole Genome Sequencing | To evaluate underlying environmental risks of difenoconazole in aquatic organisms | To evaluate underlying environmental risks of difenoconazole in zebrafish embryo | Model organism or animal sample from Danio rerio | Zebrafish | strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal | with difenoconazole | 397966 | 397966 | to evulate the environmental risks of difenoconazole in zebrafish embryo | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP115388 | 4584658950.0 | 30564393.0 | D 50 3 1.fq.gz | 0:150 1:0 | A:1219702088;C:1067643780;G:1085480895;T:1211806100;N:26087 | 150 | 0 | 1219702088 | 1067643780 | 1085480895 | 1211806100 | 26087 | SRX3091816 | SRS2429165 | SRA598900 | China Agricultural University|College of Sciences | China Agricultural University | 1 | 0.92126 | 0.10598 | 0.68398 | 0.44901 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | China | 2017-08-14 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43406 | 43406 | SRR5931548 | SRX3091815 | SRS2429165 | SRP115388 | PRJNA397956 | Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads | PRJNA397956 | Whole Genome Sequencing | To evaluate underlying environmental risks of difenoconazole in aquatic organisms | To evaluate underlying environmental risks of difenoconazole in zebrafish embryo | Model organism or animal sample from Danio rerio | Zebrafish | strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal | with difenoconazole | 397973 | 397973 | to evulate the environmental risks of difenoconazole in zebrafish embryo | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP115388 | 4705867200.0 | 31372448.0 | D 500 3 2.fq.gz | 0:0 1:150 | A:1240294141;C:1111008282;G:1125861755;T:1228667971;N:35051 | 0 | 150 | 1240294141 | 1111008282 | 1125861755 | 1228667971 | 35051 | SRX3091815 | SRS2429165 | SRA598900 | China Agricultural University|College of Sciences | China Agricultural University | 1 | 0.92297 | 0.09739 | 0.6856 | 0.47451 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | China | 2017-08-14 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43407 | 43407 | SRR5931549 | SRX3091814 | SRS2429165 | SRP115388 | PRJNA397956 | Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads | PRJNA397956 | Whole Genome Sequencing | To evaluate underlying environmental risks of difenoconazole in aquatic organisms | To evaluate underlying environmental risks of difenoconazole in zebrafish embryo | Model organism or animal sample from Danio rerio | Zebrafish | strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal | with difenoconazole | 397972 | 397972 | to evulate the environmental risks of difenoconazole in zebrafish embryo | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP115388 | 4705867200.0 | 31372448.0 | D 500 3 1.fq.gz | 0:150 1:0 | A:1241514886;C:1108723884;G:1123339576;T:1232273510;N:15344 | 150 | 0 | 1241514886 | 1108723884 | 1123339576 | 1232273510 | 15344 | SRX3091814 | SRS2429165 | SRA598900 | China Agricultural University|College of Sciences | China Agricultural University | 1 | 0.92062 | 0.09796 | 0.67856 | 0.47388 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | China | 2017-08-14 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43408 | 43408 | SRR5931550 | SRX3091813 | SRS2429165 | SRP115388 | PRJNA397956 | Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads | PRJNA397956 | Whole Genome Sequencing | To evaluate underlying environmental risks of difenoconazole in aquatic organisms | To evaluate underlying environmental risks of difenoconazole in zebrafish embryo | Model organism or animal sample from Danio rerio | Zebrafish | strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal | with difenoconazole | 397971 | 397971 | to evulate the environmental risks of difenoconazole in zebrafish embryo | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP115388 | 4750951350.0 | 31673009.0 | D 500 2 2.fq.gz | 0:0 1:150 | A:1286144024;C:1079544004;G:1112952985;T:1272274928;N:35409 | 0 | 150 | 1286144024 | 1079544004 | 1112952985 | 1272274928 | 35409 | SRX3091813 | SRS2429165 | SRA598900 | China Agricultural University|College of Sciences | China Agricultural University | 1 | 0.90446 | 0.13747 | 0.68639 | 0.46726 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | China | 2017-08-14 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43409 | 43409 | SRR5931551 | SRX3091812 | SRS2429165 | SRP115388 | PRJNA397956 | Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads | PRJNA397956 | Whole Genome Sequencing | To evaluate underlying environmental risks of difenoconazole in aquatic organisms | To evaluate underlying environmental risks of difenoconazole in zebrafish embryo | Model organism or animal sample from Danio rerio | Zebrafish | strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal | with difenoconazole | 397970 | 397970 | to evulate the environmental risks of difenoconazole in zebrafish embryo | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP115388 | 4750951350.0 | 31673009.0 | D 500 2 1.fq.gz | 0:150 1:0 | A:1287515334;C:1090783234;G:1101469034;T:1271168008;N:15740 | 150 | 0 | 1287515334 | 1090783234 | 1101469034 | 1271168008 | 15740 | SRX3091812 | SRS2429165 | SRA598900 | China Agricultural University|College of Sciences | China Agricultural University | 1 | 0.90214 | 0.13756 | 0.68158 | 0.46719 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | China | 2017-08-14 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43410 | 43410 | SRR5931552 | SRX3091811 | SRS2429165 | SRP115388 | PRJNA397956 | Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads | PRJNA397956 | Whole Genome Sequencing | To evaluate underlying environmental risks of difenoconazole in aquatic organisms | To evaluate underlying environmental risks of difenoconazole in zebrafish embryo | Model organism or animal sample from Danio rerio | Zebrafish | strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal | without xxx | 397957 | 397957 | to evulate the environmental risks of difenoconazole in zebrafish embryo | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP115388 | 4071934650.0 | 27146231.0 | CK 1 2.fq.gz | 0:0 1:150 | A:1052229682;C:975525985;G:991345538;T:1052207035;N:626410 | 0 | 150 | 1052229682 | 975525985 | 991345538 | 1052207035 | 626410 | SRX3091811 | SRS2429165 | SRA598900 | China Agricultural University|College of Sciences | China Agricultural University | 1 | 0.93603 | 0.0589 | 0.71492 | 0.48298 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | China | 2017-08-14 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43411 | 43411 | SRR5931553 | SRX3091810 | SRS2429165 | SRP115388 | PRJNA397956 | Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads | PRJNA397956 | Whole Genome Sequencing | To evaluate underlying environmental risks of difenoconazole in aquatic organisms | To evaluate underlying environmental risks of difenoconazole in zebrafish embryo | Model organism or animal sample from Danio rerio | Zebrafish | strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal | without xxx | 397956 | 397956 | to evulate the environmental risks of difenoconazole in zebrafish embryo | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP115388 | 4071934650.0 | 27146231.0 | CK 1 1.fq.gz | 0:150 1:0 | A:1057694098;C:975549420;G:988477956;T:1049766896;N:446280 | 150 | 0 | 1057694098 | 975549420 | 988477956 | 1049766896 | 446280 | SRX3091810 | SRS2429165 | SRA598900 | China Agricultural University|College of Sciences | China Agricultural University | 1 | 0.93688 | 0.05854 | 0.7091 | 0.48309 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | China | 2017-08-14 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43412 | 43412 | SRR5931554 | SRX3091809 | SRS2429165 | SRP115388 | PRJNA397956 | Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads | PRJNA397956 | Whole Genome Sequencing | To evaluate underlying environmental risks of difenoconazole in aquatic organisms | To evaluate underlying environmental risks of difenoconazole in zebrafish embryo | Model organism or animal sample from Danio rerio | Zebrafish | strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal | without xxx | 397959 | 397959 | to evulate the environmental risks of difenoconazole in zebrafish embryo | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP115388 | 4343291550.0 | 28955277.0 | CK 2 2.fq.gz | 0:0 1:150 | A:1153253014;C:1007267471;G:1028912357;T:1153739160;N:119548 | 0 | 150 | 1153253014 | 1007267471 | 1028912357 | 1153739160 | 119548 | SRX3091809 | SRS2429165 | SRA598900 | China Agricultural University|College of Sciences | China Agricultural University | 1 | 0.9209 | 0.11211 | 0.68649 | 0.45293 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | China | 2017-08-14 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43413 | 43413 | SRR5931555 | SRX3091808 | SRS2429165 | SRP115388 | PRJNA397956 | Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads | PRJNA397956 | Whole Genome Sequencing | To evaluate underlying environmental risks of difenoconazole in aquatic organisms | To evaluate underlying environmental risks of difenoconazole in zebrafish embryo | Model organism or animal sample from Danio rerio | Zebrafish | strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal | without xxx | 397958 | 397958 | to evulate the environmental risks of difenoconazole in zebrafish embryo | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP115388 | 4343291550.0 | 28955277.0 | CK 2 1.fq.gz | 0:150 1:0 | A:1157702407;C:1008975846;G:1024287434;T:1151988746;N:337117 | 150 | 0 | 1157702407 | 1008975846 | 1024287434 | 1151988746 | 337117 | SRX3091808 | SRS2429165 | SRA598900 | China Agricultural University|College of Sciences | China Agricultural University | 1 | 0.91946 | 0.11191 | 0.6828 | 0.45241 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | China | 2017-08-14 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43414 | 43414 | SRR5931556 | SRX3091807 | SRS2429165 | SRP115388 | PRJNA397956 | Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads | PRJNA397956 | Whole Genome Sequencing | To evaluate underlying environmental risks of difenoconazole in aquatic organisms | To evaluate underlying environmental risks of difenoconazole in zebrafish embryo | Model organism or animal sample from Danio rerio | Zebrafish | strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal | without xxx | 397961 | 397961 | to evulate the environmental risks of difenoconazole in zebrafish embryo | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP115388 | 4518061050.0 | 30120407.0 | CK 3 2.fq.gz | 0:0 1:150 | A:1188586431;C:1058258572;G:1080153332;T:1190907666;N:155049 | 0 | 150 | 1188586431 | 1058258572 | 1080153332 | 1190907666 | 155049 | SRX3091807 | SRS2429165 | SRA598900 | China Agricultural University|College of Sciences | China Agricultural University | 1 | 0.92512 | 0.09744 | 0.69085 | 0.45772 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | China | 2017-08-14 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43415 | 43415 | SRR5931557 | SRX3091806 | SRS2429165 | SRP115388 | PRJNA397956 | Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads | PRJNA397956 | Whole Genome Sequencing | To evaluate underlying environmental risks of difenoconazole in aquatic organisms | To evaluate underlying environmental risks of difenoconazole in zebrafish embryo | Model organism or animal sample from Danio rerio | Zebrafish | strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal | without xxx | 397960 | 397960 | to evulate the environmental risks of difenoconazole in zebrafish embryo | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP115388 | 4518061050.0 | 30120407.0 | CK 3 1.fq.gz | 0:150 1:0 | A:1195164171;C:1059996453;G:1074722334;T:1188143044;N:35048 | 150 | 0 | 1195164171 | 1059996453 | 1074722334 | 1188143044 | 35048 | SRX3091806 | SRS2429165 | SRA598900 | China Agricultural University|College of Sciences | China Agricultural University | 1 | 0.9249 | 0.09772 | 0.68562 | 0.45606 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | China | 2017-08-14 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43416 | 43416 | SRR5931558 | SRX3091805 | SRS2429165 | SRP115388 | PRJNA397956 | Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads | PRJNA397956 | Whole Genome Sequencing | To evaluate underlying environmental risks of difenoconazole in aquatic organisms | To evaluate underlying environmental risks of difenoconazole in zebrafish embryo | Model organism or animal sample from Danio rerio | Zebrafish | strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal | with difenoconazole | 397963 | 397963 | to evulate the environmental risks of difenoconazole in zebrafish embryo | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP115388 | 4572900600.0 | 30486004.0 | D 50 1 2.fq.gz | 0:0 1:150 | A:1218364634;C:1054987971;G:1079106780;T:1220261884;N:179331 | 0 | 150 | 1218364634 | 1054987971 | 1079106780 | 1220261884 | 179331 | SRX3091805 | SRS2429165 | SRA598900 | China Agricultural University|College of Sciences | China Agricultural University | 1 | 0.91953 | 0.11512 | 0.68722 | 0.45056 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | China | 2017-08-14 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43417 | 43417 | SRR5931559 | SRX3091804 | SRS2429165 | SRP115388 | PRJNA397956 | Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads | PRJNA397956 | Whole Genome Sequencing | To evaluate underlying environmental risks of difenoconazole in aquatic organisms | To evaluate underlying environmental risks of difenoconazole in zebrafish embryo | Model organism or animal sample from Danio rerio | Zebrafish | strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal | with difenoconazole | 397962 | 397962 | to evulate the environmental risks of difenoconazole in zebrafish embryo | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP115388 | 4572900600.0 | 30486004.0 | D 50 1 1.fq.gz | 0:150 1:0 | A:1223844243;C:1057030107;G:1074694968;T:1217286959;N:44323 | 150 | 0 | 1223844243 | 1057030107 | 1074694968 | 1217286959 | 44323 | SRX3091804 | SRS2429165 | SRA598900 | China Agricultural University|College of Sciences | China Agricultural University | 1 | 0.91779 | 0.1149 | 0.68258 | 0.46006 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | China | 2017-08-14 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43418 | 43418 | SRR5931560 | SRX3091803 | SRS2429165 | SRP115388 | PRJNA397956 | Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads | PRJNA397956 | Whole Genome Sequencing | To evaluate underlying environmental risks of difenoconazole in aquatic organisms | To evaluate underlying environmental risks of difenoconazole in zebrafish embryo | Model organism or animal sample from Danio rerio | Zebrafish | strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal | with difenoconazole | 397965 | 397965 | to evulate the environmental risks of difenoconazole in zebrafish embryo | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP115388 | 4595232150.0 | 30634881.0 | D 50 2 2.fq.gz | 0:0 1:150 | A:1225033548;C:1062169088;G:1082021478;T:1225833369;N:174667 | 0 | 150 | 1225033548 | 1062169088 | 1082021478 | 1225833369 | 174667 | SRX3091803 | SRS2429165 | SRA598900 | China Agricultural University|College of Sciences | China Agricultural University | 1 | 0.91827 | 0.11697 | 0.68511 | 0.44407 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | China | 2017-08-14 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43419 | 43419 | SRR5931561 | SRX3091802 | SRS2429165 | SRP115388 | PRJNA397956 | Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads | PRJNA397956 | Whole Genome Sequencing | To evaluate underlying environmental risks of difenoconazole in aquatic organisms | To evaluate underlying environmental risks of difenoconazole in zebrafish embryo | Model organism or animal sample from Danio rerio | Zebrafish | strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal | with difenoconazole | 397964 | 397964 | to evulate the environmental risks of difenoconazole in zebrafish embryo | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP115388 | 4595232150.0 | 30634881.0 | D 50 2 1.fq.gz | 0:150 1:0 | A:1231719851;C:1064618233;G:1076698645;T:1222155912;N:39509 | 150 | 0 | 1231719851 | 1064618233 | 1076698645 | 1222155912 | 39509 | SRX3091802 | SRS2429165 | SRA598900 | China Agricultural University|College of Sciences | China Agricultural University | B | usable mapping rate | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | China | 2017-08-14 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||||||||
| 43458 | 43458 | SRR5952027 | SRX3110521 | SRS2445614 | SRP115900 | PRJNA399133 | RNA seq profiling of the Tgmyo6b:GFP 2A rpl10a 3xHA zebrafish hair cell IP vs. whole fish IN | GSE102861 | Transcriptome Analysis | We have developed and tested the efficiency of the Tgmyo6b:GFP 2A rpl10a 3xHA zebrafish to specifically enrich for and evaluate the translatome of inner ear and lateral line sensory hair cells IP compared to the whole fish transcriptome IN. We show through RNA seq that HA tagged ribosome immunoprecipitation significantly enriches for RNA transcripts of known zebrafish hair cell expressed transcripts. Overall design: Tgmyo6b:GFP 2A rpl10a 3xHA were homogenized at 5dpf and the hair cell translatome was enriched for by HA tagged ribosome immunoprecipitation followed by RNA extraction. IP samples were compared to input RNA controls IN in independent biological triplicates. | pubmed:29765956 | IP HCtranslatome RNAseq rep3 | GSM2747294 | source name:Tgmyo6b:GFP 2A rpl10a 3xHA|developmental stage:5dpf|tissue:hair cells enriched|antibody:HA | IP HCtranslatome RNAseq rep3 | Base calls were performed using the built in Illumina basecaller Sequenced reads were trimmed for adaptor sequence and then mapped to Mouse GRCm38 reference using the TopHat splice aware aligner Reads Per Kilobase of gene per Million mapped reads RPKM were calculated for each sample. Differential expression of genes were computed between infected and uninfected samples Genome build: Danio rerioGRCz10 Supplementary files format and content: tab delimited text files include RPKM values for each sample | Tgmyo6b:GFP 2A rpl10a 3xHA | Untreated | RNA was isolated from the infected mouse tissues using the Qiagen Rneasy mini kit Cat#74104.HC translatome was enriched for by ribosome immunoprecipitation using an HA antibody see manuscript for full protocol Libraries were prepared from 25ng of RNA using the TruSeq RNA Sample Prep kit Illumina per manufacturer’s instructions with an additional PCR cycle.RNA libraries were prepared for sequencing using standard Illumina protocols | embryos were grown at 28 degrees C in E3 media until 5dpf | developmental stage:5dpf|tissue:hair cells enriched|antibody:HA | GSM2747294 | GSM2747294: IP HCtranslatome RNAseq rep3; Danio rerio; RIP Seq | GSM2747294 | 1 | RNA was isolated from the infected mouse tissues using the Qiagen Rneasy mini kit Cat#74104.HC translatome was enriched for by ribosome immunoprecipitation using an HA antibody see manuscript for full protocol Libraries were prepared from 25ng of RNA using the TruSeq RNA Sample Prep kit Illumina per manufacturer’s instructions with an additional PCR cycle.RNA libraries were prepared for sequencing using standard Illumina protocols | GEO Accession:GSM2747294 | RIP-Seq | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina HiSeq 4000 | SRP115900 | RiboZF_IP4_R1.fastq.gz RiboZF_IP4_R2.fastq.gz | fastq fastq | 4994833580.0 | 33330363.0 | GSM2747294 r1 | 0:74.96 1:74.90 | A:1202677579;C:1288784412;G:1278463604;T:1223941397;N:966588 | 74 | 74 | 1202677579 | 1288784412 | 1278463604 | 1223941397 | 966588 | SRX3110521 | SRS2445614 | SRA601675 | GEO | Department: Institute for Genome Sciences, University of Maryland in Baltimore | 2 | 0.61854 | 0.6151 | 0.20328 | 0.19651 | 0.83599 | 0.84104 | 0.60632 | 0.59954 | 75 | 75 | B | B | biological fallback assumption | illumina | hiseq_era | full_length | random_priming | trueseq | bulk | unknown | unknown | United States | 2017-08-21 | Larval | Larval | Embryo Imprecise | All anatomical structures | ||||||||||
| 43459 | 43459 | SRR5952026 | SRX3110520 | SRS2445613 | SRP115900 | PRJNA399133 | RNA seq profiling of the Tgmyo6b:GFP 2A rpl10a 3xHA zebrafish hair cell IP vs. whole fish IN | GSE102861 | Transcriptome Analysis | We have developed and tested the efficiency of the Tgmyo6b:GFP 2A rpl10a 3xHA zebrafish to specifically enrich for and evaluate the translatome of inner ear and lateral line sensory hair cells IP compared to the whole fish transcriptome IN. We show through RNA seq that HA tagged ribosome immunoprecipitation significantly enriches for RNA transcripts of known zebrafish hair cell expressed transcripts. Overall design: Tgmyo6b:GFP 2A rpl10a 3xHA were homogenized at 5dpf and the hair cell translatome was enriched for by HA tagged ribosome immunoprecipitation followed by RNA extraction. IP samples were compared to input RNA controls IN in independent biological triplicates. | pubmed:29765956 | IP HCtranslatome RNAseq rep2 | GSM2747293 | source name:Tgmyo6b:GFP 2A rpl10a 3xHA|developmental stage:5dpf|tissue:hair cells enriched|antibody:HA | IP HCtranslatome RNAseq rep2 | Base calls were performed using the built in Illumina basecaller Sequenced reads were trimmed for adaptor sequence and then mapped to Mouse GRCm38 reference using the TopHat splice aware aligner Reads Per Kilobase of gene per Million mapped reads RPKM were calculated for each sample. Differential expression of genes were computed between infected and uninfected samples Genome build: Danio rerioGRCz10 Supplementary files format and content: tab delimited text files include RPKM values for each sample | Tgmyo6b:GFP 2A rpl10a 3xHA | Untreated | RNA was isolated from the infected mouse tissues using the Qiagen Rneasy mini kit Cat#74104.HC translatome was enriched for by ribosome immunoprecipitation using an HA antibody see manuscript for full protocol Libraries were prepared from 25ng of RNA using the TruSeq RNA Sample Prep kit Illumina per manufacturer’s instructions with an additional PCR cycle.RNA libraries were prepared for sequencing using standard Illumina protocols | embryos were grown at 28 degrees C in E3 media until 5dpf | developmental stage:5dpf|tissue:hair cells enriched|antibody:HA | GSM2747293 | GSM2747293: IP HCtranslatome RNAseq rep2; Danio rerio; RIP Seq | GSM2747293 | 1 | RNA was isolated from the infected mouse tissues using the Qiagen Rneasy mini kit Cat#74104.HC translatome was enriched for by ribosome immunoprecipitation using an HA antibody see manuscript for full protocol Libraries were prepared from 25ng of RNA using the TruSeq RNA Sample Prep kit Illumina per manufacturer’s instructions with an additional PCR cycle.RNA libraries were prepared for sequencing using standard Illumina protocols | GEO Accession:GSM2747293 | RIP-Seq | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina HiSeq 4000 | SRP115900 | RiboZF_IP2_R1.fastq.gz RiboZF_IP2_R2.fastq.gz | fastq fastq | 4530855300.0 | 30205702.0 | GSM2747293 r1 | 0:75 1:75 | A:1112381418;C:1153277132;G:1147183468;T:1117133915;N:879367 | 75 | 75 | 1112381418 | 1153277132 | 1147183468 | 1117133915 | 879367 | SRX3110520 | SRS2445613 | SRA601675 | GEO | Department: Institute for Genome Sciences, University of Maryland in Baltimore | 2 | 0.64948 | 0.64878 | 0.15967 | 0.15683 | 0.80756 | 0.81288 | 0.56438 | 0.56275 | 75 | 75 | B | B | biological fallback assumption | illumina | hiseq_era | full_length | random_priming | trueseq | bulk | unknown | unknown | United States | 2017-08-21 | Larval | Larval | Embryo Imprecise | All anatomical structures | ||||||||||
| 43460 | 43460 | SRR5952025 | SRX3110519 | SRS2445612 | SRP115900 | PRJNA399133 | RNA seq profiling of the Tgmyo6b:GFP 2A rpl10a 3xHA zebrafish hair cell IP vs. whole fish IN | GSE102861 | Transcriptome Analysis | We have developed and tested the efficiency of the Tgmyo6b:GFP 2A rpl10a 3xHA zebrafish to specifically enrich for and evaluate the translatome of inner ear and lateral line sensory hair cells IP compared to the whole fish transcriptome IN. We show through RNA seq that HA tagged ribosome immunoprecipitation significantly enriches for RNA transcripts of known zebrafish hair cell expressed transcripts. Overall design: Tgmyo6b:GFP 2A rpl10a 3xHA were homogenized at 5dpf and the hair cell translatome was enriched for by HA tagged ribosome immunoprecipitation followed by RNA extraction. IP samples were compared to input RNA controls IN in independent biological triplicates. | pubmed:29765956 | IP HCtranslatome RNAseq rep1 | GSM2747292 | source name:Tgmyo6b:GFP 2A rpl10a 3xHA|developmental stage:5dpf|tissue:hair cells enriched|antibody:HA | IP HCtranslatome RNAseq rep1 | Base calls were performed using the built in Illumina basecaller Sequenced reads were trimmed for adaptor sequence and then mapped to Mouse GRCm38 reference using the TopHat splice aware aligner Reads Per Kilobase of gene per Million mapped reads RPKM were calculated for each sample. Differential expression of genes were computed between infected and uninfected samples Genome build: Danio rerioGRCz10 Supplementary files format and content: tab delimited text files include RPKM values for each sample | Tgmyo6b:GFP 2A rpl10a 3xHA | Untreated | RNA was isolated from the infected mouse tissues using the Qiagen Rneasy mini kit Cat#74104.HC translatome was enriched for by ribosome immunoprecipitation using an HA antibody see manuscript for full protocol Libraries were prepared from 25ng of RNA using the TruSeq RNA Sample Prep kit Illumina per manufacturer’s instructions with an additional PCR cycle.RNA libraries were prepared for sequencing using standard Illumina protocols | embryos were grown at 28 degrees C in E3 media until 5dpf | developmental stage:5dpf|tissue:hair cells enriched|antibody:HA | GSM2747292 | GSM2747292: IP HCtranslatome RNAseq rep1; Danio rerio; RIP Seq | GSM2747292 | 1 | RNA was isolated from the infected mouse tissues using the Qiagen Rneasy mini kit Cat#74104.HC translatome was enriched for by ribosome immunoprecipitation using an HA antibody see manuscript for full protocol Libraries were prepared from 25ng of RNA using the TruSeq RNA Sample Prep kit Illumina per manufacturer’s instructions with an additional PCR cycle.RNA libraries were prepared for sequencing using standard Illumina protocols | GEO Accession:GSM2747292 | RIP-Seq | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina HiSeq 4000 | SRP115900 | RiboZF_IP1_R1.fastq.gz RiboZF_IP1_R2.fastq.gz | fastq fastq | 5261113350.0 | 35074089.0 | GSM2747292 r1 | 0:75 1:75 | A:1356848229;C:1276483567;G:1260001700;T:1366757927;N:1021927 | 75 | 75 | 1356848229 | 1276483567 | 1260001700 | 1366757927 | 1021927 | SRX3110519 | SRS2445612 | SRA601675 | GEO | Department: Institute for Genome Sciences, University of Maryland in Baltimore | 2 | 0.66363 | 0.6599 | 0.15644 | 0.15316 | 0.76808 | 0.7725 | 0.48538 | 0.48933 | 75 | 75 | B | B | biological fallback assumption | illumina | hiseq_era | full_length | random_priming | trueseq | bulk | unknown | unknown | United States | 2017-08-21 | Larval | Larval | Embryo Imprecise | All anatomical structures | ||||||||||
| 44650 | 44650 | SRR6268198 | SRX3374366 | SRS2671592 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | rep A 10h | GSM2845352 | source name:zebrafish embryos|developmental stage:10hpf|tissue:embryo | rep A 10h | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:10hpf|tissue:embryo | GSM2845352 | GSM2845352: rep A 10h; Danio rerio; OTHER | GSM2845352 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845352 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | 10hpf.fastq.gz | fastq | 267594560.0 | 1672466.0 | GSM2845352 r1 | 0:160 1:0 | A:87249429;C:58556737;G:48918401;T:72845229;N:24764 | 160 | 0 | 87249429 | 58556737 | 48918401 | 72845229 | 24764 | SRX3374366 | SRS2671592 | SRA629220 | GEO | Broad Institute | 1 | 2e-05 | 0.0 | 0.99995 | 0.5 | 160 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 44651 | 44651 | SRR6268197 | SRX3374365 | SRS2671591 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | rep A 8h | GSM2845351 | source name:zebrafish embryos|developmental stage:8hpf|tissue:embryo | rep A 8h | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:8hpf|tissue:embryo | GSM2845351 | GSM2845351: rep A 8h; Danio rerio; OTHER | GSM2845351 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845351 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | 8hpf.fastq.gz | fastq | 277648000.0 | 1735300.0 | GSM2845351 r1 | 0:160 1:0 | A:88447999;C:60766591;G:51931752;T:76474911;N:26747 | 160 | 0 | 88447999 | 60766591 | 51931752 | 76474911 | 26747 | SRX3374365 | SRS2671591 | SRA629220 | GEO | Broad Institute | 1 | 0.0 | 0.0 | 1.0 | 160 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 44652 | 44652 | SRR6268196 | SRX3374364 | SRS2671590 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | rep A 6h.3 | GSM2845350 | source name:zebrafish embryos|developmental stage:6hpf|tissue:embryo | rep A 6h.3 | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:6hpf|tissue:embryo | GSM2845350 | GSM2845350: rep A 6h.3; Danio rerio; OTHER | GSM2845350 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845350 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | 6hpf.fastq.gz | fastq | 321713920.0 | 2010712.0 | GSM2845350 r1 | 0:160 1:0 | A:108106130;C:67673948;G:57401886;T:88504064;N:27892 | 160 | 0 | 108106130 | 67673948 | 57401886 | 88504064 | 27892 | SRX3374364 | SRS2671590 | SRA629220 | GEO | Broad Institute | 1 | 4e-05 | 0.0 | 0.99985 | 0.57142 | 160 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 44653 | 44653 | SRR6268195 | SRX3374363 | SRS2671589 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | rep A 6h.2 | GSM2845349 | source name:zebrafish embryos|developmental stage:6hpf|tissue:embryo | rep A 6h.2 | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:6hpf|tissue:embryo | GSM2845349 | GSM2845349: rep A 6h.2; Danio rerio; OTHER | GSM2845349 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845349 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | 4hpf-3.fastq.gz | fastq | 469592000.0 | 2934950.0 | GSM2845349 r1 | 0:160 1:0 | A:149657114;C:104627528;G:87984247;T:127285382;N:37729 | 160 | 0 | 149657114 | 104627528 | 87984247 | 127285382 | 37729 | SRX3374363 | SRS2671589 | SRA629220 | GEO | Broad Institute | 1 | 1e-05 | 0.0 | 0.99997 | 0.0 | 160 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 44654 | 44654 | SRR6268194 | SRX3374362 | SRS2671588 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | rep A 6h.1 | GSM2845348 | source name:zebrafish embryos|developmental stage:6hpf|tissue:embryo | rep A 6h.1 | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:6hpf|tissue:embryo | GSM2845348 | GSM2845348: rep A 6h.1; Danio rerio; OTHER | GSM2845348 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845348 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | 4hpf-2.fastq.gz | fastq | 450388640.0 | 2814929.0 | GSM2845348 r1 | 0:160 1:0 | A:143486047;C:99354304;G:85285329;T:122222711;N:40249 | 160 | 0 | 143486047 | 99354304 | 85285329 | 122222711 | 40249 | SRX3374362 | SRS2671588 | SRA629220 | GEO | Broad Institute | 1 | 3e-05 | 0.0 | 0.99991 | 0.5 | 160 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 44655 | 44655 | SRR6268193 | SRX3374361 | SRS2671586 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | rep A 4h | GSM2845347 | source name:zebrafish embryos|developmental stage:4hpf|tissue:embryo | rep A 4h | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:4hpf|tissue:embryo | GSM2845347 | GSM2845347: rep A 4h; Danio rerio; OTHER | GSM2845347 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845347 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | 4hpf-1.fastq.gz | fastq | 443483200.0 | 2771770.0 | GSM2845347 r1 | 0:160 1:0 | A:139383281;C:100368800;G:84425873;T:119267938;N:37308 | 160 | 0 | 139383281 | 100368800 | 84425873 | 119267938 | 37308 | SRX3374361 | SRS2671586 | SRA629220 | GEO | Broad Institute | 1 | 2e-05 | 0.0 | 0.99995 | 0.5 | 160 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 44656 | 44656 | SRR6268192 | SRX3374360 | SRS2671587 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | rep A 3h | GSM2845346 | source name:zebrafish embryos|developmental stage:3hpf|tissue:embryo | rep A 3h | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:3hpf|tissue:embryo | GSM2845346 | GSM2845346: rep A 3h; Danio rerio; OTHER | GSM2845346 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845346 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | 3hpf.fastq.gz | fastq | 557489280.0 | 3484308.0 | GSM2845346 r1 | 0:160 1:0 | A:174273480;C:125862121;G:107763308;T:149536497;N:53874 | 160 | 0 | 174273480 | 125862121 | 107763308 | 149536497 | 53874 | SRX3374360 | SRS2671587 | SRA629220 | GEO | Broad Institute | 1 | 6e-05 | 0.0 | 0.99981 | 0.22222 | 160 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 44657 | 44657 | SRR6268191 | SRX3374359 | SRS2671600 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | rep A 2h | GSM2845345 | source name:zebrafish embryos|developmental stage:2hpf|tissue:embryo | rep A 2h | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:2hpf|tissue:embryo | GSM2845345 | GSM2845345: rep A 2h; Danio rerio; OTHER | GSM2845345 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845345 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | 2hpf.fastq.gz | fastq | 530420800.0 | 3315130.0 | GSM2845345 r1 | 0:160 1:0 | A:164669564;C:122876218;G:102801422;T:140026363;N:47233 | 160 | 0 | 164669564 | 122876218 | 102801422 | 140026363 | 47233 | SRX3374359 | SRS2671600 | SRA629220 | GEO | Broad Institute | 1 | 5e-05 | 0.0 | 0.99985 | 0.71428 | 160 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 44658 | 44658 | SRR6268190 | SRX3374358 | SRS2671585 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | rep A 1h | GSM2845344 | source name:zebrafish embryos|developmental stage:1hpf|tissue:embryo | rep A 1h | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:1hpf|tissue:embryo | GSM2845344 | GSM2845344: rep A 1h; Danio rerio; OTHER | GSM2845344 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845344 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | 1hpf.fastq.gz | fastq | 560763840.0 | 3504774.0 | GSM2845344 r1 | 0:160 1:0 | A:175204436;C:129606168;G:108093534;T:147808098;N:51604 | 160 | 0 | 175204436 | 129606168 | 108093534 | 147808098 | 51604 | SRX3374358 | SRS2671585 | SRA629220 | GEO | Broad Institute | 1 | 2e-05 | 0.0 | 0.99995 | 0.0 | 160 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 44659 | 44659 | SRR6268189 | SRX3374357 | SRS2671584 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | rep A uninjected | GSM2845343 | source name:zebrafish embryos|developmental stage:NA|tissue:embryo | rep A uninjected | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:NA|tissue:embryo | GSM2845343 | GSM2845343: rep A uninjected; Danio rerio; OTHER | GSM2845343 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845343 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | SpeI-pool.fastq.gz | fastq | 2026742240.0 | 12667139.0 | GSM2845343 r1 | 0:160 1:0 | A:625744065;C:476430927;G:385335893;T:539051959;N:179396 | 160 | 0 | 625744065 | 476430927 | 385335893 | 539051959 | 179396 | SRX3374357 | SRS2671584 | SRA629220 | GEO | Broad Institute | 1 | 4e-05 | 0.0 | 0.99987 | 0.16666 | 160 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Zygote | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 44660 | 44660 | SRR6268188 | SRX3374356 | SRS2671583 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | techrep A+ 10h.2 | GSM2845342 | source name:zebrafish embryos|developmental stage:10hpf|tissue:embryo | techrep A+ 10h.2 | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:10hpf|tissue:embryo | GSM2845342 | GSM2845342: techrep A+ 10h.2; Danio rerio; OTHER | GSM2845342 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845342 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | AR24_S24.fastq.gz | fastq | 152993736.0 | 910677.0 | GSM2845342 r1 | 0:168 1:0 | A:51571958;C:32339728;G:27945885;T:41135710;N:455 | 168 | 0 | 51571958 | 32339728 | 27945885 | 41135710 | 455 | SRX3374356 | SRS2671583 | SRA629220 | GEO | Broad Institute | 1 | 5e-05 | 0.0 | 0.99989 | 0.5 | 168 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 44661 | 44661 | SRR6268187 | SRX3374355 | SRS2671580 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | techrep A+ 9h.2 | GSM2845341 | source name:zebrafish embryos|developmental stage:9hpf|tissue:embryo | techrep A+ 9h.2 | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:9hpf|tissue:embryo | GSM2845341 | GSM2845341: techrep A+ 9h.2; Danio rerio; OTHER | GSM2845341 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845341 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | AR23_S23.fastq.gz | fastq | 170881704.0 | 1017153.0 | GSM2845341 r1 | 0:168 1:0 | A:58715337;C:35449423;G:30006312;T:46710126;N:506 | 168 | 0 | 58715337 | 35449423 | 30006312 | 46710126 | 506 | SRX3374355 | SRS2671580 | SRA629220 | GEO | Broad Institute | 1 | 2e-05 | 0.0 | 0.99995 | 0.5 | 168 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 44662 | 44662 | SRR6268186 | SRX3374354 | SRS2671582 | SRP124609 | PRJNA417597 | Massively parallel reporter assay of three primeUTR sequences identifies in vivo rules for mRNA degradation | GSE106677 | Other | The stability of mRNAs is regulated by signals within their sequences but a systematic and predictive understanding of the underlying sequence rules remains elusive. Here we introduce UTR Seq a combination of massively parallel reporter assays and regression models to survey the dynamics of tens of thousands of three primeUTR sequences during early zebrafish embryogenesis. UTR Seq revealed two temporal degradation programs: a maternally encoded early onset program and a late onset program that accelerated degradation post zygotic genome activation. Three signals regulated early onset rates: stabilizing poly U and UUAG sequences and destabilizing GC rich signals. Three signals explained late onset degradation: miR 430 seeds AU rich sequences and Pumilio recognition sites. Sequence based regression models translated three primeUTRs into their unique decay patterns and predicted the in vivo impact of sequence signals on mRNA stability. Their application led to the successful design of artificial three primeUTRs that conferred specific mRNA dynamics. UTR Seq provides a general strategy to uncover the rules of RNA cis regulation. Overall design: temporal expression profiles of reporter mRNAs from zebrafish embryos 7 replicates total or oocytes 2 replicates total. A total of five embryo replicates were collected using pre adenylated A+ reporters in three separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment a single sample was collected every hour between 1h to 10h and split into two post RNA extraction to produce two technical replicates techrep. In the third experiment two separate samples were collected every two hours between 2h to 10h to produce two same day biological replicates biorep. A total of two replicates were collected using non adenylated A reporters in two separate experiments. In the first experiment a sample was collected every hour between 1h to 8h and at 10h. In the second experiment rep samples were coll… | pubmed:29225039 | techrep A+ 8h.2 | GSM2845340 | source name:zebrafish embryos|developmental stage:8hpf|tissue:embryo | techrep A+ 8h.2 | Library strategy: UTR Seq data 160nt reads was filtered to retain only sequences that contained both terminal adapter sequences with up to 10 mismatches and an insert of 90nt or longer. data 100nt reads was filtered to retain only sequences that contained the 5’ terminal adapter sequence with up to 10 mismatches and an insert of 62nt or longer. Bowtie2 was used to align retained reads to a reference set of all 90 000 synthetic oligonucleotide sequences The number of UMIs that were mapped to each oligonucleotide sequence was recorded and adjusted to represent the expected number of mRNA molecules in the sample. A generalized binomial linear regression model was fitted to counts of five control mRNAs that were added to samples at known quantities in 2 fold increments highest 50fg lowest 3.125fg and the resulting linear transformation was used to normalize UMI counts. Genome build: The file sequences.txt is a FASTA file with the oligonucleotide sequences used for real alignment. This file is available on the series record. Supplementary files format and content: tab delimited files of normalized mRNA levels | zebrafish embryos | Embryos/oocytes were removed from their chorion and injected with 50 80pg of reporter mRNAs at the one cell stage. | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known 3’UTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant 3’UTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant 3’UTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | Fertilized zebrafish eggs or oocytes were collected at 28C and kept in culture medium 5.03mM NaCl 0.17mM KCl 0.33mM CaCl2 0.33mM MgSo4 0.1% Methylene blue. A total of 20 40 injected embryos/oocytes were randomly collected per sample post ensuring that all embryos were at the same expected developmental stage. | developmental stage:8hpf|tissue:embryo | GSM2845340 | GSM2845340: techrep A+ 8h.2; Danio rerio; OTHER | GSM2845340 | 1 | Total RNA was isolated using TRIzol Invitrogen post adding 120fg of mRNA with 5 known three primeUTR control sequences into each RNA sample during the initial TRIzol lysis step. In the first step total RNA was reverse transcribed with Maxima RT Thermo Fisher and a gene specific primer that matched the constant three primeUTR of mRNA reporters. RT primer also added a random 8nt UMI and a constant RT adaptor sequence. In the second step resulting cDNA was amplified by 18 cycles of Phusion PCR with primers that matched the reporter's constant three primeUTR sequence and the RT adaptor. PCR primers also added the appropriate Illumina sample barcodes and sequencing. adaptors | GEO Accession:GSM2845340 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina MiSeq | SRP124609 | AR22_S22.fastq.gz | fastq | 162500520.0 | 967265.0 | GSM2845340 r1 | 0:168 1:0 | A:56281233;C:33095421;G:28617222;T:44506190;N:454 | 168 | 0 | 56281233 | 33095421 | 28617222 | 44506190 | 454 | SRX3374354 | SRS2671582 | SRA629220 | GEO | Broad Institute | 1 | 2e-05 | 0.0 | 0.99995 | 1.0 | 168 | T | under 1.2% mapping rate | illumina | miseq | unknown | random_priming | unknown | bulk | unknown | unknown | United States | 2017-11-08 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures |
Advanced export
JSON shape: default, array, newline-delimited
CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;