RNAquarium Metadata Server
Institute Website Terms of Use Privacy Policy

run_metadata

39 rows where experiment.library_selection = "other", experiment.library_strategy = "RNA-Seq" and tissue_curation = "Embryo Imprecise"

✎ View and edit SQL

This data as json, CSV (advanced)

devstage_curation 6

technology 2

experiment.library_source 2

experiment.library_layout 2

tissue_curation_coarse 1

tissue_curation 1

  • Embryo Imprecise · 39 ✖

experiment.platform 1

experiment.library_strategy 1

  • RNA-Seq · 39 ✖

experiment.library_selection 1

  • other · 39 ✖

devstage_curation_coarse 1

Link rowid ▼ run.accession experiment.accession sample.accession study.accession bioproject study.title study.alias study.type study.abstract study.attributes study.PMIDs sample.description sample.title sample.alias sample.centername sample.attributes GEOsample.title GEOsample.dataprocessing GEOsample.source GEOsample.treatmentprotocol GEOsample.extractprotocol GEOsample.growthprotocol GEOsample.characteristics GEOsample.accession experiment.title experiment.alias experiment.library_name experiment.design_description experiment.library_construction_protocol experiment.attributes experiment.library_strategy experiment.library_source experiment.library_selection experiment.library_layout experiment.platform experiment.instrument_model experiment.spot_descriptor experiment.study_ref run.title run.attributes run.filename run.semantic_name run.total_bases run.total_spots run.alias run.read_lengths run.base_counts run.r1_length run.r2_length run.r3_length run.r4_length run.Acount run.Ccount run.Gcount run.Tcount run.Ncount run.experiment run.pool_member submission.accession submission.srasource submission.bioprojectsource seqdetective.n_mates seqdetective.mapping_rate.mate1 seqdetective.mapping_rate.mate2 seqdetective.nofeature_rate.mate1 seqdetective.nofeature_rate.mate2 seqdetective.sparsity.mate1 seqdetective.sparsity.mate2 seqdetective.pos_strand_rate.mate1 seqdetective.pos_strand_rate.mate2 seqdetective.readlen.mate1 seqdetective.readlen.mate2 seqdetective.judgement.mate1 seqdetective.judgement.mate2 seqdetective.judgement.reason platform_family instrument_generation read_bias selection_class prep_kit sc_or_bulk tech_class technology tech_variant submission.bioprojectsource.country earliest_date devstage_curation devstage_curation_coarse tissue_curation tissue_curation_coarse
36265 36265 SRR058073 SRX022206 SRS084221 SRP002640 PRJNA128943 Expanding the MicroRNA Targeting Code: A Novel Type of Site with Centered Pairing GSE22068 Other We present “centered sites ” a class of microRNA target sites that lacks both perfect seed pairing and three prime compensatory pairing and instead has 11–12 contiguous Watson–Crick pairs to the center of the microRNA. In elevated Mg2+ centered sites impart mRNA cleavage but in cells centered sites repress protein output without xxx Agronaute catalyzed cleavage. Our study also identified novel extensively paired sites that are cleavage substrates in cultured cells and human brain. This expanded repertoire of cleavage targets and the identification of the centered site type help explain why central regions of many microRNAs are evolutionarily conserved. Overall design: To study centered sites and identify miRNA cleavage targets mRNA degradomes were sequenced from human brain and HeLa cells and smallRNAs were sequenced from human brain and zebrafish embryo at 24 hpf. Replicates were combined before the analysis. Fastq files are not available for GSM548638 and GSM548639.   pubmed:20620952   Zebrafish Embryo small RNAs GSM548640   source name:Embryo Cells|data type:small RNAs|tissue:embryo Zebrafish Embryo small RNAs Small RNA sequences from same total RNA samples were mapped to the human genome hg18 requiring a perfect match and reads co localizing to annotated miRNA loci miRBase version 11.0 were counted. sequence reads are summarized as frequency counts Embryo Cells   The small RNA cDNA libraries were made as described Grimson et al. 2008 except for the three prime adaptor ligation which was five prime adenylated pTCGTATGCCGTCTTCTGCTTGidT. For a detailed protocol see http://web.wi.mit.edu/bartel/pub/protocols.html.   data type:small RNAs|tissue:embryo GSM548640 GSM548640: Zebrafish Embryo small RNAs GSM548640: Zebrafish Embryo small RNAs GSM548640: Zebrafish Embryo small RNAs 1   GEO Accession:GSM548640 RNA-Seq TRANSCRIPTOMIC other SINGLE ILLUMINA Illumina Genome Analyzer <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP002640   quality book char:@|quality scoring system:log odds Zebrafish_embryo_24h.fastq fastq 62213148.0 1728143.0 GSM548640 1 0:36 A:13550515;C:14269249;G:15670049;T:18673533;N:49802 36       13550515 14269249 15670049 18673533 49802 SRX022206 SRS084221 SRA020539 GEO Bartel lab, Whitehead Institute 1 0.02298   0.02186   0.9988   0.3246   36   B   usable mapping rate illumina early_illumina unknown small_rna unknown bulk unknown unknown   United States 2010-06-01 Undetermined Embryo Embryo Imprecise All anatomical structures
40214 40214 SRR2982513 SRX1471725 SRS1197481 SRP067139 PRJNA305418 RiboZero mRNA seq across zebrafish development for study of uORFs PRJNA305418 Other Untranslated mRNA regionsUTRs are key mediators of post transcriptional regulation. Previous studies have predicted thousands of ORFs in five prime'UTRs the vast majority of which have unknown function. We present a systematic analysis of the translation and function of upstream open reading framesuORFs across vertebrates. Combining high resolution ribosome footprinting and phasing we find that i uORFs are pervasive within vertebrate transcriptomes ii the majority show signatures of active translation and iii uORFs act as potent regulators of translation and RNA levels with a similar magnitude to miRNAs. Evolution has targeted sequence features to mitigate the effects of constitutively repressive uORFs. Finally we observe that the regulatory potential of uORFs on individual genes is conserved across species. These results provide insight into the regulatory code within mRNA leader sequences and their capacity to modulate translation across vertebrates.The mRNA seq data contained in this archive were used along with ribosome profiling data to calculate translation efficiency values.       48hpf AG00751 mrna r0 48h   strain:TUAB|age:48hpf|sex:pooled male and female|tissue:embryo|genotype:wt|BioSampleModel:Model organism or animal                 AG00751 mrna r0 48h 48h mRNA R0 1 Twenty embryos per condition were collected from the same clutch from where the ribosome profiling timeseries was conducted.Bazzini et al 2014 Total RNA was isolated using 1mL of Trizol following manufacturer instructions. Ribosomal RNAs were depleted using Ribo Zero Epicentre/Illumina. Strand specific single end library was constructed according to the Illumina Sample Preparation Kit protocol using standard TruSeq adapters Libraries were prepared and sequenced in an Illumina Hi SEQ single end 75nt reads     RNA-Seq TRANSCRIPTOMIC other SINGLE ILLUMINA Illumina HiSeq 2000 <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>75</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP067139     AG00751_SEQ0112_R1.fastq.gz fastq 1859082512.0 24461612.0 48h mRNA R0 run1 0:76 A:488142494;C:422062452;G:411293722;T:537489879;N:93965 76       488142494 422062452 411293722 537489879 93965 SRX1471725 SRS1197481 SRA314809 Yale University|Giraldez Lab Yale University 1 0.8583   0.37297   0.6956   0.46541   76   B   usable mapping rate illumina hiseq_era unknown rrna_depletion trueseq bulk unknown unknown   United States 2015-12-08 Hatching Embryo Embryo Imprecise All anatomical structures
40215 40215 SRR2982514 SRX1471724 SRS1197482 SRP067139 PRJNA305418 RiboZero mRNA seq across zebrafish development for study of uORFs PRJNA305418 Other Untranslated mRNA regionsUTRs are key mediators of post transcriptional regulation. Previous studies have predicted thousands of ORFs in five prime'UTRs the vast majority of which have unknown function. We present a systematic analysis of the translation and function of upstream open reading framesuORFs across vertebrates. Combining high resolution ribosome footprinting and phasing we find that i uORFs are pervasive within vertebrate transcriptomes ii the majority show signatures of active translation and iii uORFs act as potent regulators of translation and RNA levels with a similar magnitude to miRNAs. Evolution has targeted sequence features to mitigate the effects of constitutively repressive uORFs. Finally we observe that the regulatory potential of uORFs on individual genes is conserved across species. These results provide insight into the regulatory code within mRNA leader sequences and their capacity to modulate translation across vertebrates.The mRNA seq data contained in this archive were used along with ribosome profiling data to calculate translation efficiency values.       24hpf AG00750 mrna r0 24h   strain:TUAB|age:24hpf|sex:pooled male and female|tissue:embryo|genotype:wt|BioSampleModel:Model organism or animal                 AG00750 mrna r0 24h 24h mRNA R0 1 Twenty embryos per condition were collected from the same clutch from where the ribosome profiling timeseries was conducted.Bazzini et al 2014 Total RNA was isolated using 1mL of Trizol following manufacturer instructions. Ribosomal RNAs were depleted using Ribo Zero Epicentre/Illumina. Strand specific single end library was constructed according to the Illumina Sample Preparation Kit protocol using standard TruSeq adapters Libraries were prepared and sequenced in an Illumina Hi SEQ single end 75nt reads     RNA-Seq TRANSCRIPTOMIC other SINGLE ILLUMINA Illumina HiSeq 2000 <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>75</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP067139     AG00750_SEQ0114_R1.fastq.gz fastq 2124277824.0 27951024.0 24h mRNA R0 run1 0:76 A:537946274;C:496576029;G:477023623;T:612576823;N:155075 76       537946274 496576029 477023623 612576823 155075 SRX1471724 SRS1197482 SRA314809 Yale University|Giraldez Lab Yale University 1 0.86054   0.27207   0.69877   0.47063   76   B   usable mapping rate illumina hiseq_era unknown rrna_depletion trueseq bulk unknown unknown   United States 2015-12-08 Pharyngula Embryo Embryo Imprecise All anatomical structures
40216 40216 SRR2982511 SRX1471723 SRS1197479 SRP067139 PRJNA305418 RiboZero mRNA seq across zebrafish development for study of uORFs PRJNA305418 Other Untranslated mRNA regionsUTRs are key mediators of post transcriptional regulation. Previous studies have predicted thousands of ORFs in five prime'UTRs the vast majority of which have unknown function. We present a systematic analysis of the translation and function of upstream open reading framesuORFs across vertebrates. Combining high resolution ribosome footprinting and phasing we find that i uORFs are pervasive within vertebrate transcriptomes ii the majority show signatures of active translation and iii uORFs act as potent regulators of translation and RNA levels with a similar magnitude to miRNAs. Evolution has targeted sequence features to mitigate the effects of constitutively repressive uORFs. Finally we observe that the regulatory potential of uORFs on individual genes is conserved across species. These results provide insight into the regulatory code within mRNA leader sequences and their capacity to modulate translation across vertebrates.The mRNA seq data contained in this archive were used along with ribosome profiling data to calculate translation efficiency values.       12hpf AG00434 mrna r0 12h   strain:TUAB|age:12hpf|sex:pooled male and female|tissue:embryo|genotype:wt|BioSampleModel:Model organism or animal                 AG00434 mrna r0 12h 12h mRNA R0 1 Twenty embryos per condition were collected from the same clutch from where the ribosome profiling timeseries was conducted.Bazzini et al 2014 Total RNA was isolated using 1mL of Trizol following manufacturer instructions. Ribosomal RNAs were depleted using Ribo Zero Epicentre/Illumina. Strand specific single end library was constructed according to the Illumina Sample Preparation Kit protocol using standard TruSeq adapters Libraries were prepared and sequenced in an Illumina Hi SEQ single end 75nt reads     RNA-Seq TRANSCRIPTOMIC other SINGLE ILLUMINA Illumina HiSeq 2000 <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>75</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP067139     AG00434_SEQ0071_R1.fastq.gz fastq 1990422368.0 26189768.0 12h mRNA R0 run1 0:76 A:512242204;C:469314942;G:452176134;T:556618667;N:70421 76       512242204 469314942 452176134 556618667 70421 SRX1471723 SRS1197479 SRA314809 Yale University|Giraldez Lab Yale University 1 0.88085   0.297   0.71711   0.46053   76   B   usable mapping rate illumina hiseq_era unknown rrna_depletion trueseq bulk unknown unknown   United States 2015-12-08 Segmentation Embryo Embryo Imprecise All anatomical structures
40217 40217 SRR2982512 SRX1471722 SRS1197480 SRP067139 PRJNA305418 RiboZero mRNA seq across zebrafish development for study of uORFs PRJNA305418 Other Untranslated mRNA regionsUTRs are key mediators of post transcriptional regulation. Previous studies have predicted thousands of ORFs in five prime'UTRs the vast majority of which have unknown function. We present a systematic analysis of the translation and function of upstream open reading framesuORFs across vertebrates. Combining high resolution ribosome footprinting and phasing we find that i uORFs are pervasive within vertebrate transcriptomes ii the majority show signatures of active translation and iii uORFs act as potent regulators of translation and RNA levels with a similar magnitude to miRNAs. Evolution has targeted sequence features to mitigate the effects of constitutively repressive uORFs. Finally we observe that the regulatory potential of uORFs on individual genes is conserved across species. These results provide insight into the regulatory code within mRNA leader sequences and their capacity to modulate translation across vertebrates.The mRNA seq data contained in this archive were used along with ribosome profiling data to calculate translation efficiency values.       5hpf AG00749 mrna r0 5h   strain:TUAB|age:5hpf|sex:pooled male and female|tissue:embryo|genotype:wt|BioSampleModel:Model organism or animal                 AG00749 mrna r0 5h 5h mRNA R0 1 Twenty embryos per condition were collected from the same clutch from where the ribosome profiling timeseries was conducted.Bazzini et al 2014 Total RNA was isolated using 1mL of Trizol following manufacturer instructions. Ribosomal RNAs were depleted using Ribo Zero Epicentre/Illumina. Strand specific single end library was constructed according to the Illumina Sample Preparation Kit protocol using standard TruSeq adapters Libraries were prepared and sequenced in an Illumina Hi SEQ single end 75nt reads     RNA-Seq TRANSCRIPTOMIC other SINGLE ILLUMINA Illumina HiSeq 2000 <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>75</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP067139     AG00749_SEQ0114_R1.fastq.gz fastq 3163721996.0 41627921.0 5h mRNA R0 run1 0:76 A:724093110;C:806620205;G:798759186;T:834042462;N:207033 76       724093110 806620205 798759186 834042462 207033 SRX1471722 SRS1197480 SRA314809 Yale University|Giraldez Lab Yale University 1 0.75274   0.23572   0.75448   0.47885   76   B   usable mapping rate illumina hiseq_era unknown rrna_depletion trueseq bulk unknown unknown   United States 2015-12-08 Blastula Embryo Embryo Imprecise All anatomical structures
40218 40218 SRR2982510 SRX1471511 SRS1197399 SRP067139 PRJNA305418 RiboZero mRNA seq across zebrafish development for study of uORFs PRJNA305418 Other Untranslated mRNA regionsUTRs are key mediators of post transcriptional regulation. Previous studies have predicted thousands of ORFs in five prime'UTRs the vast majority of which have unknown function. We present a systematic analysis of the translation and function of upstream open reading framesuORFs across vertebrates. Combining high resolution ribosome footprinting and phasing we find that i uORFs are pervasive within vertebrate transcriptomes ii the majority show signatures of active translation and iii uORFs act as potent regulators of translation and RNA levels with a similar magnitude to miRNAs. Evolution has targeted sequence features to mitigate the effects of constitutively repressive uORFs. Finally we observe that the regulatory potential of uORFs on individual genes is conserved across species. These results provide insight into the regulatory code within mRNA leader sequences and their capacity to modulate translation across vertebrates.The mRNA seq data contained in this archive were used along with ribosome profiling data to calculate translation efficiency values.       2hpf AG00244 mrna r0 2h   strain:TUAB|age:2hpf|sex:pooled male and female|tissue:embryo|genotype:wt|BioSampleModel:Model organism or animal                 AG00244 mrna r0 2h 2h mRNA R0 1 Twenty embryos per condition were collected from the same clutch from where the ribosome profiling timeseries was conducted.Bazzini et al 2014 Total RNA was isolated using 1mL of Trizol following manufacturer instructions. Ribosomal RNAs were depleted using Ribo Zero Epicentre/Illumina. Strand specific single end library was constructed according to the Illumina Sample Preparation Kit protocol using standard TruSeq adapters Libraries were prepared and sequenced in an Illumina Hi SEQ single end 75nt reads     RNA-Seq TRANSCRIPTOMIC other SINGLE ILLUMINA Illumina HiSeq 2000 <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>75</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP067139     AG00244_SEQ0039_R1.fastq.gz fastq 1010085524.0 13290599.0 2h mRNA R0 run1 0:76 A:196715560;C:309406513;G:286228000;T:217670217;N:65234 76       196715560 309406513 286228000 217670217 65234 SRX1471511 SRS1197399 SRA314809 Yale University|Giraldez Lab Yale University 1 0.89974   0.14215   0.79488   0.72171   76   B   usable mapping rate illumina hiseq_era unknown rrna_depletion trueseq bulk unknown unknown   United States 2015-12-08 Cleavage Embryo Embryo Imprecise All anatomical structures
43402 43402 SRR5931544 SRX3091819 SRS2429165 SRP115388 PRJNA397956 Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads PRJNA397956 Whole Genome Sequencing To evaluate underlying environmental risks of difenoconazole in aquatic organisms     To evaluate underlying environmental risks of difenoconazole in zebrafish embryo Model organism or animal sample from Danio rerio Zebrafish   strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal                 with difenoconazole 397969 397969 to evulate the environmental risks of difenoconazole in zebrafish embryo     RNA-Seq TRANSCRIPTOMIC other SINGLE ILLUMINA Illumina HiSeq 2500   SRP115388         4755826950.0 31705513.0 D 500 1 2.fq.gz 0:0 1:150 A:1274207449;C:1094727902;G:1122524378;T:1264331427;N:35794 0 150     1274207449 1094727902 1122524378 1264331427 35794 SRX3091819 SRS2429165 SRA598900 China Agricultural University|College of Sciences China Agricultural University 1 0.91191   0.10926   0.68341   0.47196   150   B   usable mapping rate illumina hiseq_era unknown other unknown bulk unknown unknown   China 2017-08-14 Undetermined Embryo Embryo Imprecise All anatomical structures
43403 43403 SRR5931545 SRX3091818 SRS2429165 SRP115388 PRJNA397956 Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads PRJNA397956 Whole Genome Sequencing To evaluate underlying environmental risks of difenoconazole in aquatic organisms     To evaluate underlying environmental risks of difenoconazole in zebrafish embryo Model organism or animal sample from Danio rerio Zebrafish   strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal                 with difenoconazole 397968 397968 to evulate the environmental risks of difenoconazole in zebrafish embryo     RNA-Seq TRANSCRIPTOMIC other SINGLE ILLUMINA Illumina HiSeq 2500   SRP115388         4755826950.0 31705513.0 D 500 1 1.fq.gz 0:150 1:0 A:1276129214;C:1100761964;G:1115345594;T:1263574047;N:16131 150 0     1276129214 1100761964 1115345594 1263574047 16131 SRX3091818 SRS2429165 SRA598900 China Agricultural University|College of Sciences China Agricultural University 1 0.91044   0.10895   0.67659   0.46952   150   B   usable mapping rate illumina hiseq_era unknown other unknown bulk unknown unknown   China 2017-08-14 Undetermined Embryo Embryo Imprecise All anatomical structures
43404 43404 SRR5931546 SRX3091817 SRS2429165 SRP115388 PRJNA397956 Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads PRJNA397956 Whole Genome Sequencing To evaluate underlying environmental risks of difenoconazole in aquatic organisms     To evaluate underlying environmental risks of difenoconazole in zebrafish embryo Model organism or animal sample from Danio rerio Zebrafish   strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal                 with difenoconazole 397967 397967 to evulate the environmental risks of difenoconazole in zebrafish embryo     RNA-Seq TRANSCRIPTOMIC other SINGLE ILLUMINA Illumina HiSeq 2500   SRP115388         4584658950.0 30564393.0 D 50 3 2.fq.gz 0:0 1:150 A:1214232270;C:1065003267;G:1091428812;T:1213867330;N:127271 0 150     1214232270 1065003267 1091428812 1213867330 127271 SRX3091817 SRS2429165 SRA598900 China Agricultural University|College of Sciences China Agricultural University 1 0.92229   0.10554   0.68667   0.4535   150   B   usable mapping rate illumina hiseq_era unknown other unknown bulk unknown unknown   China 2017-08-14 Undetermined Embryo Embryo Imprecise All anatomical structures
43405 43405 SRR5931547 SRX3091816 SRS2429165 SRP115388 PRJNA397956 Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads PRJNA397956 Whole Genome Sequencing To evaluate underlying environmental risks of difenoconazole in aquatic organisms     To evaluate underlying environmental risks of difenoconazole in zebrafish embryo Model organism or animal sample from Danio rerio Zebrafish   strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal                 with difenoconazole 397966 397966 to evulate the environmental risks of difenoconazole in zebrafish embryo     RNA-Seq TRANSCRIPTOMIC other SINGLE ILLUMINA Illumina HiSeq 2500   SRP115388         4584658950.0 30564393.0 D 50 3 1.fq.gz 0:150 1:0 A:1219702088;C:1067643780;G:1085480895;T:1211806100;N:26087 150 0     1219702088 1067643780 1085480895 1211806100 26087 SRX3091816 SRS2429165 SRA598900 China Agricultural University|College of Sciences China Agricultural University 1 0.92126   0.10598   0.68398   0.44901   150   B   usable mapping rate illumina hiseq_era unknown other unknown bulk unknown unknown   China 2017-08-14 Undetermined Embryo Embryo Imprecise All anatomical structures
43406 43406 SRR5931548 SRX3091815 SRS2429165 SRP115388 PRJNA397956 Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads PRJNA397956 Whole Genome Sequencing To evaluate underlying environmental risks of difenoconazole in aquatic organisms     To evaluate underlying environmental risks of difenoconazole in zebrafish embryo Model organism or animal sample from Danio rerio Zebrafish   strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal                 with difenoconazole 397973 397973 to evulate the environmental risks of difenoconazole in zebrafish embryo     RNA-Seq TRANSCRIPTOMIC other SINGLE ILLUMINA Illumina HiSeq 2500   SRP115388         4705867200.0 31372448.0 D 500 3 2.fq.gz 0:0 1:150 A:1240294141;C:1111008282;G:1125861755;T:1228667971;N:35051 0 150     1240294141 1111008282 1125861755 1228667971 35051 SRX3091815 SRS2429165 SRA598900 China Agricultural University|College of Sciences China Agricultural University 1 0.92297   0.09739   0.6856   0.47451   150   B   usable mapping rate illumina hiseq_era unknown other unknown bulk unknown unknown   China 2017-08-14 Undetermined Embryo Embryo Imprecise All anatomical structures
43407 43407 SRR5931549 SRX3091814 SRS2429165 SRP115388 PRJNA397956 Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads PRJNA397956 Whole Genome Sequencing To evaluate underlying environmental risks of difenoconazole in aquatic organisms     To evaluate underlying environmental risks of difenoconazole in zebrafish embryo Model organism or animal sample from Danio rerio Zebrafish   strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal                 with difenoconazole 397972 397972 to evulate the environmental risks of difenoconazole in zebrafish embryo     RNA-Seq TRANSCRIPTOMIC other SINGLE ILLUMINA Illumina HiSeq 2500   SRP115388         4705867200.0 31372448.0 D 500 3 1.fq.gz 0:150 1:0 A:1241514886;C:1108723884;G:1123339576;T:1232273510;N:15344 150 0     1241514886 1108723884 1123339576 1232273510 15344 SRX3091814 SRS2429165 SRA598900 China Agricultural University|College of Sciences China Agricultural University 1 0.92062   0.09796   0.67856   0.47388   150   B   usable mapping rate illumina hiseq_era unknown other unknown bulk unknown unknown   China 2017-08-14 Undetermined Embryo Embryo Imprecise All anatomical structures
43408 43408 SRR5931550 SRX3091813 SRS2429165 SRP115388 PRJNA397956 Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads PRJNA397956 Whole Genome Sequencing To evaluate underlying environmental risks of difenoconazole in aquatic organisms     To evaluate underlying environmental risks of difenoconazole in zebrafish embryo Model organism or animal sample from Danio rerio Zebrafish   strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal                 with difenoconazole 397971 397971 to evulate the environmental risks of difenoconazole in zebrafish embryo     RNA-Seq TRANSCRIPTOMIC other SINGLE ILLUMINA Illumina HiSeq 2500   SRP115388         4750951350.0 31673009.0 D 500 2 2.fq.gz 0:0 1:150 A:1286144024;C:1079544004;G:1112952985;T:1272274928;N:35409 0 150     1286144024 1079544004 1112952985 1272274928 35409 SRX3091813 SRS2429165 SRA598900 China Agricultural University|College of Sciences China Agricultural University 1 0.90446   0.13747   0.68639   0.46726   150   B   usable mapping rate illumina hiseq_era unknown other unknown bulk unknown unknown   China 2017-08-14 Undetermined Embryo Embryo Imprecise All anatomical structures
43409 43409 SRR5931551 SRX3091812 SRS2429165 SRP115388 PRJNA397956 Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads PRJNA397956 Whole Genome Sequencing To evaluate underlying environmental risks of difenoconazole in aquatic organisms     To evaluate underlying environmental risks of difenoconazole in zebrafish embryo Model organism or animal sample from Danio rerio Zebrafish   strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal                 with difenoconazole 397970 397970 to evulate the environmental risks of difenoconazole in zebrafish embryo     RNA-Seq TRANSCRIPTOMIC other SINGLE ILLUMINA Illumina HiSeq 2500   SRP115388         4750951350.0 31673009.0 D 500 2 1.fq.gz 0:150 1:0 A:1287515334;C:1090783234;G:1101469034;T:1271168008;N:15740 150 0     1287515334 1090783234 1101469034 1271168008 15740 SRX3091812 SRS2429165 SRA598900 China Agricultural University|College of Sciences China Agricultural University 1 0.90214   0.13756   0.68158   0.46719   150   B   usable mapping rate illumina hiseq_era unknown other unknown bulk unknown unknown   China 2017-08-14 Undetermined Embryo Embryo Imprecise All anatomical structures
43410 43410 SRR5931552 SRX3091811 SRS2429165 SRP115388 PRJNA397956 Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads PRJNA397956 Whole Genome Sequencing To evaluate underlying environmental risks of difenoconazole in aquatic organisms     To evaluate underlying environmental risks of difenoconazole in zebrafish embryo Model organism or animal sample from Danio rerio Zebrafish   strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal                 without xxx 397957 397957 to evulate the environmental risks of difenoconazole in zebrafish embryo     RNA-Seq TRANSCRIPTOMIC other SINGLE ILLUMINA Illumina HiSeq 2500   SRP115388         4071934650.0 27146231.0 CK 1 2.fq.gz 0:0 1:150 A:1052229682;C:975525985;G:991345538;T:1052207035;N:626410 0 150     1052229682 975525985 991345538 1052207035 626410 SRX3091811 SRS2429165 SRA598900 China Agricultural University|College of Sciences China Agricultural University 1 0.93603   0.0589   0.71492   0.48298   150   B   usable mapping rate illumina hiseq_era unknown other unknown bulk unknown unknown   China 2017-08-14 Undetermined Embryo Embryo Imprecise All anatomical structures
43411 43411 SRR5931553 SRX3091810 SRS2429165 SRP115388 PRJNA397956 Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads PRJNA397956 Whole Genome Sequencing To evaluate underlying environmental risks of difenoconazole in aquatic organisms     To evaluate underlying environmental risks of difenoconazole in zebrafish embryo Model organism or animal sample from Danio rerio Zebrafish   strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal                 without xxx 397956 397956 to evulate the environmental risks of difenoconazole in zebrafish embryo     RNA-Seq TRANSCRIPTOMIC other SINGLE ILLUMINA Illumina HiSeq 2500   SRP115388         4071934650.0 27146231.0 CK 1 1.fq.gz 0:150 1:0 A:1057694098;C:975549420;G:988477956;T:1049766896;N:446280 150 0     1057694098 975549420 988477956 1049766896 446280 SRX3091810 SRS2429165 SRA598900 China Agricultural University|College of Sciences China Agricultural University 1 0.93688   0.05854   0.7091   0.48309   150   B   usable mapping rate illumina hiseq_era unknown other unknown bulk unknown unknown   China 2017-08-14 Undetermined Embryo Embryo Imprecise All anatomical structures
43412 43412 SRR5931554 SRX3091809 SRS2429165 SRP115388 PRJNA397956 Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads PRJNA397956 Whole Genome Sequencing To evaluate underlying environmental risks of difenoconazole in aquatic organisms     To evaluate underlying environmental risks of difenoconazole in zebrafish embryo Model organism or animal sample from Danio rerio Zebrafish   strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal                 without xxx 397959 397959 to evulate the environmental risks of difenoconazole in zebrafish embryo     RNA-Seq TRANSCRIPTOMIC other SINGLE ILLUMINA Illumina HiSeq 2500   SRP115388         4343291550.0 28955277.0 CK 2 2.fq.gz 0:0 1:150 A:1153253014;C:1007267471;G:1028912357;T:1153739160;N:119548 0 150     1153253014 1007267471 1028912357 1153739160 119548 SRX3091809 SRS2429165 SRA598900 China Agricultural University|College of Sciences China Agricultural University 1 0.9209   0.11211   0.68649   0.45293   150   B   usable mapping rate illumina hiseq_era unknown other unknown bulk unknown unknown   China 2017-08-14 Undetermined Embryo Embryo Imprecise All anatomical structures
43413 43413 SRR5931555 SRX3091808 SRS2429165 SRP115388 PRJNA397956 Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads PRJNA397956 Whole Genome Sequencing To evaluate underlying environmental risks of difenoconazole in aquatic organisms     To evaluate underlying environmental risks of difenoconazole in zebrafish embryo Model organism or animal sample from Danio rerio Zebrafish   strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal                 without xxx 397958 397958 to evulate the environmental risks of difenoconazole in zebrafish embryo     RNA-Seq TRANSCRIPTOMIC other SINGLE ILLUMINA Illumina HiSeq 2500   SRP115388         4343291550.0 28955277.0 CK 2 1.fq.gz 0:150 1:0 A:1157702407;C:1008975846;G:1024287434;T:1151988746;N:337117 150 0     1157702407 1008975846 1024287434 1151988746 337117 SRX3091808 SRS2429165 SRA598900 China Agricultural University|College of Sciences China Agricultural University 1 0.91946   0.11191   0.6828   0.45241   150   B   usable mapping rate illumina hiseq_era unknown other unknown bulk unknown unknown   China 2017-08-14 Undetermined Embryo Embryo Imprecise All anatomical structures
43414 43414 SRR5931556 SRX3091807 SRS2429165 SRP115388 PRJNA397956 Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads PRJNA397956 Whole Genome Sequencing To evaluate underlying environmental risks of difenoconazole in aquatic organisms     To evaluate underlying environmental risks of difenoconazole in zebrafish embryo Model organism or animal sample from Danio rerio Zebrafish   strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal                 without xxx 397961 397961 to evulate the environmental risks of difenoconazole in zebrafish embryo     RNA-Seq TRANSCRIPTOMIC other SINGLE ILLUMINA Illumina HiSeq 2500   SRP115388         4518061050.0 30120407.0 CK 3 2.fq.gz 0:0 1:150 A:1188586431;C:1058258572;G:1080153332;T:1190907666;N:155049 0 150     1188586431 1058258572 1080153332 1190907666 155049 SRX3091807 SRS2429165 SRA598900 China Agricultural University|College of Sciences China Agricultural University 1 0.92512   0.09744   0.69085   0.45772   150   B   usable mapping rate illumina hiseq_era unknown other unknown bulk unknown unknown   China 2017-08-14 Undetermined Embryo Embryo Imprecise All anatomical structures
43415 43415 SRR5931557 SRX3091806 SRS2429165 SRP115388 PRJNA397956 Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads PRJNA397956 Whole Genome Sequencing To evaluate underlying environmental risks of difenoconazole in aquatic organisms     To evaluate underlying environmental risks of difenoconazole in zebrafish embryo Model organism or animal sample from Danio rerio Zebrafish   strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal                 without xxx 397960 397960 to evulate the environmental risks of difenoconazole in zebrafish embryo     RNA-Seq TRANSCRIPTOMIC other SINGLE ILLUMINA Illumina HiSeq 2500   SRP115388         4518061050.0 30120407.0 CK 3 1.fq.gz 0:150 1:0 A:1195164171;C:1059996453;G:1074722334;T:1188143044;N:35048 150 0     1195164171 1059996453 1074722334 1188143044 35048 SRX3091806 SRS2429165 SRA598900 China Agricultural University|College of Sciences China Agricultural University 1 0.9249   0.09772   0.68562   0.45606   150   B   usable mapping rate illumina hiseq_era unknown other unknown bulk unknown unknown   China 2017-08-14 Undetermined Embryo Embryo Imprecise All anatomical structures
43416 43416 SRR5931558 SRX3091805 SRS2429165 SRP115388 PRJNA397956 Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads PRJNA397956 Whole Genome Sequencing To evaluate underlying environmental risks of difenoconazole in aquatic organisms     To evaluate underlying environmental risks of difenoconazole in zebrafish embryo Model organism or animal sample from Danio rerio Zebrafish   strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal                 with difenoconazole 397963 397963 to evulate the environmental risks of difenoconazole in zebrafish embryo     RNA-Seq TRANSCRIPTOMIC other SINGLE ILLUMINA Illumina HiSeq 2500   SRP115388         4572900600.0 30486004.0 D 50 1 2.fq.gz 0:0 1:150 A:1218364634;C:1054987971;G:1079106780;T:1220261884;N:179331 0 150     1218364634 1054987971 1079106780 1220261884 179331 SRX3091805 SRS2429165 SRA598900 China Agricultural University|College of Sciences China Agricultural University 1 0.91953   0.11512   0.68722   0.45056   150   B   usable mapping rate illumina hiseq_era unknown other unknown bulk unknown unknown   China 2017-08-14 Undetermined Embryo Embryo Imprecise All anatomical structures
43417 43417 SRR5931559 SRX3091804 SRS2429165 SRP115388 PRJNA397956 Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads PRJNA397956 Whole Genome Sequencing To evaluate underlying environmental risks of difenoconazole in aquatic organisms     To evaluate underlying environmental risks of difenoconazole in zebrafish embryo Model organism or animal sample from Danio rerio Zebrafish   strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal                 with difenoconazole 397962 397962 to evulate the environmental risks of difenoconazole in zebrafish embryo     RNA-Seq TRANSCRIPTOMIC other SINGLE ILLUMINA Illumina HiSeq 2500   SRP115388         4572900600.0 30486004.0 D 50 1 1.fq.gz 0:150 1:0 A:1223844243;C:1057030107;G:1074694968;T:1217286959;N:44323 150 0     1223844243 1057030107 1074694968 1217286959 44323 SRX3091804 SRS2429165 SRA598900 China Agricultural University|College of Sciences China Agricultural University 1 0.91779   0.1149   0.68258   0.46006   150   B   usable mapping rate illumina hiseq_era unknown other unknown bulk unknown unknown   China 2017-08-14 Undetermined Embryo Embryo Imprecise All anatomical structures
43418 43418 SRR5931560 SRX3091803 SRS2429165 SRP115388 PRJNA397956 Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads PRJNA397956 Whole Genome Sequencing To evaluate underlying environmental risks of difenoconazole in aquatic organisms     To evaluate underlying environmental risks of difenoconazole in zebrafish embryo Model organism or animal sample from Danio rerio Zebrafish   strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal                 with difenoconazole 397965 397965 to evulate the environmental risks of difenoconazole in zebrafish embryo     RNA-Seq TRANSCRIPTOMIC other SINGLE ILLUMINA Illumina HiSeq 2500   SRP115388         4595232150.0 30634881.0 D 50 2 2.fq.gz 0:0 1:150 A:1225033548;C:1062169088;G:1082021478;T:1225833369;N:174667 0 150     1225033548 1062169088 1082021478 1225833369 174667 SRX3091803 SRS2429165 SRA598900 China Agricultural University|College of Sciences China Agricultural University 1 0.91827   0.11697   0.68511   0.44407   150   B   usable mapping rate illumina hiseq_era unknown other unknown bulk unknown unknown   China 2017-08-14 Undetermined Embryo Embryo Imprecise All anatomical structures
43419 43419 SRR5931561 SRX3091802 SRS2429165 SRP115388 PRJNA397956 Danio rerio strain:AB wild type | isolate:CK Ddifenoconazole | breed:zebrafish | cultivar:zebrafish embryo Raw sequence reads PRJNA397956 Whole Genome Sequencing To evaluate underlying environmental risks of difenoconazole in aquatic organisms     To evaluate underlying environmental risks of difenoconazole in zebrafish embryo Model organism or animal sample from Danio rerio Zebrafish   strain:AB wild type|isolate:CK Ddifenoconazole|breed:zebrafish|cultivar:zebrafish embryo|dev stage:embryo|sex:not applicable|tissue:with difenoconazole and without xxx|BioSampleModel:Model organism or animal                 with difenoconazole 397964 397964 to evulate the environmental risks of difenoconazole in zebrafish embryo     RNA-Seq TRANSCRIPTOMIC other SINGLE ILLUMINA Illumina HiSeq 2500   SRP115388         4595232150.0 30634881.0 D 50 2 1.fq.gz 0:150 1:0 A:1231719851;C:1064618233;G:1076698645;T:1222155912;N:39509 150 0     1231719851 1064618233 1076698645 1222155912 39509 SRX3091802 SRS2429165 SRA598900 China Agricultural University|College of Sciences China Agricultural University                       B   usable mapping rate illumina hiseq_era unknown other unknown bulk unknown unknown   China 2017-08-14 Undetermined Embryo Embryo Imprecise All anatomical structures
47735 47735 SRR6846413 SRX3801804 SRS3053760 SRP135842 PRJNA438572 RNA seq of embryo stimulated by interferons in Danio rerio PRJNA438572 Other RNA seq of embryo stimulated by interferons in Danio rerio provides transcriptome data which affords a unique view for understanding differences of expression of ISGs regulated by different interferons.         IFNY   strain:missing|isolate:missing|breed:missing|cultivar:missing|ecotype:missing|age:missing|dev stage:stimulated by interferons|sex:missing|tissue:embryo|collection date:2017 03 12|geo loc name:China:Wuhan|BioSampleModel:Model organism or animal                 RNA seq of embryo stimulated by interferons in Danio rerio IFNY IFNY RNA seq of embryo stimulated by interferons in Danio rerio provides transcriptome data which affords a unique view for understanding differences of expression of ISGs regulated by different interferons.     RNA-Seq TRANSCRIPTOMIC other PAIRED ILLUMINA Illumina HiSeq 4000   SRP135842     IFNY_S13_L004_R2_001.fastq.gz IFNY_S13_L004_R1_001.fastq.gz fastq fastq 8611053142.0 28513421.0 IFNY S13 L004 R1 001.fastq.gz 0:151 1:151 A:2172756042;C:2133682578;G:2133331951;T:2170977207;N:305364 151 151     2172756042 2133682578 2133331951 2170977207 305364 SRX3801804 SRS3053760 SRA666995 Chinese Academy of Sciences|Institute of Hydrobiology Chinese Academy of Sciences 2 0.955 0.95804 0.04308 0.04392 0.70218 0.71033 0.46525 0.462 151 151 B B biological fallback assumption illumina hiseq_era unknown other unknown bulk unknown unknown   China 2018-03-16 Undetermined Embryo Embryo Imprecise All anatomical structures
47736 47736 SRR6846414 SRX3801803 SRS3053759 SRP135842 PRJNA438572 RNA seq of embryo stimulated by interferons in Danio rerio PRJNA438572 Other RNA seq of embryo stimulated by interferons in Danio rerio provides transcriptome data which affords a unique view for understanding differences of expression of ISGs regulated by different interferons.         vector   strain:missing|isolate:missing|breed:missing|cultivar:missing|ecotype:missing|age:missing|dev stage:stimulated by interferons|sex:missing|tissue:embryo|collection date:2017 03 11|geo loc name:China:Wuhan|BioSampleModel:Model organism or animal                 RNA seq of embryo stimulated by interferons in Danio rerio vector vector RNA seq of embryo stimulated by interferons in Danio rerio provides transcriptome data which affords a unique view for understanding differences of expression of ISGs regulated by different interferons.     RNA-Seq TRANSCRIPTOMIC other PAIRED ILLUMINA Illumina HiSeq 4000   SRP135842     vector_S12_L004_R1_001.fastq.gz vector_S12_L004_R2_001.fastq.gz fastq fastq 10279577472.0 34038336.0 vector S12 L004 R1 001.fastq.gz 0:151 1:151 A:2615896150;C:2524788585;G:2528030423;T:2610500306;N:362008 151 151     2615896150 2524788585 2528030423 2610500306 362008 SRX3801803 SRS3053759 SRA666995 Chinese Academy of Sciences|Institute of Hydrobiology Chinese Academy of Sciences 2 0.9555 0.9579 0.04617 0.04728 0.70337 0.71072 0.46191 0.46954 151 151 B B biological fallback assumption illumina hiseq_era unknown other unknown bulk unknown unknown   China 2018-03-16 Undetermined Embryo Embryo Imprecise All anatomical structures
47737 47737 SRR6846415 SRX3801802 SRS3053756 SRP135842 PRJNA438572 RNA seq of embryo stimulated by interferons in Danio rerio PRJNA438572 Other RNA seq of embryo stimulated by interferons in Danio rerio provides transcriptome data which affords a unique view for understanding differences of expression of ISGs regulated by different interferons.         IFNG   strain:missing|isolate:missing|breed:missing|cultivar:missing|ecotype:missing|age:missing|dev stage:stimulated by interferons|sex:missing|tissue:embryo|collection date:2017 03 14|geo loc name:China:Wuhan|BioSampleModel:Model organism or animal                 RNA seq of embryo stimulated by interferons in Danio rerio IFNG IFNG RNA seq of embryo stimulated by interferons in Danio rerio provides transcriptome data which affords a unique view for understanding differences of expression of ISGs regulated by different interferons.     RNA-Seq TRANSCRIPTOMIC other PAIRED ILLUMINA Illumina HiSeq 4000   SRP135842     IFNG_S15_L004_R1_001.fastq.gz IFNG_S15_L004_R2_001.fastq.gz fastq fastq 9082411722.0 30074211.0 IFNG S15 L004 R2 001.fastq.gz 0:151 1:151 A:2283553036;C:2258886090;G:2257807913;T:2281843116;N:321567 151 151     2283553036 2258886090 2257807913 2281843116 321567 SRX3801802 SRS3053756 SRA666995 Chinese Academy of Sciences|Institute of Hydrobiology Chinese Academy of Sciences 2 0.95442 0.95794 0.03954 0.04042 0.70694 0.71674 0.45987 0.45045 151 151 B B biological fallback assumption illumina hiseq_era unknown other unknown bulk unknown unknown   China 2021-01-01 Undetermined Embryo Embryo Imprecise All anatomical structures
47738 47738 SRR6846416 SRX3801801 SRS3053758 SRP135842 PRJNA438572 RNA seq of embryo stimulated by interferons in Danio rerio PRJNA438572 Other RNA seq of embryo stimulated by interferons in Danio rerio provides transcriptome data which affords a unique view for understanding differences of expression of ISGs regulated by different interferons.         IFN1   strain:missing|isolate:missing|breed:missing|cultivar:missing|ecotype:missing|age:missing|dev stage:stimulated by interferons|sex:missing|tissue:embryo|collection date:2017 03 13|geo loc name:China:Wuhan|BioSampleModel:Model organism or animal                 RNA seq of embryo stimulated by interferons in Danio rerio IFN1 IFN1 RNA seq of embryo stimulated by interferons in Danio rerio provides transcriptome data which affords a unique view for understanding differences of expression of ISGs regulated by different interferons.     RNA-Seq TRANSCRIPTOMIC other PAIRED ILLUMINA Illumina HiSeq 4000   SRP135842     IFN1_S14_L004_R1_001.fastq.gz IFN1_S14_L004_R2_001.fastq.gz fastq fastq 9801986820.0 32456910.0 IFN1 S14 L004 R2 001.fastq.gz 0:151 1:151 A:2476732153;C:2426531434;G:2425138255;T:2473239913;N:345065 151 151     2476732153 2426531434 2425138255 2473239913 345065 SRX3801801 SRS3053758 SRA666995 Chinese Academy of Sciences|Institute of Hydrobiology Chinese Academy of Sciences 2 0.95422 0.9559 0.0427 0.04366 0.7068 0.71467 0.45683 0.46354 151 151 B B biological fallback assumption illumina hiseq_era unknown other unknown bulk unknown unknown   China 2021-01-01 Undetermined Embryo Embryo Imprecise All anatomical structures
47739 47739 SRR6846417 SRX3801800 SRS3053757 SRP135842 PRJNA438572 RNA seq of embryo stimulated by interferons in Danio rerio PRJNA438572 Other RNA seq of embryo stimulated by interferons in Danio rerio provides transcriptome data which affords a unique view for understanding differences of expression of ISGs regulated by different interferons.         IFN3   strain:missing|isolate:missing|breed:missing|cultivar:missing|ecotype:missing|age:missing|dev stage:stimulated by interferons|sex:missing|tissue:embryo|collection date:2017 03 15|geo loc name:China:Wuhan|BioSampleModel:Model organism or animal                 RNA seq of embryo stimulated by interferons in Danio rerio IFN3 IFN3 RNA seq of embryo stimulated by interferons in Danio rerio provides transcriptome data which affords a unique view for understanding differences of expression of ISGs regulated by different interferons.     RNA-Seq TRANSCRIPTOMIC other PAIRED ILLUMINA Illumina HiSeq 4000   SRP135842     IFN3_S16_L004_R2_001.fastq.gz IFN3_S16_L004_R1_001.fastq.gz fastq fastq 8628116746.0 28569923.0 IFN3 S16 L004 R2 001.fastq.gz 0:151 1:151 A:2178313667;C:2137778611;G:2137088678;T:2174631627;N:304163 151 151     2178313667 2137778611 2137088678 2174631627 304163 SRX3801800 SRS3053757 SRA666995 Chinese Academy of Sciences|Institute of Hydrobiology Chinese Academy of Sciences 2 0.95589 0.95838 0.04186 0.04249 0.70587 0.71376 0.44245 0.46157 151 151 B B biological fallback assumption illumina hiseq_era unknown other unknown bulk unknown unknown   China 2021-01-01 Undetermined Embryo Embryo Imprecise All anatomical structures
69402 69402 SRR18516945 SRX14648017 SRS12413419 SRP366502 PRJNA821148 CAGE seq total and nuclear RNA and nanT iCAGE acrosss 6 developmental stages PRJNA821148 Other In order to compare mRNA expression in the whole cell and the nucleus during development we prepared CAGE seq libraries from total RNA as well as only from nuclear RNA as well as nanti CAGE on 6 developmental stages         DCD007415BS   strain:AB|age:4.7hpf|dev stage:zfs:0000015|sex:not applicable|tissue:early embryonic cell|biomaterial provider:Mueller lab University of Birmingham|BioSampleModel:Model organism or animal                 nanT iCAGE zfs:0000015 DCD003635SQ DCD003635SQ nanT iCAGE with Total RNA max read depth: 48     RNA-Seq TRANSCRIPTOMIC other SINGLE ILLUMINA Illumina HiSeq 2000   SRP366502     CAGE-seq_Mueller_lab_0008AS.DCD003635SQ.USERirene.stevens.R1.fastq.gz fastq 294441504.0 6134198.0 CAGE seq Mueller lab 0008AS.DCD003635SQ.USERirene.stevens.R1.fastq.gz 0:48 1:0 A:79426328;C:71077605;G:78480399;T:65051436;N:405736 48 0     79426328 71077605 78480399 65051436 405736 SRX14648017 SRS12413419 SRA1393751 DANIO-CODE|Department for Biosciences and Nutrition DANIO-CODE DANIO-CODE 1 0.85189   0.16254   0.81716   0.63115   48   B   usable mapping rate illumina hiseq_era unknown other unknown bulk unknown unknown   Unknown 2022-03-29 Blastula Embryo Embryo Imprecise All anatomical structures
69403 69403 SRR18516946 SRX14648016 SRS12413419 SRP366502 PRJNA821148 CAGE seq total and nuclear RNA and nanT iCAGE acrosss 6 developmental stages PRJNA821148 Other In order to compare mRNA expression in the whole cell and the nucleus during development we prepared CAGE seq libraries from total RNA as well as only from nuclear RNA as well as nanti CAGE on 6 developmental stages         DCD007415BS   strain:AB|age:4.7hpf|dev stage:zfs:0000015|sex:not applicable|tissue:early embryonic cell|biomaterial provider:Mueller lab University of Birmingham|BioSampleModel:Model organism or animal                 nanT iCAGE zfs:0000015 DCD003631SQ DCD003631SQ nanT iCAGE with Total RNA max read depth: 48     RNA-Seq TRANSCRIPTOMIC other SINGLE ILLUMINA Illumina HiSeq 2000   SRP366502     CAGE-seq_Mueller_lab_0008AS.DCD003631SQ.USERirene.stevens.R1.fastq.gz fastq 334998768.0 6979141.0 CAGE seq Mueller lab 0008AS.DCD003631SQ.USERirene.stevens.R1.fastq.gz 0:48 1:0 A:90775534;C:79265953;G:87566501;T:76935994;N:454786 48 0     90775534 79265953 87566501 76935994 454786 SRX14648016 SRS12413419 SRA1393751 DANIO-CODE|Department for Biosciences and Nutrition DANIO-CODE DANIO-CODE 1 0.82791   0.15938   0.81302   0.61851   48   B   usable mapping rate illumina hiseq_era unknown other unknown bulk unknown unknown   Unknown 2022-03-29 Blastula Embryo Embryo Imprecise All anatomical structures
69404 69404 SRR18516947 SRX14648015 SRS12413417 SRP366502 PRJNA821148 CAGE seq total and nuclear RNA and nanT iCAGE acrosss 6 developmental stages PRJNA821148 Other In order to compare mRNA expression in the whole cell and the nucleus during development we prepared CAGE seq libraries from total RNA as well as only from nuclear RNA as well as nanti CAGE on 6 developmental stages         DCD007416BS   strain:AB|age:2.25hpf|dev stage:128 cell|sex:not applicable|tissue:early embryonic cell|biomaterial provider:Mueller lab University of Birmingham|BioSampleModel:Model organism or animal                 nanT iCAGE 128 cell DCD003641SQ DCD003641SQ nanT iCAGE with Total RNA max read depth: 48     RNA-Seq TRANSCRIPTOMIC other SINGLE ILLUMINA Illumina HiSeq 2000   SRP366502     CAGE-seq_Mueller_lab_0008AS.DCD003641SQ.USERirene.stevens.R1.fastq.gz fastq 266018592.0 5542054.0 CAGE seq Mueller lab 0008AS.DCD003641SQ.USERirene.stevens.R1.fastq.gz 0:48 1:0 A:71393510;C:62894111;G:70482522;T:60880917;N:367532 48 0     71393510 62894111 70482522 60880917 367532 SRX14648015 SRS12413417 SRA1393751 DANIO-CODE|Department for Biosciences and Nutrition DANIO-CODE DANIO-CODE 1 0.82888   0.12766   0.79437   0.67583   48   B   usable mapping rate illumina hiseq_era unknown other unknown bulk unknown unknown   Unknown 2022-03-29 Blastula Embryo Embryo Imprecise All anatomical structures
69405 69405 SRR18516948 SRX14648014 SRS12413417 SRP366502 PRJNA821148 CAGE seq total and nuclear RNA and nanT iCAGE acrosss 6 developmental stages PRJNA821148 Other In order to compare mRNA expression in the whole cell and the nucleus during development we prepared CAGE seq libraries from total RNA as well as only from nuclear RNA as well as nanti CAGE on 6 developmental stages         DCD007416BS   strain:AB|age:2.25hpf|dev stage:128 cell|sex:not applicable|tissue:early embryonic cell|biomaterial provider:Mueller lab University of Birmingham|BioSampleModel:Model organism or animal                 nanT iCAGE 128 cell DCD003638SQ DCD003638SQ nanT iCAGE with Total RNA max read depth: 48     RNA-Seq TRANSCRIPTOMIC other SINGLE ILLUMINA Illumina HiSeq 2000   SRP366502     CAGE-seq_Mueller_lab_0008AS.DCD003638SQ.USERirene.stevens.R1.fastq.gz fastq 244530816.0 5094392.0 CAGE seq Mueller lab 0008AS.DCD003638SQ.USERirene.stevens.R1.fastq.gz 0:48 1:0 A:63996450;C:58644251;G:70160025;T:51392278;N:337812 48 0     63996450 58644251 70160025 51392278 337812 SRX14648014 SRS12413417 SRA1393751 DANIO-CODE|Department for Biosciences and Nutrition DANIO-CODE DANIO-CODE 1 0.86857   0.164   0.80852   0.72718   48   B   usable mapping rate illumina hiseq_era unknown other unknown bulk unknown unknown   Unknown 2022-03-29 Blastula Embryo Embryo Imprecise All anatomical structures
69406 69406 SRR18516949 SRX14648013 SRS12413416 SRP366502 PRJNA821148 CAGE seq total and nuclear RNA and nanT iCAGE acrosss 6 developmental stages PRJNA821148 Other In order to compare mRNA expression in the whole cell and the nucleus during development we prepared CAGE seq libraries from total RNA as well as only from nuclear RNA as well as nanti CAGE on 6 developmental stages         DCD007417BS   strain:AB|age:2.75hpf|dev stage:512 cell|sex:not applicable|tissue:early embryonic cell|biomaterial provider:Mueller lab University of Birmingham|BioSampleModel:Model organism or animal                 nanT iCAGE 512 cell DCD003640SQ DCD003640SQ nanT iCAGE with Total RNA max read depth: 48     RNA-Seq TRANSCRIPTOMIC other SINGLE ILLUMINA Illumina HiSeq 2000   SRP366502     CAGE-seq_Mueller_lab_0008AS.DCD003640SQ.USERirene.stevens.R1.fastq.gz fastq 389471904.0 8113998.0 CAGE seq Mueller lab 0008AS.DCD003640SQ.USERirene.stevens.R1.fastq.gz 0:48 1:0 A:106010507;C:93511522;G:101307749;T:88105339;N:536787 48 0     106010507 93511522 101307749 88105339 536787 SRX14648013 SRS12413416 SRA1393751 DANIO-CODE|Department for Biosciences and Nutrition DANIO-CODE DANIO-CODE 1 0.88886   0.17661   0.80624   0.71804   48   B   usable mapping rate illumina hiseq_era unknown other unknown bulk unknown unknown   Unknown 2022-03-29 Blastula Embryo Embryo Imprecise All anatomical structures
69407 69407 SRR18516950 SRX14648012 SRS12413416 SRP366502 PRJNA821148 CAGE seq total and nuclear RNA and nanT iCAGE acrosss 6 developmental stages PRJNA821148 Other In order to compare mRNA expression in the whole cell and the nucleus during development we prepared CAGE seq libraries from total RNA as well as only from nuclear RNA as well as nanti CAGE on 6 developmental stages         DCD007417BS   strain:AB|age:2.75hpf|dev stage:512 cell|sex:not applicable|tissue:early embryonic cell|biomaterial provider:Mueller lab University of Birmingham|BioSampleModel:Model organism or animal                 nanT iCAGE 512 cell DCD003642SQ DCD003642SQ nanT iCAGE with Total RNA max read depth: 48     RNA-Seq TRANSCRIPTOMIC other SINGLE ILLUMINA Illumina HiSeq 2000   SRP366502     CAGE-seq_Mueller_lab_0008AS.DCD003642SQ.USERirene.stevens.R1.fastq.gz fastq 336311136.0 7006482.0 CAGE seq Mueller lab 0008AS.DCD003642SQ.USERirene.stevens.R1.fastq.gz 0:48 1:0 A:90213623;C:77505515;G:88574792;T:79555106;N:462100 48 0     90213623 77505515 88574792 79555106 462100 SRX14648012 SRS12413416 SRA1393751 DANIO-CODE|Department for Biosciences and Nutrition DANIO-CODE DANIO-CODE 1 0.81351   0.11572   0.78792   0.61957   48   B   usable mapping rate illumina hiseq_era unknown other unknown bulk unknown unknown   Unknown 2022-03-29 Blastula Embryo Embryo Imprecise All anatomical structures
69408 69408 SRR18516951 SRX14648011 SRS12413418 SRP366502 PRJNA821148 CAGE seq total and nuclear RNA and nanT iCAGE acrosss 6 developmental stages PRJNA821148 Other In order to compare mRNA expression in the whole cell and the nucleus during development we prepared CAGE seq libraries from total RNA as well as only from nuclear RNA as well as nanti CAGE on 6 developmental stages         DCD007418BS   strain:AB|age:24hpf|dev stage:Prim 5|sex:not applicable|tissue:early embryonic cell|biomaterial provider:Mueller lab University of Birmingham|BioSampleModel:Model organism or animal                 tagging CAGE Prim 5 DCD003639SQ DCD003639SQ tagging CAGE with Nuclear RNA max read depth: 27     RNA-Seq TRANSCRIPTOMIC other SINGLE ILLUMINA Illumina HiSeq 2000   SRP366502     CAGE-seq_Mueller_lab_0007AS.DCD003639SQ.USERirene.stevens.R1.fastq.gz fastq 1328398677.0 49199951.0 CAGE seq Mueller lab 0007AS.DCD003639SQ.USERirene.stevens.R1.fastq.gz 0:27 1:0 A:347247893;C:293260323;G:377992379;T:309837948;N:60134 27 0     347247893 293260323 377992379 309837948 60134 SRX14648011 SRS12413418 SRA1393751 DANIO-CODE|Department for Biosciences and Nutrition DANIO-CODE DANIO-CODE 1 0.46699   0.13006   0.78332   0.8225   27   B   usable mapping rate illumina hiseq_era unknown other unknown bulk unknown unknown   Unknown 2022-03-29 Pharyngula Embryo Embryo Imprecise All anatomical structures
69409 69409 SRR18516952 SRX14648010 SRS12413415 SRP366502 PRJNA821148 CAGE seq total and nuclear RNA and nanT iCAGE acrosss 6 developmental stages PRJNA821148 Other In order to compare mRNA expression in the whole cell and the nucleus during development we prepared CAGE seq libraries from total RNA as well as only from nuclear RNA as well as nanti CAGE on 6 developmental stages         DCD007419BS   strain:AB|age:1.5hpf|dev stage:16 cell|sex:not applicable|tissue:early embryonic cell|biomaterial provider:Mueller lab University of Birmingham|BioSampleModel:Model organism or animal                 nanT iCAGE 16 cell DCD003632SQ DCD003632SQ nanT iCAGE with Total RNA max read depth: 48     RNA-Seq TRANSCRIPTOMIC other SINGLE ILLUMINA Illumina HiSeq 2000   SRP366502     CAGE-seq_Mueller_lab_0008AS.DCD003632SQ.USERirene.stevens.R1.fastq.gz fastq 392835168.0 8184066.0 CAGE seq Mueller lab 0008AS.DCD003632SQ.USERirene.stevens.R1.fastq.gz 0:48 1:0 A:106127709;C:94140127;G:103587770;T:88439881;N:539681 48 0     106127709 94140127 103587770 88439881 539681 SRX14648010 SRS12413415 SRA1393751 DANIO-CODE|Department for Biosciences and Nutrition DANIO-CODE DANIO-CODE 1 0.87892   0.18576   0.80509   0.63419   48   B   usable mapping rate illumina hiseq_era unknown other unknown bulk unknown unknown   Unknown 2022-03-29 Cleavage Embryo Embryo Imprecise All anatomical structures
69410 69410 SRR18516953 SRX14648009 SRS12413415 SRP366502 PRJNA821148 CAGE seq total and nuclear RNA and nanT iCAGE acrosss 6 developmental stages PRJNA821148 Other In order to compare mRNA expression in the whole cell and the nucleus during development we prepared CAGE seq libraries from total RNA as well as only from nuclear RNA as well as nanti CAGE on 6 developmental stages         DCD007419BS   strain:AB|age:1.5hpf|dev stage:16 cell|sex:not applicable|tissue:early embryonic cell|biomaterial provider:Mueller lab University of Birmingham|BioSampleModel:Model organism or animal                 nanT iCAGE 16 cell DCD003637SQ DCD003637SQ nanT iCAGE with Total RNA max read depth: 48     RNA-Seq TRANSCRIPTOMIC other SINGLE ILLUMINA Illumina HiSeq 2000   SRP366502     CAGE-seq_Mueller_lab_0008AS.DCD003637SQ.USERirene.stevens.R1.fastq.gz fastq 225142368.0 4690466.0 CAGE seq Mueller lab 0008AS.DCD003637SQ.USERirene.stevens.R1.fastq.gz 0:48 1:0 A:61697148;C:52348969;G:58818293;T:51968512;N:309446 48 0     61697148 52348969 58818293 51968512 309446 SRX14648009 SRS12413415 SRA1393751 DANIO-CODE|Department for Biosciences and Nutrition DANIO-CODE DANIO-CODE 1 0.8438   0.1185   0.78476   0.66042   48   B   usable mapping rate illumina hiseq_era unknown other unknown bulk unknown unknown   Unknown 2022-03-29 Cleavage Embryo Embryo Imprecise All anatomical structures
75444 75444 SRR24630527 SRX20411156 SRS17723880 SRP438317 PRJNA973246 Differentiating zebrafish slow muscle precursor expression profiles PRJNA973246 Other Zebrafish slow muscle precursor stereotypical behaviours were well characterized but their related gene signatures remained unknown. We characterized the trajectory and gene signatures of differentiating slow muscle precursor using single cell RNA sequencing.       Model organism or animal sample from Danio rerio differentiating adaxial cell   strain:smyhc1:gfp injected|age:18 hpf|dev stage:18 hpf|sex:missing|tissue:embryos|collection date:2021 03 04|BioSampleModel:Model organism or animal                 scRNAseq of smyhc1:gfp zebrafish cells Lib Adaxial cells 10X Lib Adaxial cells 10X 10X genomics single cell three prime v3.1     RNA-Seq TRANSCRIPTOMIC SINGLE CELL other PAIRED ILLUMINA NextSeq 500   SRP438317   loader:fastq load.py Lib_Adaxial_cells_10X_13_21_R1_001.fastq.gz Lib_Adaxial_cells_10X_13_21_R2_001.fastq.gz fastq fastq 97290535840.0 608065849.0 Lib Adaxial cells 10X 13 21 R1 001.fastq.gz 0:28 1:132 A:31239174068;C:19321240292;G:21191429606;T:25387874670;N:150817204 28 132     31239174068 19321240292 21191429606 25387874670 150817204 SRX20411156 SRS17723880 SRA1639828 Institut de Genomique Fonctionnelle de Lyon|ENS de Lyon, CNRS Institut de Genomique Fonctionnelle de Lyon 2 0.00774 0.8686 0.00239 0.15226 0.99082 0.81945 0.30856 0.50916 28 132 T B sc-like readlen illumina nextseq unknown other unknown sc single_cell_droplet 10x   France 2023-05-18 Segmentation Embryo Embryo Imprecise All anatomical structures

Advanced export

JSON shape: default, array, newline-delimited

CSV options: 

CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;