run_metadata
2,268 rows where experiment.library_selection = "cDNA" and tissue_curation = "Spinal Cord"
This data as json, CSV (advanced)
| Link | rowid ▼ | run.accession | experiment.accession | sample.accession | study.accession | bioproject | study.title | study.alias | study.type | study.abstract | study.attributes | study.PMIDs | sample.description | sample.title | sample.alias | sample.centername | sample.attributes | GEOsample.title | GEOsample.dataprocessing | GEOsample.source | GEOsample.treatmentprotocol | GEOsample.extractprotocol | GEOsample.growthprotocol | GEOsample.characteristics | GEOsample.accession | experiment.title | experiment.alias | experiment.library_name | experiment.design_description | experiment.library_construction_protocol | experiment.attributes | experiment.library_strategy | experiment.library_source | experiment.library_selection | experiment.library_layout | experiment.platform | experiment.instrument_model | experiment.spot_descriptor | experiment.study_ref | run.title | run.attributes | run.filename | run.semantic_name | run.total_bases | run.total_spots | run.alias | run.read_lengths | run.base_counts | run.r1_length | run.r2_length | run.r3_length | run.r4_length | run.Acount | run.Ccount | run.Gcount | run.Tcount | run.Ncount | run.experiment | run.pool_member | submission.accession | submission.srasource | submission.bioprojectsource | seqdetective.n_mates | seqdetective.mapping_rate.mate1 | seqdetective.mapping_rate.mate2 | seqdetective.nofeature_rate.mate1 | seqdetective.nofeature_rate.mate2 | seqdetective.sparsity.mate1 | seqdetective.sparsity.mate2 | seqdetective.pos_strand_rate.mate1 | seqdetective.pos_strand_rate.mate2 | seqdetective.readlen.mate1 | seqdetective.readlen.mate2 | seqdetective.judgement.mate1 | seqdetective.judgement.mate2 | seqdetective.judgement.reason | platform_family | instrument_generation | read_bias | selection_class | prep_kit | sc_or_bulk | tech_class | technology | tech_variant | submission.bioprojectsource.country | earliest_date | devstage_curation | devstage_curation_coarse | tissue_curation | tissue_curation_coarse |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 44 | 44 | DRR668250 | DRX648352 | DRS458865 | DRP012880 | PRJDB18466 | Comparison of spinal cord regeneration capacity in zebrafish and medaka | PRJDB18466 | Other | Unlike mammals zebrafish have the remarkable ability to regenerate many tissues including the spinal cord. Medaka another model fish species has a low regenerative ability in the spinal cord. Therefore comparisons with them advantageous to revealing regeneration specific mechanisms in the spinal cord. The comparison of the spinal cord regeneration abilities of zebrafish and medaka could be a promising research field to elucidate new factors that determine spinal cord regeneration ability. | pubmed:40278963 | Zebrafish 2 weeks post spinal cord injury replicate 3 | Zebrafish 2wpi 3 | SAMD00799623 | sample name:Zebrafish 2wpi 3|biological replicate:3|biomaterial provider:Center of Medical Innovation and Translational Research Osaka University|collection date:2023 04 25|dev stage:Adult|geo loc name:Japan|sex:not determined|strain:AB Zebrafish|tissue:Spinal cord | DNBSEQ G400 paired end sequencing of SAMD00799623 | DRX648352 | RNA seq of spinal cord in zebrafish at 2wpi injured 3 | 1 | Total RNA was extracted using RNeasy Micro Kit Qiagen 74104 with DNase treatment RNase Free DNase Set Qiagen 79254. Libraries were constructed from the amplified total RNA. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | DNBSEQ | DNBSEQ-G400 | DRP012880 | DNBSEQ G400 paired end sequencing of SAMD00799623 | 14782516800.0 | 73912584.0 | DRR668250 | 0:100 1:100 | A:4058090278;C:3335994894;G:3323563782;T:4062467903;N:2399943 | 100 | 100 | 4058090278 | 3335994894 | 3323563782 | 4062467903 | 2399943 | DRX648352 | DRS458865 | DRA020617 | Osaka University | Osaka University | B | B | biological fallback assumption | bgi | bgi | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | Japan | 2025-05-12 | Adult | Adult | Spinal Cord | Nervous System | |||||||||||||||||||||||||||||
| 45 | 45 | DRR668249 | DRX648351 | DRS458864 | DRP012880 | PRJDB18466 | Comparison of spinal cord regeneration capacity in zebrafish and medaka | PRJDB18466 | Other | Unlike mammals zebrafish have the remarkable ability to regenerate many tissues including the spinal cord. Medaka another model fish species has a low regenerative ability in the spinal cord. Therefore comparisons with them advantageous to revealing regeneration specific mechanisms in the spinal cord. The comparison of the spinal cord regeneration abilities of zebrafish and medaka could be a promising research field to elucidate new factors that determine spinal cord regeneration ability. | pubmed:40278963 | Zebrafish 2 weeks post spinal cord injury replicate 2 | Zebrafish 2wpi 2 | SAMD00799622 | sample name:Zebrafish 2wpi 2|biological replicate:2|biomaterial provider:Center of Medical Innovation and Translational Research Osaka University|collection date:2023 04 14|dev stage:Adult|geo loc name:Japan|sex:not determined|strain:AB Zebrafish|tissue:Spinal cord | DNBSEQ G400 paired end sequencing of SAMD00799622 | DRX648351 | RNA seq of spinal cord in zebrafish at 2wpi injured 2 | 1 | Total RNA was extracted using RNeasy Micro Kit Qiagen 74104 with DNase treatment RNase Free DNase Set Qiagen 79254. Libraries were constructed from the amplified total RNA. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | DNBSEQ | DNBSEQ-G400 | DRP012880 | DNBSEQ G400 paired end sequencing of SAMD00799622 | 13687641800.0 | 68438209.0 | DRR668249 | 0:100 1:100 | A:3759784620;C:3087398782;G:3083881581;T:3754378915;N:2197902 | 100 | 100 | 3759784620 | 3087398782 | 3083881581 | 3754378915 | 2197902 | DRX648351 | DRS458864 | DRA020617 | Osaka University | Osaka University | B | B | biological fallback assumption | bgi | bgi | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | Japan | 2025-05-12 | Adult | Adult | Spinal Cord | Nervous System | |||||||||||||||||||||||||||||
| 46 | 46 | DRR668248 | DRX648350 | DRS458863 | DRP012880 | PRJDB18466 | Comparison of spinal cord regeneration capacity in zebrafish and medaka | PRJDB18466 | Other | Unlike mammals zebrafish have the remarkable ability to regenerate many tissues including the spinal cord. Medaka another model fish species has a low regenerative ability in the spinal cord. Therefore comparisons with them advantageous to revealing regeneration specific mechanisms in the spinal cord. The comparison of the spinal cord regeneration abilities of zebrafish and medaka could be a promising research field to elucidate new factors that determine spinal cord regeneration ability. | pubmed:40278963 | Zebrafish 2 weeks post spinal cord injury replicate 1 | Zebrafish 2wpi 1 | SAMD00799621 | sample name:Zebrafish 2wpi 1|biological replicate:1|biomaterial provider:Center of Medical Innovation and Translational Research Osaka University|collection date:2023 04 14|dev stage:Adult|geo loc name:Japan|sex:not determined|strain:AB Zebrafish|tissue:Spinal cord | DNBSEQ G400 paired end sequencing of SAMD00799621 | DRX648350 | RNA seq of spinal cord in zebrafish at 2wpi injured 1 | 1 | Total RNA was extracted using RNeasy Micro Kit Qiagen 74104 with DNase treatment RNase Free DNase Set Qiagen 79254. Libraries were constructed from the amplified total RNA. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | DNBSEQ | DNBSEQ-G400 | DRP012880 | DNBSEQ G400 paired end sequencing of SAMD00799621 | 16376197200.0 | 81880986.0 | DRR668248 | 0:100 1:100 | A:4485868844;C:3700974430;G:3710833937;T:4475827800;N:2692189 | 100 | 100 | 4485868844 | 3700974430 | 3710833937 | 4475827800 | 2692189 | DRX648350 | DRS458863 | DRA020617 | Osaka University | Osaka University | B | B | biological fallback assumption | bgi | bgi | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | Japan | 2025-05-12 | Adult | Adult | Spinal Cord | Nervous System | |||||||||||||||||||||||||||||
| 47 | 47 | DRR668247 | DRX648349 | DRS458862 | DRP012880 | PRJDB18466 | Comparison of spinal cord regeneration capacity in zebrafish and medaka | PRJDB18466 | Other | Unlike mammals zebrafish have the remarkable ability to regenerate many tissues including the spinal cord. Medaka another model fish species has a low regenerative ability in the spinal cord. Therefore comparisons with them advantageous to revealing regeneration specific mechanisms in the spinal cord. The comparison of the spinal cord regeneration abilities of zebrafish and medaka could be a promising research field to elucidate new factors that determine spinal cord regeneration ability. | pubmed:40278963 | Zebrafish Intact biological replicate 3 | Zebrafish Control 3 | SAMD00799620 | sample name:Zebrafish Control 3|biological replicate:3|biomaterial provider:Center of Medical Innovation and Translational Research Osaka University|collection date:2023 04 21|dev stage:Adult|geo loc name:Japan|sex:not determined|strain:AB Zebrafish|tissue:Spinal cord | DNBSEQ G400 paired end sequencing of SAMD00799620 | DRX648349 | RNA seq of spinal cord in zebrafish at 0wpi control 3 | 1 | Total RNA was extracted using RNeasy Micro Kit Qiagen 74104 with DNase treatment RNase Free DNase Set Qiagen 79254. Libraries were constructed from the amplified total RNA. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | DNBSEQ | DNBSEQ-G400 | DRP012880 | DNBSEQ G400 paired end sequencing of SAMD00799620 | 13377538600.0 | 66887693.0 | DRR668247 | 0:100 1:100 | A:3725064764;C:2973653932;G:2980883214;T:3695767890;N:2168800 | 100 | 100 | 3725064764 | 2973653932 | 2980883214 | 3695767890 | 2168800 | DRX648349 | DRS458862 | DRA020617 | Osaka University | Osaka University | B | B | biological fallback assumption | bgi | bgi | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | Japan | 2025-05-12 | Adult | Adult | Spinal Cord | Nervous System | |||||||||||||||||||||||||||||
| 48 | 48 | DRR668246 | DRX648348 | DRS458861 | DRP012880 | PRJDB18466 | Comparison of spinal cord regeneration capacity in zebrafish and medaka | PRJDB18466 | Other | Unlike mammals zebrafish have the remarkable ability to regenerate many tissues including the spinal cord. Medaka another model fish species has a low regenerative ability in the spinal cord. Therefore comparisons with them advantageous to revealing regeneration specific mechanisms in the spinal cord. The comparison of the spinal cord regeneration abilities of zebrafish and medaka could be a promising research field to elucidate new factors that determine spinal cord regeneration ability. | pubmed:40278963 | Zebrafish Intact biological replicate 2 | Zebrafish Control 2 | SAMD00799619 | sample name:Zebrafish Control 2|biological replicate:2|biomaterial provider:Center of Medical Innovation and Translational Research Osaka University|collection date:2023 04 21|dev stage:Adult|geo loc name:Japan|sex:not determined|strain:AB Zebrafish|tissue:Spinal cord | DNBSEQ G400 paired end sequencing of SAMD00799619 | DRX648348 | RNA seq of spinal cord in zebrafish at 0wpi control 2 | 1 | Total RNA was extracted using RNeasy Micro Kit Qiagen 74104 with DNase treatment RNase Free DNase Set Qiagen 79254. Libraries were constructed from the amplified total RNA. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | DNBSEQ | DNBSEQ-G400 | DRP012880 | DNBSEQ G400 paired end sequencing of SAMD00799619 | 14971411400.0 | 74857057.0 | DRR668246 | 0:100 1:100 | A:4160326445;C:3329083037;G:3329123314;T:4150453700;N:2424904 | 100 | 100 | 4160326445 | 3329083037 | 3329123314 | 4150453700 | 2424904 | DRX648348 | DRS458861 | DRA020617 | Osaka University | Osaka University | B | B | biological fallback assumption | bgi | bgi | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | Japan | 2025-05-12 | Adult | Adult | Spinal Cord | Nervous System | |||||||||||||||||||||||||||||
| 49 | 49 | DRR668245 | DRX648347 | DRS458860 | DRP012880 | PRJDB18466 | Comparison of spinal cord regeneration capacity in zebrafish and medaka | PRJDB18466 | Other | Unlike mammals zebrafish have the remarkable ability to regenerate many tissues including the spinal cord. Medaka another model fish species has a low regenerative ability in the spinal cord. Therefore comparisons with them advantageous to revealing regeneration specific mechanisms in the spinal cord. The comparison of the spinal cord regeneration abilities of zebrafish and medaka could be a promising research field to elucidate new factors that determine spinal cord regeneration ability. | pubmed:40278963 | Zebrafish Intact biological replicate 1 | Zebrafish Control 1 | SAMD00799618 | sample name:Zebrafish Control 1|biological replicate:1|biomaterial provider:Center of Medical Innovation and Translational Research Osaka University|collection date:2024 05 04|dev stage:Adult|geo loc name:Japan|sex:not determined|strain:AB Zebrafish|tissue:Spinal cord | DNBSEQ G400 paired end sequencing of SAMD00799618 | DRX648347 | RNA seq of spinal cord in zebrafish at 0wpi control 1 | 1 | Total RNA was extracted using RNeasy Micro Kit Qiagen 74104 with DNase treatment RNase Free DNase Set Qiagen 79254. Libraries were constructed from the amplified total RNA. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | DNBSEQ | DNBSEQ-G400 | DRP012880 | DNBSEQ G400 paired end sequencing of SAMD00799618 | 13912523800.0 | 69562619.0 | DRR668245 | 0:100 1:100 | A:3888902049;C:3079617959;G:3075111814;T:3866655202;N:2236776 | 100 | 100 | 3888902049 | 3079617959 | 3075111814 | 3866655202 | 2236776 | DRX648347 | DRS458860 | DRA020617 | Osaka University | Osaka University | B | B | biological fallback assumption | bgi | bgi | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | Japan | 2025-05-12 | Adult | Adult | Spinal Cord | Nervous System | |||||||||||||||||||||||||||||
| 24927 | 24927 | SRR25557778 | SRX21286665 | SRS18536778 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant XI | GSM7688794 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant XI | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688794 | GSM7688794: Morphant XI; Danio rerio; RNA Seq | GSM7688794 r1 | GSM7688794 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-XI_S7_L001_R1_001.fastq.gz | fastq | 420092501.0 | 5668059.0 | GSM7688794 r1 | 0:74.12 | A:113006440;C:96725832;G:99320773;T:110915967;N:123489 | 74 | 113006440 | 96725832 | 99320773 | 110915967 | 123489 | SRX21286665 | SRS18536778 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94757 | 0.06229 | 0.72364 | 0.46676 | 74 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24928 | 24928 | SRR25557779 | SRX21286665 | SRS18536778 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant XI | GSM7688794 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant XI | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688794 | GSM7688794: Morphant XI; Danio rerio; RNA Seq | GSM7688794 r1 | GSM7688794 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-XI_S7_L002_R1_001.fastq.gz | fastq | 421869780.0 | 5690053.0 | GSM7688794 r2 | 0:74.14 | A:113530489;C:97144227;G:99697959;T:111388539;N:108566 | 74 | 113530489 | 97144227 | 99697959 | 111388539 | 108566 | SRX21286665 | SRS18536778 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94921 | 0.06226 | 0.72462 | 0.4738 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24929 | 24929 | SRR25557780 | SRX21286665 | SRS18536778 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant XI | GSM7688794 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant XI | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688794 | GSM7688794: Morphant XI; Danio rerio; RNA Seq | GSM7688794 r1 | GSM7688794 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-XI_S7_L003_R1_001.fastq.gz | fastq | 425064659.0 | 5734041.0 | GSM7688794 r3 | 0:74.13 | A:114342253;C:97873100;G:100532599;T:112196433;N:120274 | 74 | 114342253 | 97873100 | 100532599 | 112196433 | 120274 | SRX21286665 | SRS18536778 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94886 | 0.06112 | 0.72425 | 0.47055 | 74 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24930 | 24930 | SRR25557781 | SRX21286665 | SRS18536778 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant XI | GSM7688794 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant XI | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688794 | GSM7688794: Morphant XI; Danio rerio; RNA Seq | GSM7688794 r1 | GSM7688794 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-XI_S7_L004_R1_001.fastq.gz | fastq | 416990548.0 | 5624902.0 | GSM7688794 r4 | 0:74.13 | A:112153356;C:96009158;G:98613145;T:110097476;N:117413 | 74 | 112153356 | 96009158 | 98613145 | 110097476 | 117413 | SRX21286665 | SRS18536778 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94869 | 0.06229 | 0.72506 | 0.47222 | 74 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24931 | 24931 | SRR25557782 | SRX21286664 | SRS18536777 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant X | GSM7688793 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant X | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688793 | GSM7688793: Morphant X; Danio rerio; RNA Seq | GSM7688793 r1 | GSM7688793 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-X_S6_L001_R1_001.fastq.gz | fastq | 434485284.0 | 5881416.0 | GSM7688793 r1 | 0:73.87 | A:116640351;C:100176557;G:102659919;T:114799536;N:208921 | 73 | 116640351 | 100176557 | 102659919 | 114799536 | 208921 | SRX21286664 | SRS18536777 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94533 | 0.07176 | 0.72464 | 0.47632 | 74 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24932 | 24932 | SRR25557783 | SRX21286664 | SRS18536777 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant X | GSM7688793 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant X | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688793 | GSM7688793: Morphant X; Danio rerio; RNA Seq | GSM7688793 r1 | GSM7688793 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-X_S6_L002_R1_001.fastq.gz | fastq | 435203869.0 | 5886556.0 | GSM7688793 r2 | 0:73.93 | A:116869356;C:100363580;G:102830644;T:114973504;N:166785 | 73 | 116869356 | 100363580 | 102830644 | 114973504 | 166785 | SRX21286664 | SRS18536777 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94542 | 0.07203 | 0.72421 | 0.47733 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24933 | 24933 | SRR25557784 | SRX21286664 | SRS18536777 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant X | GSM7688793 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant X | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688793 | GSM7688793: Morphant X; Danio rerio; RNA Seq | GSM7688793 r1 | GSM7688793 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-X_S6_L003_R1_001.fastq.gz | fastq | 439897269.0 | 5951878.0 | GSM7688793 r3 | 0:73.91 | A:118101648;C:101426657;G:103990006;T:116184480;N:194478 | 73 | 118101648 | 101426657 | 103990006 | 116184480 | 194478 | SRX21286664 | SRS18536777 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94486 | 0.07224 | 0.72448 | 0.47915 | 74 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24934 | 24934 | SRR25557785 | SRX21286664 | SRS18536777 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant X | GSM7688793 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant X | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688793 | GSM7688793: Morphant X; Danio rerio; RNA Seq | GSM7688793 r1 | GSM7688793 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-X_S6_L004_R1_001.fastq.gz | fastq | 431385256.0 | 5836029.0 | GSM7688793 r4 | 0:73.92 | A:115804970;C:99459059;G:101962932;T:113975935;N:182360 | 73 | 115804970 | 99459059 | 101962932 | 113975935 | 182360 | SRX21286664 | SRS18536777 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94432 | 0.07229 | 0.7261 | 0.47463 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24935 | 24935 | SRR25557786 | SRX21286663 | SRS18536776 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant IX | GSM7688792 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant IX | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688792 | GSM7688792: Morphant IX; Danio rerio; RNA Seq | GSM7688792 r1 | GSM7688792 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-IX_S16_L001_R1_001.fastq.gz | fastq | 513309395.0 | 6929648.0 | GSM7688792 r1 | 0:74.07 | A:137428462;C:118688804;G:122019962;T:134991729;N:180438 | 74 | 137428462 | 118688804 | 122019962 | 134991729 | 180438 | SRX21286663 | SRS18536776 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94188 | 0.07029 | 0.73772 | 0.47692 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24936 | 24936 | SRR25557787 | SRX21286663 | SRS18536776 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant IX | GSM7688792 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant IX | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688792 | GSM7688792: Morphant IX; Danio rerio; RNA Seq | GSM7688792 r1 | GSM7688792 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-IX_S16_L002_R1_001.fastq.gz | fastq | 517356735.0 | 6982196.0 | GSM7688792 r2 | 0:74.10 | A:138524037;C:119650852;G:122965491;T:136056171;N:160184 | 74 | 138524037 | 119650852 | 122965491 | 136056171 | 160184 | SRX21286663 | SRS18536776 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94281 | 0.06967 | 0.73963 | 0.48142 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24937 | 24937 | SRR25557788 | SRX21286663 | SRS18536776 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant IX | GSM7688792 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant IX | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688792 | GSM7688792: Morphant IX; Danio rerio; RNA Seq | GSM7688792 r1 | GSM7688792 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-IX_S16_L003_R1_001.fastq.gz | fastq | 519422328.0 | 7010631.0 | GSM7688792 r3 | 0:74.09 | A:139040684;C:120128748;G:123529198;T:136551898;N:171800 | 74 | 139040684 | 120128748 | 123529198 | 136551898 | 171800 | SRX21286663 | SRS18536776 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94297 | 0.06942 | 0.73726 | 0.47499 | 74 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24938 | 24938 | SRR25557789 | SRX21286663 | SRS18536776 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant IX | GSM7688792 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant IX | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688792 | GSM7688792: Morphant IX; Danio rerio; RNA Seq | GSM7688792 r1 | GSM7688792 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-IX_S16_L004_R1_001.fastq.gz | fastq | 511640294.0 | 6905748.0 | GSM7688792 r4 | 0:74.09 | A:136914638;C:118302866;G:121704665;T:134543505;N:174620 | 74 | 136914638 | 118302866 | 121704665 | 134543505 | 174620 | SRX21286663 | SRS18536776 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94176 | 0.07029 | 0.73868 | 0.47987 | 74 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24939 | 24939 | SRR25557790 | SRX21286662 | SRS18536775 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant VIII | GSM7688791 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant VIII | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688791 | GSM7688791: Morphant VIII; Danio rerio; RNA Seq | GSM7688791 r1 | GSM7688791 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-VIII_S14_L001_R1_001.fastq.gz | fastq | 429446821.0 | 5803178.0 | GSM7688791 r1 | 0:74.00 | A:114793535;C:99506379;G:102226914;T:112748761;N:171232 | 74 | 114793535 | 99506379 | 102226914 | 112748761 | 171232 | SRX21286662 | SRS18536775 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94175 | 0.06669 | 0.73673 | 0.48179 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24940 | 24940 | SRR25557791 | SRX21286662 | SRS18536775 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant VIII | GSM7688791 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant VIII | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688791 | GSM7688791: Morphant VIII; Danio rerio; RNA Seq | GSM7688791 r1 | GSM7688791 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-VIII_S14_L002_R1_001.fastq.gz | fastq | 434629893.0 | 5870828.0 | GSM7688791 r2 | 0:74.03 | A:116216940;C:100703527;G:103463365;T:114092681;N:153380 | 74 | 116216940 | 100703527 | 103463365 | 114092681 | 153380 | SRX21286662 | SRS18536775 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94143 | 0.0676 | 0.73791 | 0.48091 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24941 | 24941 | SRR25557792 | SRX21286662 | SRS18536775 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant VIII | GSM7688791 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant VIII | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688791 | GSM7688791: Morphant VIII; Danio rerio; RNA Seq | GSM7688791 r1 | GSM7688791 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-VIII_S14_L003_R1_001.fastq.gz | fastq | 435879881.0 | 5888685.0 | GSM7688791 r3 | 0:74.02 | A:116548094;C:100971153;G:103794902;T:114400770;N:164962 | 74 | 116548094 | 100971153 | 103794902 | 114400770 | 164962 | SRX21286662 | SRS18536775 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94195 | 0.06686 | 0.73785 | 0.48044 | 73 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24942 | 24942 | SRR25557793 | SRX21286662 | SRS18536775 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant VIII | GSM7688791 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant VIII | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688791 | GSM7688791: Morphant VIII; Danio rerio; RNA Seq | GSM7688791 r1 | GSM7688791 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-VIII_S14_L004_R1_001.fastq.gz | fastq | 429478475.0 | 5801978.0 | GSM7688791 r4 | 0:74.02 | A:114799280;C:99474677;G:102302775;T:112737475;N:164268 | 74 | 114799280 | 99474677 | 102302775 | 112737475 | 164268 | SRX21286662 | SRS18536775 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94118 | 0.06706 | 0.73892 | 0.47732 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24943 | 24943 | SRR25557794 | SRX21286661 | SRS18536774 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant VII | GSM7688790 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant VII | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688790 | GSM7688790: Morphant VII; Danio rerio; RNA Seq | GSM7688790 r1 | GSM7688790 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-VII_S15_L001_R1_001.fastq.gz | fastq | 459545188.0 | 6215897.0 | GSM7688790 r1 | 0:73.93 | A:121926568;C:107379723;G:110263606;T:119766429;N:208862 | 73 | 121926568 | 107379723 | 110263606 | 119766429 | 208862 | SRX21286661 | SRS18536774 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94273 | 0.06072 | 0.74582 | 0.47499 | 73 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24944 | 24944 | SRR25557795 | SRX21286661 | SRS18536774 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant VII | GSM7688790 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant VII | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688790 | GSM7688790: Morphant VII; Danio rerio; RNA Seq | GSM7688790 r1 | GSM7688790 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-VII_S15_L002_R1_001.fastq.gz | fastq | 463143624.0 | 6261406.0 | GSM7688790 r2 | 0:73.97 | A:122917997;C:108229793;G:111099867;T:120713978;N:181989 | 73 | 122917997 | 108229793 | 111099867 | 120713978 | 181989 | SRX21286661 | SRS18536774 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94387 | 0.06093 | 0.74341 | 0.47351 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24945 | 24945 | SRR25557796 | SRX21286661 | SRS18536774 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant VII | GSM7688790 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant VII | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688790 | GSM7688790: Morphant VII; Danio rerio; RNA Seq | GSM7688790 r1 | GSM7688790 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-VII_S15_L003_R1_001.fastq.gz | fastq | 465959664.0 | 6300929.0 | GSM7688790 r3 | 0:73.95 | A:123689364;C:108847593;G:111847868;T:121377463;N:197376 | 73 | 123689364 | 108847593 | 111847868 | 121377463 | 197376 | SRX21286661 | SRS18536774 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94322 | 0.06219 | 0.74357 | 0.47977 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24946 | 24946 | SRR25557797 | SRX21286661 | SRS18536774 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant VII | GSM7688790 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant VII | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688790 | GSM7688790: Morphant VII; Danio rerio; RNA Seq | GSM7688790 r1 | GSM7688790 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-VII_S15_L004_R1_001.fastq.gz | fastq | 459075430.0 | 6207363.0 | GSM7688790 r4 | 0:73.96 | A:121797426;C:107221116;G:110209684;T:119657308;N:189896 | 73 | 121797426 | 107221116 | 110209684 | 119657308 | 189896 | SRX21286661 | SRS18536774 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94313 | 0.06211 | 0.74343 | 0.47801 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24947 | 24947 | SRR25557798 | SRX21286660 | SRS18536773 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control XI | GSM7688787 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control XI | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688787 | GSM7688787: Control XI; Danio rerio; RNA Seq | GSM7688787 r1 | GSM7688787 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-XI_S2_L001_R1_001.fastq.gz | fastq | 439719566.0 | 5947052.0 | GSM7688787 r1 | 0:73.94 | A:117482073;C:102083665;G:104685444;T:115272860;N:195524 | 73 | 117482073 | 102083665 | 104685444 | 115272860 | 195524 | SRX21286660 | SRS18536773 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94829 | 0.06278 | 0.72525 | 0.46494 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24948 | 24948 | SRR25557799 | SRX21286660 | SRS18536773 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control XI | GSM7688787 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control XI | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688787 | GSM7688787: Control XI; Danio rerio; RNA Seq | GSM7688787 r1 | GSM7688787 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-XI_S2_L002_R1_001.fastq.gz | fastq | 438533503.0 | 5927990.0 | GSM7688787 r2 | 0:73.98 | A:117199594;C:101810881;G:104402169;T:114946611;N:174248 | 73 | 117199594 | 101810881 | 104402169 | 114946611 | 174248 | SRX21286660 | SRS18536773 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94887 | 0.06387 | 0.72827 | 0.46616 | 74 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24949 | 24949 | SRR25557800 | SRX21286660 | SRS18536773 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control XI | GSM7688787 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control XI | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688787 | GSM7688787: Control XI; Danio rerio; RNA Seq | GSM7688787 r1 | GSM7688787 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-XI_S2_L003_R1_001.fastq.gz | fastq | 443995554.0 | 6003540.0 | GSM7688787 r3 | 0:73.96 | A:118663936;C:103031716;G:105723574;T:116387834;N:188494 | 73 | 118663936 | 103031716 | 105723574 | 116387834 | 188494 | SRX21286660 | SRS18536773 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94788 | 0.06232 | 0.72693 | 0.46653 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24950 | 24950 | SRR25557801 | SRX21286660 | SRS18536773 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control XI | GSM7688787 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control XI | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688787 | GSM7688787: Control XI; Danio rerio; RNA Seq | GSM7688787 r1 | GSM7688787 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-XI_S2_L004_R1_001.fastq.gz | fastq | 435088869.0 | 5882642.0 | GSM7688787 r4 | 0:73.96 | A:116261447;C:100986653;G:103615584;T:114042354;N:182831 | 73 | 116261447 | 100986653 | 103615584 | 114042354 | 182831 | SRX21286660 | SRS18536773 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94914 | 0.06241 | 0.72829 | 0.4546 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24951 | 24951 | SRR25557802 | SRX21286659 | SRS18536772 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control X | GSM7688785 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control X | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688785 | GSM7688785: Control X; Danio rerio; RNA Seq | GSM7688785 r1 | GSM7688785 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-X_S1_L001_R1_001.fastq.gz | fastq | 395130702.0 | 5338263.0 | GSM7688785 r1 | 0:74.02 | A:107005793;C:90183031;G:92316770;T:105476481;N:148627 | 74 | 107005793 | 90183031 | 92316770 | 105476481 | 148627 | SRX21286659 | SRS18536772 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94534 | 0.07625 | 0.73888 | 0.48135 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24952 | 24952 | SRR25557803 | SRX21286659 | SRS18536772 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control X | GSM7688785 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control X | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688785 | GSM7688785: Control X; Danio rerio; RNA Seq | GSM7688785 r1 | GSM7688785 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-X_S1_L002_R1_001.fastq.gz | fastq | 396764458.0 | 5358448.0 | GSM7688785 r2 | 0:74.04 | A:107513717;C:90540282;G:92658504;T:105917444;N:134511 | 74 | 107513717 | 90540282 | 92658504 | 105917444 | 134511 | SRX21286659 | SRS18536772 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94374 | 0.07709 | 0.73878 | 0.47615 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24953 | 24953 | SRR25557804 | SRX21286659 | SRS18536772 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control X | GSM7688785 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control X | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688785 | GSM7688785: Control X; Danio rerio; RNA Seq | GSM7688785 r1 | GSM7688785 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-X_S1_L003_R1_001.fastq.gz | fastq | 399623551.0 | 5397520.0 | GSM7688785 r3 | 0:74.04 | A:108230540;C:91192011;G:93388052;T:106665106;N:147842 | 74 | 108230540 | 91192011 | 93388052 | 106665106 | 147842 | SRX21286659 | SRS18536772 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94399 | 0.07657 | 0.73797 | 0.4794 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24954 | 24954 | SRR25557805 | SRX21286659 | SRS18536772 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control X | GSM7688785 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control X | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688785 | GSM7688785: Control X; Danio rerio; RNA Seq | GSM7688785 r1 | GSM7688785 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-X_S1_L004_R1_001.fastq.gz | fastq | 393298978.0 | 5312101.0 | GSM7688785 r4 | 0:74.04 | A:106518845;C:89734564;G:91901232;T:105004490;N:139847 | 74 | 106518845 | 89734564 | 91901232 | 105004490 | 139847 | SRX21286659 | SRS18536772 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94423 | 0.07599 | 0.73884 | 0.47905 | 71 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24955 | 24955 | SRR25557806 | SRX21286658 | SRS18536771 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control IX | GSM7688783 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control IX | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688783 | GSM7688783: Control IX; Danio rerio; RNA Seq | GSM7688783 r1 | GSM7688783 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-IX_S22_L001_R1_001.fastq.gz | fastq | 366045799.0 | 4944832.0 | GSM7688783 r1 | 0:74.03 | A:98000119;C:84654222;G:86951226;T:96295351;N:144881 | 74 | 98000119 | 84654222 | 86951226 | 96295351 | 144881 | SRX21286658 | SRS18536771 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94303 | 0.07499 | 0.73085 | 0.47881 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24956 | 24956 | SRR25557807 | SRX21286658 | SRS18536771 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control IX | GSM7688783 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control IX | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688783 | GSM7688783: Control IX; Danio rerio; RNA Seq | GSM7688783 r1 | GSM7688783 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-IX_S22_L002_R1_001.fastq.gz | fastq | 369429068.0 | 4988719.0 | GSM7688783 r2 | 0:74.05 | A:98907882;C:85446993;G:87729593;T:97216477;N:128123 | 74 | 98907882 | 85446993 | 87729593 | 97216477 | 128123 | SRX21286658 | SRS18536771 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94261 | 0.07335 | 0.72969 | 0.47867 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24957 | 24957 | SRR25557808 | SRX21286658 | SRS18536771 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control IX | GSM7688783 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control IX | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688783 | GSM7688783: Control IX; Danio rerio; RNA Seq | GSM7688783 r1 | GSM7688783 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-IX_S22_L003_R1_001.fastq.gz | fastq | 369967330.0 | 4996710.0 | GSM7688783 r3 | 0:74.04 | A:99035743;C:85549878;G:87926587;T:97310812;N:144310 | 74 | 99035743 | 85549878 | 87926587 | 97310812 | 144310 | SRX21286658 | SRS18536771 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94328 | 0.0743 | 0.73034 | 0.47133 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24958 | 24958 | SRR25557809 | SRX21286658 | SRS18536771 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control IX | GSM7688783 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control IX | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688783 | GSM7688783: Control IX; Danio rerio; RNA Seq | GSM7688783 r1 | GSM7688783 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-IX_S22_L004_R1_001.fastq.gz | fastq | 365499176.0 | 4936305.0 | GSM7688783 r4 | 0:74.04 | A:97825658;C:84517732;G:86863655;T:96157429;N:134702 | 74 | 97825658 | 84517732 | 86863655 | 96157429 | 134702 | SRX21286658 | SRS18536771 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94286 | 0.07288 | 0.72999 | 0.4783 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24959 | 24959 | SRR25557810 | SRX21286657 | SRS18536770 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control VIII | GSM7688782 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control VIII | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688782 | GSM7688782: Control VIII; Danio rerio; RNA Seq | GSM7688782 r1 | GSM7688782 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-VIII_S20_L001_R1_001.fastq.gz | fastq | 488585907.0 | 6585668.0 | GSM7688782 r1 | 0:74.19 | A:131727468;C:112349971;G:115189425;T:129203159;N:115884 | 74 | 131727468 | 112349971 | 115189425 | 129203159 | 115884 | SRX21286657 | SRS18536770 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.93794 | 0.07381 | 0.7315 | 0.47355 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24960 | 24960 | SRR25557811 | SRX21286657 | SRS18536770 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control VIII | GSM7688782 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control VIII | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688782 | GSM7688782: Control VIII; Danio rerio; RNA Seq | GSM7688782 r1 | GSM7688782 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-VIII_S20_L002_R1_001.fastq.gz | fastq | 493766544.0 | 6653820.0 | GSM7688782 r2 | 0:74.21 | A:133135166;C:113551418;G:116398455;T:130575771;N:105734 | 74 | 133135166 | 113551418 | 116398455 | 130575771 | 105734 | SRX21286657 | SRS18536770 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.93729 | 0.07312 | 0.7307 | 0.47966 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24961 | 24961 | SRR25557812 | SRX21286657 | SRS18536770 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control VIII | GSM7688782 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control VIII | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688782 | GSM7688782: Control VIII; Danio rerio; RNA Seq | GSM7688782 r1 | GSM7688782 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-VIII_S20_L003_R1_001.fastq.gz | fastq | 494935071.0 | 6670024.0 | GSM7688782 r3 | 0:74.20 | A:133406912;C:113769494;G:116771560;T:130871612;N:115493 | 74 | 133406912 | 113769494 | 116771560 | 130871612 | 115493 | SRX21286657 | SRS18536770 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.93847 | 0.07383 | 0.73194 | 0.47646 | 74 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24962 | 24962 | SRR25557813 | SRX21286657 | SRS18536770 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control VIII | GSM7688782 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control VIII | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688782 | GSM7688782: Control VIII; Danio rerio; RNA Seq | GSM7688782 r1 | GSM7688782 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-VIII_S20_L004_R1_001.fastq.gz | fastq | 487644286.0 | 6572100.0 | GSM7688782 r4 | 0:74.20 | A:131423055;C:112092623;G:115067911;T:128945959;N:114738 | 74 | 131423055 | 112092623 | 115067911 | 128945959 | 114738 | SRX21286657 | SRS18536770 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.93708 | 0.0732 | 0.73186 | 0.4781 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24963 | 24963 | SRR25557814 | SRX21286656 | SRS18536769 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control VII | GSM7688781 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control VII | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688781 | GSM7688781: Control VII; Danio rerio; RNA Seq | GSM7688781 r1 | GSM7688781 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-VII_S21_L001_R1_001.fastq.gz | fastq | 419048369.0 | 5664168.0 | GSM7688781 r1 | 0:73.98 | A:111569757;C:97553687;G:100228004;T:109523480;N:173441 | 73 | 111569757 | 97553687 | 100228004 | 109523480 | 173441 | SRX21286656 | SRS18536769 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94179 | 0.06596 | 0.74499 | 0.46809 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24964 | 24964 | SRR25557815 | SRX21286656 | SRS18536769 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control VII | GSM7688781 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control VII | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688781 | GSM7688781: Control VII; Danio rerio; RNA Seq | GSM7688781 r1 | GSM7688781 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-VII_S21_L002_R1_001.fastq.gz | fastq | 422419362.0 | 5707444.0 | GSM7688781 r2 | 0:74.01 | A:112476977;C:98366185;G:101046586;T:110369882;N:159732 | 74 | 112476977 | 98366185 | 101046586 | 110369882 | 159732 | SRX21286656 | SRS18536769 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94275 | 0.06539 | 0.74523 | 0.47247 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24965 | 24965 | SRR25557816 | SRX21286656 | SRS18536769 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control VII | GSM7688781 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control VII | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688781 | GSM7688781: Control VII; Danio rerio; RNA Seq | GSM7688781 r1 | GSM7688781 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-VII_S21_L003_R1_001.fastq.gz | fastq | 424260551.0 | 5733133.0 | GSM7688781 r3 | 0:74.00 | A:112957538;C:98789480;G:101496747;T:110850186;N:166600 | 74 | 112957538 | 98789480 | 101496747 | 110850186 | 166600 | SRX21286656 | SRS18536769 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94174 | 0.06482 | 0.74304 | 0.46935 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24966 | 24966 | SRR25557817 | SRX21286656 | SRS18536769 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control VII | GSM7688781 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control VII | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688781 | GSM7688781: Control VII; Danio rerio; RNA Seq | GSM7688781 r1 | GSM7688781 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-VII_S21_L004_R1_001.fastq.gz | fastq | 417875320.0 | 5646817.0 | GSM7688781 r4 | 0:74.00 | A:111226895;C:97273168;G:100030641;T:109182520;N:162096 | 74 | 111226895 | 97273168 | 100030641 | 109182520 | 162096 | SRX21286656 | SRS18536769 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94352 | 0.06524 | 0.74442 | 0.47095 | 74 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24967 | 24967 | SRR25557924 | SRX21286763 | SRS18536876 | SRP453891 | PRJNA1003032 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq] | GSE240239 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | MUTSU2 AllGFP S5 | GSM7688796 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1|geo loc name:missing|collection date:missing | MUTSU2 AllGFP S5 | We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files. | Spinal Cord | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size. | tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1 | GSM7688796 | GSM7688796: MUTSU2 AllGFP S5; Danio rerio; RNA Seq | GSM7688796 r1 | GSM7688796 | 1 | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP453891 | loader:fastq load.py | MUTSU2_AllGFP-S5_S3_L001_I1_001.fastq.gz MUTSU2_AllGFP-S5_S3_L001_R1_001.fastq.gz MUTSU2_AllGFP-S5_S3_L001_R2_001.fastq.gz | fastq fastq fastq | 783833459.0 | 6171917.0 | GSM7688796 r1 | 0:8 1:28 2:91 | A:165863131;C:117191802;G:128146802;T:150173329;N:269383 | 8 | 28 | 91 | 165863131 | 117191802 | 128146802 | 150173329 | 269383 | SRX21286763 | SRS18536876 | SRA1688438 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.89127 | 0.221 | 0.78317 | 0.52195 | 91 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | ||||||||||||||
| 24968 | 24968 | SRR25557925 | SRX21286763 | SRS18536876 | SRP453891 | PRJNA1003032 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq] | GSE240239 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | MUTSU2 AllGFP S5 | GSM7688796 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1|geo loc name:missing|collection date:missing | MUTSU2 AllGFP S5 | We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files. | Spinal Cord | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size. | tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1 | GSM7688796 | GSM7688796: MUTSU2 AllGFP S5; Danio rerio; RNA Seq | GSM7688796 r1 | GSM7688796 | 1 | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP453891 | loader:fastq load.py | MUTSU2_AllGFP-S5-3_S2_L002_I1_001.fastq.gz MUTSU2_AllGFP-S5-3_S2_L002_R1_001.fastq.gz MUTSU2_AllGFP-S5-3_S2_L002_R2_001.fastq.gz | fastq fastq fastq | 7208342327.0 | 56758601.0 | GSM7688796 r10 | 0:8 1:28 2:91 | A:1518008610;C:1083228714;G:1190089577;T:1369772782;N:3933008 | 8 | 28 | 91 | 1518008610 | 1083228714 | 1190089577 | 1369772782 | 3933008 | SRX21286763 | SRS18536876 | SRA1688438 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.88938 | 0.21991 | 0.79088 | 0.53044 | 91 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | ||||||||||||||
| 24969 | 24969 | SRR25557926 | SRX21286763 | SRS18536876 | SRP453891 | PRJNA1003032 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq] | GSE240239 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | MUTSU2 AllGFP S5 | GSM7688796 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1|geo loc name:missing|collection date:missing | MUTSU2 AllGFP S5 | We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files. | Spinal Cord | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size. | tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1 | GSM7688796 | GSM7688796: MUTSU2 AllGFP S5; Danio rerio; RNA Seq | GSM7688796 r1 | GSM7688796 | 1 | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP453891 | loader:fastq load.py | MUTSU2_AllGFP-S5-3_S2_L003_I1_001.fastq.gz MUTSU2_AllGFP-S5-3_S2_L003_R1_001.fastq.gz MUTSU2_AllGFP-S5-3_S2_L003_R2_001.fastq.gz | fastq fastq fastq | 7337435414.0 | 57775082.0 | GSM7688796 r11 | 0:8 1:28 2:91 | A:1545051667;C:1103394058;G:1211577972;T:1395133564;N:2375201 | 8 | 28 | 91 | 1545051667 | 1103394058 | 1211577972 | 1395133564 | 2375201 | SRX21286763 | SRS18536876 | SRA1688438 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.88966 | 0.2211 | 0.78961 | 0.53156 | 91 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | ||||||||||||||
| 24970 | 24970 | SRR25557927 | SRX21286763 | SRS18536876 | SRP453891 | PRJNA1003032 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq] | GSE240239 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | MUTSU2 AllGFP S5 | GSM7688796 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1|geo loc name:missing|collection date:missing | MUTSU2 AllGFP S5 | We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files. | Spinal Cord | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size. | tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1 | GSM7688796 | GSM7688796: MUTSU2 AllGFP S5; Danio rerio; RNA Seq | GSM7688796 r1 | GSM7688796 | 1 | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP453891 | loader:fastq load.py | MUTSU2_AllGFP-S5-3_S2_L004_I1_001.fastq.gz MUTSU2_AllGFP-S5-3_S2_L004_R1_001.fastq.gz MUTSU2_AllGFP-S5-3_S2_L004_R2_001.fastq.gz | fastq fastq fastq | 7218240453.0 | 56836539.0 | GSM7688796 r12 | 0:8 1:28 2:91 | A:1521442237;C:1084242714;G:1191469584;T:1372277539;N:2692975 | 8 | 28 | 91 | 1521442237 | 1084242714 | 1191469584 | 1372277539 | 2692975 | SRX21286763 | SRS18536876 | SRA1688438 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.8888 | 0.2174 | 0.79172 | 0.53311 | 91 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | ||||||||||||||
| 24971 | 24971 | SRR25557928 | SRX21286763 | SRS18536876 | SRP453891 | PRJNA1003032 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq] | GSE240239 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | MUTSU2 AllGFP S5 | GSM7688796 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1|geo loc name:missing|collection date:missing | MUTSU2 AllGFP S5 | We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files. | Spinal Cord | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size. | tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1 | GSM7688796 | GSM7688796: MUTSU2 AllGFP S5; Danio rerio; RNA Seq | GSM7688796 r1 | GSM7688796 | 1 | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP453891 | loader:fastq load.py | MUTSU2_AllGFP-S5_S3_L002_I1_001.fastq.gz MUTSU2_AllGFP-S5_S3_L002_R1_001.fastq.gz MUTSU2_AllGFP-S5_S3_L002_R2_001.fastq.gz | fastq fastq fastq | 774302109.0 | 6096867.0 | GSM7688796 r2 | 0:8 1:28 2:91 | A:163989105;C:115793536;G:126358958;T:148430473;N:242825 | 8 | 28 | 91 | 163989105 | 115793536 | 126358958 | 148430473 | 242825 | SRX21286763 | SRS18536876 | SRA1688438 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.89371 | 0.2215 | 0.78253 | 0.53282 | 91 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | ||||||||||||||
| 24972 | 24972 | SRR25557929 | SRX21286763 | SRS18536876 | SRP453891 | PRJNA1003032 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq] | GSE240239 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | MUTSU2 AllGFP S5 | GSM7688796 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1|geo loc name:missing|collection date:missing | MUTSU2 AllGFP S5 | We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files. | Spinal Cord | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size. | tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1 | GSM7688796 | GSM7688796: MUTSU2 AllGFP S5; Danio rerio; RNA Seq | GSM7688796 r1 | GSM7688796 | 1 | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP453891 | loader:fastq load.py | MUTSU2_AllGFP-S5_S3_L003_I1_001.fastq.gz MUTSU2_AllGFP-S5_S3_L003_R1_001.fastq.gz MUTSU2_AllGFP-S5_S3_L003_R2_001.fastq.gz | fastq fastq fastq | 790430093.0 | 6223859.0 | GSM7688796 r3 | 0:8 1:28 2:91 | A:167465790;C:118269595;G:129024496;T:151447225;N:164063 | 8 | 28 | 91 | 167465790 | 118269595 | 129024496 | 151447225 | 164063 | SRX21286763 | SRS18536876 | SRA1688438 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.89284 | 0.21955 | 0.78356 | 0.53369 | 91 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | ||||||||||||||
| 24973 | 24973 | SRR25557930 | SRX21286763 | SRS18536876 | SRP453891 | PRJNA1003032 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq] | GSE240239 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | MUTSU2 AllGFP S5 | GSM7688796 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1|geo loc name:missing|collection date:missing | MUTSU2 AllGFP S5 | We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files. | Spinal Cord | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size. | tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1 | GSM7688796 | GSM7688796: MUTSU2 AllGFP S5; Danio rerio; RNA Seq | GSM7688796 r1 | GSM7688796 | 1 | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP453891 | loader:fastq load.py | MUTSU2_AllGFP-S5_S3_L004_I1_001.fastq.gz MUTSU2_AllGFP-S5_S3_L004_R1_001.fastq.gz MUTSU2_AllGFP-S5_S3_L004_R2_001.fastq.gz | fastq fastq fastq | 778936974.0 | 6133362.0 | GSM7688796 r4 | 0:8 1:28 2:91 | A:165013558;C:116498474;G:127146290;T:149314806;N:162814 | 8 | 28 | 91 | 165013558 | 116498474 | 127146290 | 149314806 | 162814 | SRX21286763 | SRS18536876 | SRA1688438 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.89195 | 0.2209 | 0.78196 | 0.53121 | 91 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | ||||||||||||||
| 24974 | 24974 | SRR25557931 | SRX21286763 | SRS18536876 | SRP453891 | PRJNA1003032 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq] | GSE240239 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | MUTSU2 AllGFP S5 | GSM7688796 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1|geo loc name:missing|collection date:missing | MUTSU2 AllGFP S5 | We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files. | Spinal Cord | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size. | tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1 | GSM7688796 | GSM7688796: MUTSU2 AllGFP S5; Danio rerio; RNA Seq | GSM7688796 r1 | GSM7688796 | 1 | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP453891 | loader:fastq load.py | MUTSU2_AllGFP-S5-2_S2_L001_I1_001.fastq.gz MUTSU2_AllGFP-S5-2_S2_L001_R1_001.fastq.gz MUTSU2_AllGFP-S5-2_S2_L001_R2_001.fastq.gz | fastq fastq fastq | 4174244890.0 | 32868070.0 | GSM7688796 r5 | 0:8 1:28 2:91 | A:882060228;C:627098568;G:684890393;T:795503862;N:1441319 | 8 | 28 | 91 | 882060228 | 627098568 | 684890393 | 795503862 | 1441319 | SRX21286763 | SRS18536876 | SRA1688438 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.89137 | 0.22041 | 0.77926 | 0.52991 | 91 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | ||||||||||||||
| 24975 | 24975 | SRR25557932 | SRX21286763 | SRS18536876 | SRP453891 | PRJNA1003032 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq] | GSE240239 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | MUTSU2 AllGFP S5 | GSM7688796 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1|geo loc name:missing|collection date:missing | MUTSU2 AllGFP S5 | We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files. | Spinal Cord | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size. | tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1 | GSM7688796 | GSM7688796: MUTSU2 AllGFP S5; Danio rerio; RNA Seq | GSM7688796 r1 | GSM7688796 | 1 | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP453891 | loader:fastq load.py | MUTSU2_AllGFP-S5-2_S2_L002_I1_001.fastq.gz MUTSU2_AllGFP-S5-2_S2_L002_R1_001.fastq.gz MUTSU2_AllGFP-S5-2_S2_L002_R2_001.fastq.gz | fastq fastq fastq | 4150210902.0 | 32678826.0 | GSM7688796 r6 | 0:8 1:28 2:91 | A:878218072;C:623662333;G:679977758;T:790589138;N:1325865 | 8 | 28 | 91 | 878218072 | 623662333 | 679977758 | 790589138 | 1325865 | SRX21286763 | SRS18536876 | SRA1688438 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.89264 | 0.22159 | 0.78121 | 0.52989 | 91 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | ||||||||||||||
| 24976 | 24976 | SRR25557933 | SRX21286763 | SRS18536876 | SRP453891 | PRJNA1003032 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq] | GSE240239 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | MUTSU2 AllGFP S5 | GSM7688796 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1|geo loc name:missing|collection date:missing | MUTSU2 AllGFP S5 | We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files. | Spinal Cord | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size. | tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1 | GSM7688796 | GSM7688796: MUTSU2 AllGFP S5; Danio rerio; RNA Seq | GSM7688796 r1 | GSM7688796 | 1 | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP453891 | loader:fastq load.py | MUTSU2_AllGFP-S5-2_S2_L003_I1_001.fastq.gz MUTSU2_AllGFP-S5-2_S2_L003_R1_001.fastq.gz MUTSU2_AllGFP-S5-2_S2_L003_R2_001.fastq.gz | fastq fastq fastq | 4198043547.0 | 33055461.0 | GSM7688796 r7 | 0:8 1:28 2:91 | A:888287475;C:630914324;G:688006958;T:799794077;N:1044117 | 8 | 28 | 91 | 888287475 | 630914324 | 688006958 | 799794077 | 1044117 | SRX21286763 | SRS18536876 | SRA1688438 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.8912 | 0.21889 | 0.7822 | 0.52774 | 91 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | ||||||||||||||
| 24977 | 24977 | SRR25557934 | SRX21286763 | SRS18536876 | SRP453891 | PRJNA1003032 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq] | GSE240239 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | MUTSU2 AllGFP S5 | GSM7688796 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1|geo loc name:missing|collection date:missing | MUTSU2 AllGFP S5 | We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files. | Spinal Cord | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size. | tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1 | GSM7688796 | GSM7688796: MUTSU2 AllGFP S5; Danio rerio; RNA Seq | GSM7688796 r1 | GSM7688796 | 1 | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP453891 | loader:fastq load.py | MUTSU2_AllGFP-S5-2_S2_L004_I1_001.fastq.gz MUTSU2_AllGFP-S5-2_S2_L004_R1_001.fastq.gz MUTSU2_AllGFP-S5-2_S2_L004_R2_001.fastq.gz | fastq fastq fastq | 4154784553.0 | 32714839.0 | GSM7688796 r8 | 0:8 1:28 2:91 | A:880520885;C:624179045;G:680076172;T:791297938;N:976309 | 8 | 28 | 91 | 880520885 | 624179045 | 680076172 | 791297938 | 976309 | SRX21286763 | SRS18536876 | SRA1688438 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.8927 | 0.22063 | 0.78216 | 0.5346 | 91 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | ||||||||||||||
| 24978 | 24978 | SRR25557935 | SRX21286763 | SRS18536876 | SRP453891 | PRJNA1003032 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq] | GSE240239 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | MUTSU2 AllGFP S5 | GSM7688796 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1|geo loc name:missing|collection date:missing | MUTSU2 AllGFP S5 | We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files. | Spinal Cord | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size. | tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1 | GSM7688796 | GSM7688796: MUTSU2 AllGFP S5; Danio rerio; RNA Seq | GSM7688796 r1 | GSM7688796 | 1 | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP453891 | loader:fastq load.py | MUTSU2_AllGFP-S5-3_S2_L001_I1_001.fastq.gz MUTSU2_AllGFP-S5-3_S2_L001_R1_001.fastq.gz MUTSU2_AllGFP-S5-3_S2_L001_R2_001.fastq.gz | fastq fastq fastq | 7231973725.0 | 56944675.0 | GSM7688796 r9 | 0:8 1:28 2:91 | A:1522035629;C:1085783001;G:1195535350;T:1374885853;N:3725592 | 8 | 28 | 91 | 1522035629 | 1085783001 | 1195535350 | 1374885853 | 3725592 | SRX21286763 | SRS18536876 | SRA1688438 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.88833 | 0.22076 | 0.79056 | 0.52744 | 91 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | ||||||||||||||
| 24979 | 24979 | SRR25557936 | SRX21286762 | SRS18536875 | SRP453891 | PRJNA1003032 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq] | GSE240239 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | MUTSU2 OtherGFP G8 | GSM7688795 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1|geo loc name:missing|collection date:missing | MUTSU2 OtherGFP G8 | We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files. | Spinal Cord | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size. | tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1 | GSM7688795 | GSM7688795: MUTSU2 OtherGFP G8; Danio rerio; RNA Seq | GSM7688795 r1 | GSM7688795 | 1 | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP453891 | loader:fastq load.py | MUTSU2_OtherGFP-G8_S2_L001_I1_001.fastq.gz MUTSU2_OtherGFP-G8_S2_L001_R1_001.fastq.gz MUTSU2_OtherGFP-G8_S2_L001_R2_001.fastq.gz | fastq fastq fastq | 699161670.0 | 5505210.0 | GSM7688795 r1 | 0:8 1:28 2:91 | A:149927051;C:100829317;G:116075103;T:133908276;N:234363 | 8 | 28 | 91 | 149927051 | 100829317 | 116075103 | 133908276 | 234363 | SRX21286762 | SRS18536875 | SRA1688438 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.85081 | 0.21257 | 0.80426 | 0.52779 | 91 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | ||||||||||||||
| 24980 | 24980 | SRR25557937 | SRX21286762 | SRS18536875 | SRP453891 | PRJNA1003032 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq] | GSE240239 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | MUTSU2 OtherGFP G8 | GSM7688795 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1|geo loc name:missing|collection date:missing | MUTSU2 OtherGFP G8 | We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files. | Spinal Cord | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size. | tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1 | GSM7688795 | GSM7688795: MUTSU2 OtherGFP G8; Danio rerio; RNA Seq | GSM7688795 r1 | GSM7688795 | 1 | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP453891 | loader:fastq load.py | MUTSU2_OtherGFP-G8-3_S1_L002_I1_001.fastq.gz MUTSU2_OtherGFP-G8-3_S1_L002_R1_001.fastq.gz MUTSU2_OtherGFP-G8-3_S1_L002_R2_001.fastq.gz | fastq fastq fastq | 8174836330.0 | 64368790.0 | GSM7688795 r10 | 0:8 1:28 2:91 | A:1748532358;C:1187854561;G:1356279755;T:1560491610;N:4401606 | 8 | 28 | 91 | 1748532358 | 1187854561 | 1356279755 | 1560491610 | 4401606 | SRX21286762 | SRS18536875 | SRA1688438 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.85069 | 0.20989 | 0.81049 | 0.52069 | 91 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | ||||||||||||||
| 24981 | 24981 | SRR25557938 | SRX21286762 | SRS18536875 | SRP453891 | PRJNA1003032 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq] | GSE240239 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | MUTSU2 OtherGFP G8 | GSM7688795 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1|geo loc name:missing|collection date:missing | MUTSU2 OtherGFP G8 | We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files. | Spinal Cord | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size. | tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1 | GSM7688795 | GSM7688795: MUTSU2 OtherGFP G8; Danio rerio; RNA Seq | GSM7688795 r1 | GSM7688795 | 1 | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP453891 | loader:fastq load.py | MUTSU2_OtherGFP-G8-3_S1_L003_I1_001.fastq.gz MUTSU2_OtherGFP-G8-3_S1_L003_R1_001.fastq.gz MUTSU2_OtherGFP-G8-3_S1_L003_R2_001.fastq.gz | fastq fastq fastq | 8307872640.0 | 65416320.0 | GSM7688795 r11 | 0:8 1:28 2:91 | A:1778112295;C:1207569588;G:1377139686;T:1587359299;N:2704252 | 8 | 28 | 91 | 1778112295 | 1207569588 | 1377139686 | 1587359299 | 2704252 | SRX21286762 | SRS18536875 | SRA1688438 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.85151 | 0.21054 | 0.80813 | 0.52675 | 91 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | ||||||||||||||
| 24982 | 24982 | SRR25557939 | SRX21286762 | SRS18536875 | SRP453891 | PRJNA1003032 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq] | GSE240239 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | MUTSU2 OtherGFP G8 | GSM7688795 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1|geo loc name:missing|collection date:missing | MUTSU2 OtherGFP G8 | We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files. | Spinal Cord | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size. | tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1 | GSM7688795 | GSM7688795: MUTSU2 OtherGFP G8; Danio rerio; RNA Seq | GSM7688795 r1 | GSM7688795 | 1 | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP453891 | loader:fastq load.py | MUTSU2_OtherGFP-G8-3_S1_L004_R2_001.fastq.gz MUTSU2_OtherGFP-G8-3_S1_L004_R1_001.fastq.gz MUTSU2_OtherGFP-G8-3_S1_L004_I1_001.fastq.gz | fastq fastq fastq | 8197523483.0 | 64547429.0 | GSM7688795 r12 | 0:8 1:28 2:91 | A:1755321680;C:1190415496;G:1359502433;T:1565500310;N:3076120 | 8 | 28 | 91 | 1755321680 | 1190415496 | 1359502433 | 1565500310 | 3076120 | SRX21286762 | SRS18536875 | SRA1688438 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.84956 | 0.20968 | 0.81113 | 0.52382 | 91 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | ||||||||||||||
| 24983 | 24983 | SRR25557940 | SRX21286762 | SRS18536875 | SRP453891 | PRJNA1003032 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq] | GSE240239 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | MUTSU2 OtherGFP G8 | GSM7688795 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1|geo loc name:missing|collection date:missing | MUTSU2 OtherGFP G8 | We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files. | Spinal Cord | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size. | tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1 | GSM7688795 | GSM7688795: MUTSU2 OtherGFP G8; Danio rerio; RNA Seq | GSM7688795 r1 | GSM7688795 | 1 | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP453891 | loader:fastq load.py | MUTSU2_OtherGFP-G8_S2_L002_R2_001.fastq.gz MUTSU2_OtherGFP-G8_S2_L002_R1_001.fastq.gz MUTSU2_OtherGFP-G8_S2_L002_I1_001.fastq.gz | fastq fastq fastq | 690198899.0 | 5434637.0 | GSM7688795 r2 | 0:8 1:28 2:91 | A:147896108;C:99606794;G:114681063;T:132140792;N:227210 | 8 | 28 | 91 | 147896108 | 99606794 | 114681063 | 132140792 | 227210 | SRX21286762 | SRS18536875 | SRA1688438 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.85228 | 0.21261 | 0.803 | 0.52382 | 91 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | ||||||||||||||
| 24984 | 24984 | SRR25557941 | SRX21286762 | SRS18536875 | SRP453891 | PRJNA1003032 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq] | GSE240239 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | MUTSU2 OtherGFP G8 | GSM7688795 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1|geo loc name:missing|collection date:missing | MUTSU2 OtherGFP G8 | We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files. | Spinal Cord | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size. | tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1 | GSM7688795 | GSM7688795: MUTSU2 OtherGFP G8; Danio rerio; RNA Seq | GSM7688795 r1 | GSM7688795 | 1 | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP453891 | loader:fastq load.py | MUTSU2_OtherGFP-G8_S2_L003_I1_001.fastq.gz MUTSU2_OtherGFP-G8_S2_L003_R1_001.fastq.gz MUTSU2_OtherGFP-G8_S2_L003_R2_001.fastq.gz | fastq fastq fastq | 702239515.0 | 5529445.0 | GSM7688795 r3 | 0:8 1:28 2:91 | A:150477574;C:101266550;G:116878466;T:134415299;N:141606 | 8 | 28 | 91 | 150477574 | 101266550 | 116878466 | 134415299 | 141606 | SRX21286762 | SRS18536875 | SRA1688438 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.85364 | 0.21344 | 0.80346 | 0.52158 | 91 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | ||||||||||||||
| 24985 | 24985 | SRR25557942 | SRX21286762 | SRS18536875 | SRP453891 | PRJNA1003032 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq] | GSE240239 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | MUTSU2 OtherGFP G8 | GSM7688795 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1|geo loc name:missing|collection date:missing | MUTSU2 OtherGFP G8 | We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files. | Spinal Cord | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size. | tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1 | GSM7688795 | GSM7688795: MUTSU2 OtherGFP G8; Danio rerio; RNA Seq | GSM7688795 r1 | GSM7688795 | 1 | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP453891 | loader:fastq load.py | MUTSU2_OtherGFP-G8_S2_L004_I1_001.fastq.gz MUTSU2_OtherGFP-G8_S2_L004_R1_001.fastq.gz MUTSU2_OtherGFP-G8_S2_L004_R2_001.fastq.gz | fastq fastq fastq | 694537346.0 | 5468798.0 | GSM7688795 r4 | 0:8 1:28 2:91 | A:148876263;C:100202441;G:115455212;T:132982029;N:144673 | 8 | 28 | 91 | 148876263 | 100202441 | 115455212 | 132982029 | 144673 | SRX21286762 | SRS18536875 | SRA1688438 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.85238 | 0.2138 | 0.80379 | 0.52691 | 91 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | ||||||||||||||
| 24986 | 24986 | SRR25557943 | SRX21286762 | SRS18536875 | SRP453891 | PRJNA1003032 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq] | GSE240239 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | MUTSU2 OtherGFP G8 | GSM7688795 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1|geo loc name:missing|collection date:missing | MUTSU2 OtherGFP G8 | We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files. | Spinal Cord | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size. | tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1 | GSM7688795 | GSM7688795: MUTSU2 OtherGFP G8; Danio rerio; RNA Seq | GSM7688795 r1 | GSM7688795 | 1 | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP453891 | loader:fastq load.py | MUTSU2_OtherGFP-G8-2_S1_L001_R2_001.fastq.gz MUTSU2_OtherGFP-G8-2_S1_L001_R1_001.fastq.gz MUTSU2_OtherGFP-G8-2_S1_L001_I1_001.fastq.gz | fastq fastq fastq | 4324997954.0 | 34055102.0 | GSM7688795 r5 | 0:8 1:28 2:91 | A:924471384;C:626141120;G:722856562;T:824050239;N:1494977 | 8 | 28 | 91 | 924471384 | 626141120 | 722856562 | 824050239 | 1494977 | SRX21286762 | SRS18536875 | SRA1688438 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.85083 | 0.21122 | 0.80472 | 0.524 | 91 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | ||||||||||||||
| 24987 | 24987 | SRR25557944 | SRX21286762 | SRS18536875 | SRP453891 | PRJNA1003032 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq] | GSE240239 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | MUTSU2 OtherGFP G8 | GSM7688795 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1|geo loc name:missing|collection date:missing | MUTSU2 OtherGFP G8 | We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files. | Spinal Cord | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size. | tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1 | GSM7688795 | GSM7688795: MUTSU2 OtherGFP G8; Danio rerio; RNA Seq | GSM7688795 r1 | GSM7688795 | 1 | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP453891 | loader:fastq load.py | MUTSU2_OtherGFP-G8-2_S1_L002_R2_001.fastq.gz MUTSU2_OtherGFP-G8-2_S1_L002_R1_001.fastq.gz MUTSU2_OtherGFP-G8-2_S1_L002_I1_001.fastq.gz | fastq fastq fastq | 4306232942.0 | 33907346.0 | GSM7688795 r6 | 0:8 1:28 2:91 | A:920615353;C:623090513;G:721201055;T:819291149;N:1370416 | 8 | 28 | 91 | 920615353 | 623090513 | 721201055 | 819291149 | 1370416 | SRX21286762 | SRS18536875 | SRA1688438 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.85335 | 0.21315 | 0.80206 | 0.51508 | 91 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | ||||||||||||||
| 24988 | 24988 | SRR25557945 | SRX21286762 | SRS18536875 | SRP453891 | PRJNA1003032 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq] | GSE240239 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | MUTSU2 OtherGFP G8 | GSM7688795 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1|geo loc name:missing|collection date:missing | MUTSU2 OtherGFP G8 | We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files. | Spinal Cord | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size. | tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1 | GSM7688795 | GSM7688795: MUTSU2 OtherGFP G8; Danio rerio; RNA Seq | GSM7688795 r1 | GSM7688795 | 1 | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP453891 | loader:fastq load.py | MUTSU2_OtherGFP-G8-2_S1_L003_R2_001.fastq.gz MUTSU2_OtherGFP-G8-2_S1_L003_R1_001.fastq.gz MUTSU2_OtherGFP-G8-2_S1_L003_I1_001.fastq.gz | fastq fastq fastq | 4348436312.0 | 34239656.0 | GSM7688795 r7 | 0:8 1:28 2:91 | A:930204208;C:629005094;G:727756813;T:827747478;N:1095103 | 8 | 28 | 91 | 930204208 | 629005094 | 727756813 | 827747478 | 1095103 | SRX21286762 | SRS18536875 | SRA1688438 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.85369 | 0.21216 | 0.80503 | 0.52219 | 91 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | ||||||||||||||
| 24989 | 24989 | SRR25557946 | SRX21286762 | SRS18536875 | SRP453891 | PRJNA1003032 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq] | GSE240239 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | MUTSU2 OtherGFP G8 | GSM7688795 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1|geo loc name:missing|collection date:missing | MUTSU2 OtherGFP G8 | We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files. | Spinal Cord | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size. | tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1 | GSM7688795 | GSM7688795: MUTSU2 OtherGFP G8; Danio rerio; RNA Seq | GSM7688795 r1 | GSM7688795 | 1 | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP453891 | loader:fastq load.py | MUTSU2_OtherGFP-G8-2_S1_L004_R2_001.fastq.gz MUTSU2_OtherGFP-G8-2_S1_L004_R1_001.fastq.gz MUTSU2_OtherGFP-G8-2_S1_L004_I1_001.fastq.gz | fastq fastq fastq | 4313915172.0 | 33967836.0 | GSM7688795 r8 | 0:8 1:28 2:91 | A:922742754;C:623127831;G:724345885;T:819819593;N:1037013 | 8 | 28 | 91 | 922742754 | 623127831 | 724345885 | 819819593 | 1037013 | SRX21286762 | SRS18536875 | SRA1688438 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.85456 | 0.21236 | 0.80223 | 0.5216 | 91 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | ||||||||||||||
| 24990 | 24990 | SRR25557947 | SRX21286762 | SRS18536875 | SRP453891 | PRJNA1003032 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [scRNA Seq] | GSE240239 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | MUTSU2 OtherGFP G8 | GSM7688795 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1|geo loc name:missing|collection date:missing | MUTSU2 OtherGFP G8 | We performed demultiplexing and counts analysis as per the manufacturer’s instructions using Cell Ranger v4.0.0 software https://www.10xgenomics.com We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. Multiplets were removed by filtering out cells with >12 000 counts and >2 500 detected genes. Sick and/or “leaky” cells were removed by filtering out cells with <500 detected genes and >6% mitochondrial transcripts. We normalized the data using a counts per million CPM algorithm and applied a logarithmic transformation to improve data visualization. The outcome of normalisation was assessed by principal components analysis PCA graph based clustering and Uniform Manifold Approximation and Projection UMAP plotting using the NN Descent method of nearest neighbour type calculation and Euclidean distance metrics. We manually inspected UMAP plots to assess clustering quality based on expression of known V0v spinal interneuron markers. We then fine tuned the clustering by manually deducing and extrapolating cell fate assignments by comparing expression profiles of 48 hpf single cell clusters with the molecular phenotypes of V0v spinal interneurons in 24 hpf and 30 hpf wild type evx1i232 and evx2sa140 single mutant and evx1i232;evx2sa140 double mutant embryos. To perform differential expression analysis in Partek Flow we used the statistically robust Hurdle Model two part model with default parameters. We initially analyzed the two libraries separately. We then combined the data from these two libraries using the Counts Aggregation pipeline in Cell Ranger v4.0.0 and reanalyzed the data as described above. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated and matrix files. | Spinal Cord | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | Embryos obtained from crossing heterozygous evx1i232/+;evx2sa140/+;Tgevx1:EGFPSU2 parents were raised at 28.5oC until they reached the desired developmental stage of 48 hpf as confirmed by analysis of morphological criteria including head trunk angle head and eye size. | tissue:Spinal Cord|cell line:Tgevx1:EGFPSU2|cell type:V0v spinal interneurons|genotype:evx1i232/+;evx2sa140/+ incross|treatment:N1 | GSM7688795 | GSM7688795: MUTSU2 OtherGFP G8; Danio rerio; RNA Seq | GSM7688795 r1 | GSM7688795 | 1 | Embryos were screened for fluorescence from 30 hpf onwards using a fluorescent dissecting microscope. Only EGFP positive embryos were used for dissections and FACS at 48 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 40 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant… | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP453891 | loader:fastq load.py | MUTSU2_OtherGFP-G8-3_S1_L001_R2_001.fastq.gz MUTSU2_OtherGFP-G8-3_S1_L001_R1_001.fastq.gz MUTSU2_OtherGFP-G8-3_S1_L001_I1_001.fastq.gz | fastq fastq fastq | 8184961024.0 | 64448512.0 | GSM7688795 r9 | 0:8 1:28 2:91 | A:1748819280;C:1187802244;G:1360994184;T:1562975470;N:4223414 | 8 | 28 | 91 | 1748819280 | 1187802244 | 1360994184 | 1562975470 | 4223414 | SRX21286762 | SRS18536875 | SRA1688438 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.8493 | 0.21072 | 0.80967 | 0.52593 | 91 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | ||||||||||||||
| 26558 | 26558 | SRR26173859 | SRX21885960 | SRS18977085 | SRP463130 | PRJNA1020854 | Molecular blueprints for spinal circuit modules controlling locomotor speed | GSE243993 | Transcriptome Analysis | The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2. | pubmed:37919423 | V2a sample2 354 F17 R1 | GSM7804200 | source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing | V2a sample2 354 F17 R1 | The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis | Spinal cord | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons | GSM7804200 | GSM7804200: V2a sample2 354 F17 R1; Danio rerio; RNA Seq | GSM7804200 r1 | GSM7804200 | 1 | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP463130 | SS2_18_354_F17_R1.fastq.gz | fastq | 26979490.0 | 627430.0 | GSM7804200 r1 | 0:43 | A:7493119;C:5872644;G:6013311;T:7600416;N:0 | 43 | 7493119 | 5872644 | 6013311 | 7600416 | 0 | SRX21885960 | SRS18977085 | SRA1719948 | Neuroscience, Karolinaska Institutet | Neuroscience, Karolinaska Institutet | 1 | 0.82979 | 0.33034 | 0.94253 | 0.53995 | 43 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_plate | smartseq | Sweden | 2023-09-25 | Juvenile | Juvenile | Spinal Cord | Nervous System | |||||||||||||||||||
| 26559 | 26559 | SRR26173860 | SRX21885959 | SRS18977083 | SRP463130 | PRJNA1020854 | Molecular blueprints for spinal circuit modules controlling locomotor speed | GSE243993 | Transcriptome Analysis | The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2. | pubmed:37919423 | V2a sample2 354 F16 R1 | GSM7804199 | source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing | V2a sample2 354 F16 R1 | The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis | Spinal cord | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons | GSM7804199 | GSM7804199: V2a sample2 354 F16 R1; Danio rerio; RNA Seq | GSM7804199 r1 | GSM7804199 | 1 | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP463130 | SS2_18_354_F16_R1.fastq.gz | fastq | 26312130.0 | 611910.0 | GSM7804199 r1 | 0:43 | A:7117249;C:5957278;G:6103577;T:7134026;N:0 | 43 | 7117249 | 5957278 | 6103577 | 7134026 | 0 | SRX21885959 | SRS18977083 | SRA1719948 | Neuroscience, Karolinaska Institutet | Neuroscience, Karolinaska Institutet | 1 | 0.87071 | 0.23579 | 0.90678 | 0.52226 | 43 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_plate | smartseq | Sweden | 2023-09-25 | Juvenile | Juvenile | Spinal Cord | Nervous System | |||||||||||||||||||
| 26560 | 26560 | SRR26173861 | SRX21885958 | SRS18977084 | SRP463130 | PRJNA1020854 | Molecular blueprints for spinal circuit modules controlling locomotor speed | GSE243993 | Transcriptome Analysis | The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2. | pubmed:37919423 | V2a sample2 354 F15 R1 | GSM7804198 | source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing | V2a sample2 354 F15 R1 | The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis | Spinal cord | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons | GSM7804198 | GSM7804198: V2a sample2 354 F15 R1; Danio rerio; RNA Seq | GSM7804198 r1 | GSM7804198 | 1 | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP463130 | SS2_18_354_F15_R1.fastq.gz | fastq | 32073872.0 | 745904.0 | GSM7804198 r1 | 0:43 | A:8695962;C:7255833;G:7422516;T:8699561;N:0 | 43 | 8695962 | 7255833 | 7422516 | 8699561 | 0 | SRX21885958 | SRS18977084 | SRA1719948 | Neuroscience, Karolinaska Institutet | Neuroscience, Karolinaska Institutet | 1 | 0.86262 | 0.24391 | 0.90881 | 0.52511 | 43 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_plate | smartseq | Sweden | 2023-09-25 | Juvenile | Juvenile | Spinal Cord | Nervous System | |||||||||||||||||||
| 26561 | 26561 | SRR26173862 | SRX21885957 | SRS18977081 | SRP463130 | PRJNA1020854 | Molecular blueprints for spinal circuit modules controlling locomotor speed | GSE243993 | Transcriptome Analysis | The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2. | pubmed:37919423 | V2a sample2 354 F14 R1 | GSM7804197 | source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing | V2a sample2 354 F14 R1 | The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis | Spinal cord | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons | GSM7804197 | GSM7804197: V2a sample2 354 F14 R1; Danio rerio; RNA Seq | GSM7804197 r1 | GSM7804197 | 1 | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP463130 | SS2_18_354_F14_R1.fastq.gz | fastq | 31158875.0 | 724625.0 | GSM7804197 r1 | 0:43 | A:8769852;C:6707813;G:6866255;T:8814955;N:0 | 43 | 8769852 | 6707813 | 6866255 | 8814955 | 0 | SRX21885957 | SRS18977081 | SRA1719948 | Neuroscience, Karolinaska Institutet | Neuroscience, Karolinaska Institutet | 1 | 0.8739 | 0.27254 | 0.9246 | 0.54185 | 43 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_plate | smartseq | Sweden | 2023-09-25 | Juvenile | Juvenile | Spinal Cord | Nervous System | |||||||||||||||||||
| 26562 | 26562 | SRR26173863 | SRX21885956 | SRS18977082 | SRP463130 | PRJNA1020854 | Molecular blueprints for spinal circuit modules controlling locomotor speed | GSE243993 | Transcriptome Analysis | The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2. | pubmed:37919423 | V2a sample2 354 F13 R1 | GSM7804196 | source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing | V2a sample2 354 F13 R1 | The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis | Spinal cord | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons | GSM7804196 | GSM7804196: V2a sample2 354 F13 R1; Danio rerio; RNA Seq | GSM7804196 r1 | GSM7804196 | 1 | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP463130 | SS2_18_354_F13_R1.fastq.gz | fastq | 41289804.0 | 960228.0 | GSM7804196 r1 | 0:43 | A:11114918;C:9358398;G:9568761;T:11247727;N:0 | 43 | 11114918 | 9358398 | 9568761 | 11247727 | 0 | SRX21885956 | SRS18977082 | SRA1719948 | Neuroscience, Karolinaska Institutet | Neuroscience, Karolinaska Institutet | 1 | 0.82861 | 0.29409 | 0.93235 | 0.49485 | 43 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_plate | smartseq | Sweden | 2023-09-25 | Juvenile | Juvenile | Spinal Cord | Nervous System | |||||||||||||||||||
| 26563 | 26563 | SRR26173864 | SRX21885955 | SRS18977079 | SRP463130 | PRJNA1020854 | Molecular blueprints for spinal circuit modules controlling locomotor speed | GSE243993 | Transcriptome Analysis | The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2. | pubmed:37919423 | V2a sample2 354 F12 R1 | GSM7804195 | source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing | V2a sample2 354 F12 R1 | The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis | Spinal cord | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons | GSM7804195 | GSM7804195: V2a sample2 354 F12 R1; Danio rerio; RNA Seq | GSM7804195 r1 | GSM7804195 | 1 | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP463130 | SS2_18_354_F12_R1.fastq.gz | fastq | 30569259.0 | 710913.0 | GSM7804195 r1 | 0:43 | A:8286806;C:6854804;G:7028453;T:8399196;N:0 | 43 | 8286806 | 6854804 | 7028453 | 8399196 | 0 | SRX21885955 | SRS18977079 | SRA1719948 | Neuroscience, Karolinaska Institutet | Neuroscience, Karolinaska Institutet | 1 | 0.80426 | 0.29136 | 0.94123 | 0.54305 | 43 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_plate | smartseq | Sweden | 2023-09-25 | Juvenile | Juvenile | Spinal Cord | Nervous System | |||||||||||||||||||
| 26564 | 26564 | SRR26173865 | SRX21885954 | SRS18977080 | SRP463130 | PRJNA1020854 | Molecular blueprints for spinal circuit modules controlling locomotor speed | GSE243993 | Transcriptome Analysis | The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2. | pubmed:37919423 | V2a sample2 354 F11 R1 | GSM7804194 | source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing | V2a sample2 354 F11 R1 | The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis | Spinal cord | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons | GSM7804194 | GSM7804194: V2a sample2 354 F11 R1; Danio rerio; RNA Seq | GSM7804194 r1 | GSM7804194 | 1 | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP463130 | SS2_18_354_F11_R1.fastq.gz | fastq | 29626097.0 | 688979.0 | GSM7804194 r1 | 0:43 | A:8063765;C:6645347;G:6803778;T:8113207;N:0 | 43 | 8063765 | 6645347 | 6803778 | 8113207 | 0 | SRX21885954 | SRS18977080 | SRA1719948 | Neuroscience, Karolinaska Institutet | Neuroscience, Karolinaska Institutet | 1 | 0.84972 | 0.26423 | 0.9234 | 0.54087 | 43 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_plate | smartseq | Sweden | 2023-09-25 | Juvenile | Juvenile | Spinal Cord | Nervous System | |||||||||||||||||||
| 26565 | 26565 | SRR26173866 | SRX21885953 | SRS18977078 | SRP463130 | PRJNA1020854 | Molecular blueprints for spinal circuit modules controlling locomotor speed | GSE243993 | Transcriptome Analysis | The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2. | pubmed:37919423 | V2a sample2 354 F10 R1 | GSM7804193 | source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing | V2a sample2 354 F10 R1 | The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis | Spinal cord | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons | GSM7804193 | GSM7804193: V2a sample2 354 F10 R1; Danio rerio; RNA Seq | GSM7804193 r1 | GSM7804193 | 1 | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP463130 | SS2_18_354_F10_R1.fastq.gz | fastq | 24594409.0 | 571963.0 | GSM7804193 r1 | 0:43 | A:6605642;C:5535165;G:5682586;T:6771016;N:0 | 43 | 6605642 | 5535165 | 5682586 | 6771016 | 0 | SRX21885953 | SRS18977078 | SRA1719948 | Neuroscience, Karolinaska Institutet | Neuroscience, Karolinaska Institutet | 1 | 0.77683 | 0.28872 | 0.94633 | 0.52513 | 43 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_plate | smartseq | Sweden | 2023-09-25 | Juvenile | Juvenile | Spinal Cord | Nervous System | |||||||||||||||||||
| 26566 | 26566 | SRR26173867 | SRX21885952 | SRS18977077 | SRP463130 | PRJNA1020854 | Molecular blueprints for spinal circuit modules controlling locomotor speed | GSE243993 | Transcriptome Analysis | The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2. | pubmed:37919423 | V2a sample2 354 E9 R1 | GSM7804168 | source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing | V2a sample2 354 E9 R1 | The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis | Spinal cord | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons | GSM7804168 | GSM7804168: V2a sample2 354 E9 R1; Danio rerio; RNA Seq | GSM7804168 r1 | GSM7804168 | 1 | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP463130 | SS2_18_354_E9_R1.fastq.gz | fastq | 33259941.0 | 773487.0 | GSM7804168 r1 | 0:43 | A:9004615;C:7506729;G:7674909;T:9073688;N:0 | 43 | 9004615 | 7506729 | 7674909 | 9073688 | 0 | SRX21885952 | SRS18977077 | SRA1719948 | Neuroscience, Karolinaska Institutet | Neuroscience, Karolinaska Institutet | 1 | 0.85528 | 0.32094 | 0.89217 | 0.50224 | 43 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_plate | smartseq | Sweden | 2023-09-25 | Juvenile | Juvenile | Spinal Cord | Nervous System | |||||||||||||||||||
| 26567 | 26567 | SRR26173868 | SRX21885951 | SRS18977076 | SRP463130 | PRJNA1020854 | Molecular blueprints for spinal circuit modules controlling locomotor speed | GSE243993 | Transcriptome Analysis | The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2. | pubmed:37919423 | V2a sample2 354 E8 R1 | GSM7804167 | source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing | V2a sample2 354 E8 R1 | The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis | Spinal cord | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons | GSM7804167 | GSM7804167: V2a sample2 354 E8 R1; Danio rerio; RNA Seq | GSM7804167 r1 | GSM7804167 | 1 | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP463130 | SS2_18_354_E8_R1.fastq.gz | fastq | 45348316.0 | 1054612.0 | GSM7804167 r1 | 0:43 | A:12143243;C:10459395;G:10612458;T:12133220;N:0 | 43 | 12143243 | 10459395 | 10612458 | 12133220 | 0 | SRX21885951 | SRS18977076 | SRA1719948 | Neuroscience, Karolinaska Institutet | Neuroscience, Karolinaska Institutet | 1 | 0.8783 | 0.19318 | 0.88572 | 0.49101 | 43 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_plate | smartseq | Sweden | 2023-09-25 | Juvenile | Juvenile | Spinal Cord | Nervous System | |||||||||||||||||||
| 26568 | 26568 | SRR26173869 | SRX21885950 | SRS18977075 | SRP463130 | PRJNA1020854 | Molecular blueprints for spinal circuit modules controlling locomotor speed | GSE243993 | Transcriptome Analysis | The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2. | pubmed:37919423 | V2a sample2 354 E7 R1 | GSM7804166 | source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing | V2a sample2 354 E7 R1 | The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis | Spinal cord | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons | GSM7804166 | GSM7804166: V2a sample2 354 E7 R1; Danio rerio; RNA Seq | GSM7804166 r1 | GSM7804166 | 1 | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP463130 | SS2_18_354_E7_R1.fastq.gz | fastq | 30522002.0 | 709814.0 | GSM7804166 r1 | 0:43 | A:8167984;C:7033955;G:7127866;T:8192197;N:0 | 43 | 8167984 | 7033955 | 7127866 | 8192197 | 0 | SRX21885950 | SRS18977075 | SRA1719948 | Neuroscience, Karolinaska Institutet | Neuroscience, Karolinaska Institutet | 1 | 0.87804 | 0.20762 | 0.88418 | 0.51381 | 43 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_plate | smartseq | Sweden | 2023-09-25 | Juvenile | Juvenile | Spinal Cord | Nervous System | |||||||||||||||||||
| 26569 | 26569 | SRR26173870 | SRX21885949 | SRS18977074 | SRP463130 | PRJNA1020854 | Molecular blueprints for spinal circuit modules controlling locomotor speed | GSE243993 | Transcriptome Analysis | The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2. | pubmed:37919423 | V2a sample2 354 E6 R1 | GSM7804165 | source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing | V2a sample2 354 E6 R1 | The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis | Spinal cord | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons | GSM7804165 | GSM7804165: V2a sample2 354 E6 R1; Danio rerio; RNA Seq | GSM7804165 r1 | GSM7804165 | 1 | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP463130 | SS2_18_354_E6_R1.fastq.gz | fastq | 39095858.0 | 909206.0 | GSM7804165 r1 | 0:43 | A:10597068;C:8804712;G:8974908;T:10719170;N:0 | 43 | 10597068 | 8804712 | 8974908 | 10719170 | 0 | SRX21885949 | SRS18977074 | SRA1719948 | Neuroscience, Karolinaska Institutet | Neuroscience, Karolinaska Institutet | 1 | 0.8093 | 0.38297 | 0.91545 | 0.56195 | 43 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_plate | smartseq | Sweden | 2023-09-25 | Juvenile | Juvenile | Spinal Cord | Nervous System | |||||||||||||||||||
| 26570 | 26570 | SRR26173871 | SRX21885948 | SRS18977073 | SRP463130 | PRJNA1020854 | Molecular blueprints for spinal circuit modules controlling locomotor speed | GSE243993 | Transcriptome Analysis | The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2. | pubmed:37919423 | V2a sample2 354 E5 R1 | GSM7804164 | source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing | V2a sample2 354 E5 R1 | The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis | Spinal cord | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons | GSM7804164 | GSM7804164: V2a sample2 354 E5 R1; Danio rerio; RNA Seq | GSM7804164 r1 | GSM7804164 | 1 | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP463130 | SS2_18_354_E5_R1.fastq.gz | fastq | 33632880.0 | 782160.0 | GSM7804164 r1 | 0:43 | A:9099447;C:7602241;G:7747634;T:9183558;N:0 | 43 | 9099447 | 7602241 | 7747634 | 9183558 | 0 | SRX21885948 | SRS18977073 | SRA1719948 | Neuroscience, Karolinaska Institutet | Neuroscience, Karolinaska Institutet | 1 | 0.83226 | 0.28405 | 0.90715 | 0.52148 | 43 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_plate | smartseq | Sweden | 2023-09-25 | Juvenile | Juvenile | Spinal Cord | Nervous System | |||||||||||||||||||
| 26571 | 26571 | SRR26173872 | SRX21885947 | SRS18977072 | SRP463130 | PRJNA1020854 | Molecular blueprints for spinal circuit modules controlling locomotor speed | GSE243993 | Transcriptome Analysis | The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2. | pubmed:37919423 | V2a sample2 354 E4 R1 | GSM7804163 | source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing | V2a sample2 354 E4 R1 | The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis | Spinal cord | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons | GSM7804163 | GSM7804163: V2a sample2 354 E4 R1; Danio rerio; RNA Seq | GSM7804163 r1 | GSM7804163 | 1 | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP463130 | SS2_18_354_E4_R1.fastq.gz | fastq | 10823057.0 | 251699.0 | GSM7804163 r1 | 0:43 | A:3014035;C:2419189;G:2487845;T:2901988;N:0 | 43 | 3014035 | 2419189 | 2487845 | 2901988 | 0 | SRX21885947 | SRS18977072 | SRA1719948 | Neuroscience, Karolinaska Institutet | Neuroscience, Karolinaska Institutet | 1 | 0.85783 | 0.26946 | 0.91033 | 0.52459 | 43 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_plate | smartseq | Sweden | 2023-09-25 | Juvenile | Juvenile | Spinal Cord | Nervous System | |||||||||||||||||||
| 26572 | 26572 | SRR26173873 | SRX21885946 | SRS18977068 | SRP463130 | PRJNA1020854 | Molecular blueprints for spinal circuit modules controlling locomotor speed | GSE243993 | Transcriptome Analysis | The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2. | pubmed:37919423 | V2a sample2 354 E3 R1 | GSM7804162 | source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing | V2a sample2 354 E3 R1 | The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis | Spinal cord | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons | GSM7804162 | GSM7804162: V2a sample2 354 E3 R1; Danio rerio; RNA Seq | GSM7804162 r1 | GSM7804162 | 1 | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP463130 | SS2_18_354_E3_R1.fastq.gz | fastq | 49775381.0 | 1157567.0 | GSM7804162 r1 | 0:43 | A:13325978;C:11313973;G:11568082;T:13567348;N:0 | 43 | 13325978 | 11313973 | 11568082 | 13567348 | 0 | SRX21885946 | SRS18977068 | SRA1719948 | Neuroscience, Karolinaska Institutet | Neuroscience, Karolinaska Institutet | 1 | 0.80873 | 0.29504 | 0.93791 | 0.52789 | 43 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_plate | smartseq | Sweden | 2023-09-25 | Juvenile | Juvenile | Spinal Cord | Nervous System | |||||||||||||||||||
| 26573 | 26573 | SRR26173874 | SRX21885945 | SRS18977070 | SRP463130 | PRJNA1020854 | Molecular blueprints for spinal circuit modules controlling locomotor speed | GSE243993 | Transcriptome Analysis | The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2. | pubmed:37919423 | V2a sample2 354 E2 R1 | GSM7804161 | source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing | V2a sample2 354 E2 R1 | The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis | Spinal cord | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons | GSM7804161 | GSM7804161: V2a sample2 354 E2 R1; Danio rerio; RNA Seq | GSM7804161 r1 | GSM7804161 | 1 | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP463130 | SS2_18_354_E2_R1.fastq.gz | fastq | 44072334.0 | 1024938.0 | GSM7804161 r1 | 0:43 | A:11780930;C:10068667;G:10185567;T:12037170;N:0 | 43 | 11780930 | 10068667 | 10185567 | 12037170 | 0 | SRX21885945 | SRS18977070 | SRA1719948 | Neuroscience, Karolinaska Institutet | Neuroscience, Karolinaska Institutet | 1 | 0.78009 | 0.2621 | 0.943 | 0.54719 | 43 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_plate | smartseq | Sweden | 2023-09-25 | Juvenile | Juvenile | Spinal Cord | Nervous System | |||||||||||||||||||
| 26574 | 26574 | SRR26173875 | SRX21885944 | SRS18977071 | SRP463130 | PRJNA1020854 | Molecular blueprints for spinal circuit modules controlling locomotor speed | GSE243993 | Transcriptome Analysis | The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2. | pubmed:37919423 | V2a sample2 354 D1 R1 | GSM7804136 | source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing | V2a sample2 354 D1 R1 | The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis | Spinal cord | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons | GSM7804136 | GSM7804136: V2a sample2 354 D1 R1; Danio rerio; RNA Seq | GSM7804136 r1 | GSM7804136 | 1 | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP463130 | SS2_18_354_D1_R1.fastq.gz | fastq | 49923.0 | 1161.0 | GSM7804136 r1 | 0:43 | A:12799;C:11604;G:11134;T:14386;N:0 | 43 | 12799 | 11604 | 11134 | 14386 | 0 | SRX21885944 | SRS18977071 | SRA1719948 | Neuroscience, Karolinaska Institutet | Neuroscience, Karolinaska Institutet | 1 | 0.5773 | 0.18478 | 0.99472 | 0.51097 | 43 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_plate | smartseq | Sweden | 2023-09-25 | Juvenile | Juvenile | Spinal Cord | Nervous System | |||||||||||||||||||
| 26575 | 26575 | SRR26173876 | SRX21885943 | SRS18977069 | SRP463130 | PRJNA1020854 | Molecular blueprints for spinal circuit modules controlling locomotor speed | GSE243993 | Transcriptome Analysis | The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2. | pubmed:37919423 | V2a sample2 354 C24 R1 | GSM7804135 | source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing | V2a sample2 354 C24 R1 | The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis | Spinal cord | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons | GSM7804135 | GSM7804135: V2a sample2 354 C24 R1; Danio rerio; RNA Seq | GSM7804135 r1 | GSM7804135 | 1 | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP463130 | SS2_18_354_C24_R1.fastq.gz | fastq | 30735540.0 | 714780.0 | GSM7804135 r1 | 0:43 | A:7999390;C:7036767;G:7190113;T:8509270;N:0 | 43 | 7999390 | 7036767 | 7190113 | 8509270 | 0 | SRX21885943 | SRS18977069 | SRA1719948 | Neuroscience, Karolinaska Institutet | Neuroscience, Karolinaska Institutet | 1 | 0.48457 | 0.16974 | 0.99328 | 0.82979 | 43 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_plate | smartseq | Sweden | 2023-09-25 | Juvenile | Juvenile | Spinal Cord | Nervous System | |||||||||||||||||||
| 26576 | 26576 | SRR26173877 | SRX21885942 | SRS18977067 | SRP463130 | PRJNA1020854 | Molecular blueprints for spinal circuit modules controlling locomotor speed | GSE243993 | Transcriptome Analysis | The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2. | pubmed:37919423 | V2a sample2 354 C23 R1 | GSM7804134 | source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing | V2a sample2 354 C23 R1 | The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis | Spinal cord | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons | GSM7804134 | GSM7804134: V2a sample2 354 C23 R1; Danio rerio; RNA Seq | GSM7804134 r1 | GSM7804134 | 1 | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP463130 | SS2_18_354_C23_R1.fastq.gz | fastq | 24386031.0 | 567117.0 | GSM7804134 r1 | 0:43 | A:6620599;C:5230020;G:5371347;T:7164065;N:0 | 43 | 6620599 | 5230020 | 5371347 | 7164065 | 0 | SRX21885942 | SRS18977067 | SRA1719948 | Neuroscience, Karolinaska Institutet | Neuroscience, Karolinaska Institutet | 1 | 0.55183 | 0.13531 | 0.99105 | 0.54904 | 43 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_plate | smartseq | Sweden | 2023-09-25 | Juvenile | Juvenile | Spinal Cord | Nervous System | |||||||||||||||||||
| 26577 | 26577 | SRR26173878 | SRX21885941 | SRS18977064 | SRP463130 | PRJNA1020854 | Molecular blueprints for spinal circuit modules controlling locomotor speed | GSE243993 | Transcriptome Analysis | The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2. | pubmed:37919423 | V2a sample2 354 C22 R1 | GSM7804133 | source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing | V2a sample2 354 C22 R1 | The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis | Spinal cord | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons | GSM7804133 | GSM7804133: V2a sample2 354 C22 R1; Danio rerio; RNA Seq | GSM7804133 r1 | GSM7804133 | 1 | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP463130 | SS2_18_354_C22_R1.fastq.gz | fastq | 35984550.0 | 836850.0 | GSM7804133 r1 | 0:43 | A:9917644;C:7959027;G:8126203;T:9981676;N:0 | 43 | 9917644 | 7959027 | 8126203 | 9981676 | 0 | SRX21885941 | SRS18977064 | SRA1719948 | Neuroscience, Karolinaska Institutet | Neuroscience, Karolinaska Institutet | 1 | 0.85473 | 0.2804 | 0.91165 | 0.52909 | 43 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_plate | smartseq | Sweden | 2023-09-25 | Juvenile | Juvenile | Spinal Cord | Nervous System | |||||||||||||||||||
| 26578 | 26578 | SRR26173879 | SRX21885940 | SRS18977065 | SRP463130 | PRJNA1020854 | Molecular blueprints for spinal circuit modules controlling locomotor speed | GSE243993 | Transcriptome Analysis | The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2. | pubmed:37919423 | V2a sample2 354 C21 R1 | GSM7804132 | source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing | V2a sample2 354 C21 R1 | The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis | Spinal cord | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons | GSM7804132 | GSM7804132: V2a sample2 354 C21 R1; Danio rerio; RNA Seq | GSM7804132 r1 | GSM7804132 | 1 | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP463130 | SS2_18_354_C21_R1.fastq.gz | fastq | 32265738.0 | 750366.0 | GSM7804132 r1 | 0:43 | A:8963112;C:7046873;G:7192067;T:9063686;N:0 | 43 | 8963112 | 7046873 | 7192067 | 9063686 | 0 | SRX21885940 | SRS18977065 | SRA1719948 | Neuroscience, Karolinaska Institutet | Neuroscience, Karolinaska Institutet | 1 | 0.8426 | 0.36876 | 0.91179 | 0.58759 | 43 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_plate | smartseq | Sweden | 2023-09-25 | Juvenile | Juvenile | Spinal Cord | Nervous System | |||||||||||||||||||
| 26579 | 26579 | SRR26173880 | SRX21885939 | SRS18977066 | SRP463130 | PRJNA1020854 | Molecular blueprints for spinal circuit modules controlling locomotor speed | GSE243993 | Transcriptome Analysis | The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2. | pubmed:37919423 | V2a sample2 354 C20 R1 | GSM7804131 | source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing | V2a sample2 354 C20 R1 | The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis | Spinal cord | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons | GSM7804131 | GSM7804131: V2a sample2 354 C20 R1; Danio rerio; RNA Seq | GSM7804131 r1 | GSM7804131 | 1 | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP463130 | SS2_18_354_C20_R1.fastq.gz | fastq | 33471157.0 | 778399.0 | GSM7804131 r1 | 0:43 | A:9073629;C:7510863;G:7675381;T:9211284;N:0 | 43 | 9073629 | 7510863 | 7675381 | 9211284 | 0 | SRX21885939 | SRS18977066 | SRA1719948 | Neuroscience, Karolinaska Institutet | Neuroscience, Karolinaska Institutet | 1 | 0.82141 | 0.28926 | 0.93655 | 0.49873 | 43 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_plate | smartseq | Sweden | 2023-09-25 | Juvenile | Juvenile | Spinal Cord | Nervous System | |||||||||||||||||||
| 26580 | 26580 | SRR26173881 | SRX21885938 | SRS18977062 | SRP463130 | PRJNA1020854 | Molecular blueprints for spinal circuit modules controlling locomotor speed | GSE243993 | Transcriptome Analysis | The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2. | pubmed:37919423 | V2a sample2 354 C19 R1 | GSM7804130 | source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing | V2a sample2 354 C19 R1 | The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis | Spinal cord | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons | GSM7804130 | GSM7804130: V2a sample2 354 C19 R1; Danio rerio; RNA Seq | GSM7804130 r1 | GSM7804130 | 1 | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP463130 | SS2_18_354_C19_R1.fastq.gz | fastq | 30131304.0 | 700728.0 | GSM7804130 r1 | 0:43 | A:8036932;C:6893678;G:7034855;T:8165839;N:0 | 43 | 8036932 | 6893678 | 7034855 | 8165839 | 0 | SRX21885938 | SRS18977062 | SRA1719948 | Neuroscience, Karolinaska Institutet | Neuroscience, Karolinaska Institutet | 1 | 0.80896 | 0.25245 | 0.94067 | 0.54072 | 43 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_plate | smartseq | Sweden | 2023-09-25 | Juvenile | Juvenile | Spinal Cord | Nervous System | |||||||||||||||||||
| 26581 | 26581 | SRR26173882 | SRX21885937 | SRS18977061 | SRP463130 | PRJNA1020854 | Molecular blueprints for spinal circuit modules controlling locomotor speed | GSE243993 | Transcriptome Analysis | The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2. | pubmed:37919423 | V2a sample2 354 C18 R1 | GSM7804129 | source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing | V2a sample2 354 C18 R1 | The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis | Spinal cord | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons | GSM7804129 | GSM7804129: V2a sample2 354 C18 R1; Danio rerio; RNA Seq | GSM7804129 r1 | GSM7804129 | 1 | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP463130 | SS2_18_354_C18_R1.fastq.gz | fastq | 31050429.0 | 722103.0 | GSM7804129 r1 | 0:43 | A:8363024;C:7088111;G:7227301;T:8371993;N:0 | 43 | 8363024 | 7088111 | 7227301 | 8371993 | 0 | SRX21885937 | SRS18977061 | SRA1719948 | Neuroscience, Karolinaska Institutet | Neuroscience, Karolinaska Institutet | 1 | 0.87399 | 0.20843 | 0.89881 | 0.49682 | 43 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_plate | smartseq | Sweden | 2023-09-25 | Juvenile | Juvenile | Spinal Cord | Nervous System | |||||||||||||||||||
| 26582 | 26582 | SRR26173883 | SRX21885936 | SRS18977063 | SRP463130 | PRJNA1020854 | Molecular blueprints for spinal circuit modules controlling locomotor speed | GSE243993 | Transcriptome Analysis | The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2. | pubmed:37919423 | V2a sample2 354 B17 R1 | GSM7804104 | source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing | V2a sample2 354 B17 R1 | The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis | Spinal cord | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons | GSM7804104 | GSM7804104: V2a sample2 354 B17 R1; Danio rerio; RNA Seq | GSM7804104 r1 | GSM7804104 | 1 | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP463130 | SS2_18_354_B17_R1.fastq.gz | fastq | 47093729.0 | 1095203.0 | GSM7804104 r1 | 0:43 | A:13057598;C:10185883;G:10457076;T:13393172;N:0 | 43 | 13057598 | 10185883 | 10457076 | 13393172 | 0 | SRX21885936 | SRS18977063 | SRA1719948 | Neuroscience, Karolinaska Institutet | Neuroscience, Karolinaska Institutet | 1 | 0.80343 | 0.36098 | 0.95059 | 0.52562 | 43 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_plate | smartseq | Sweden | 2023-09-25 | Juvenile | Juvenile | Spinal Cord | Nervous System | |||||||||||||||||||
| 26583 | 26583 | SRR26173884 | SRX21885935 | SRS18977060 | SRP463130 | PRJNA1020854 | Molecular blueprints for spinal circuit modules controlling locomotor speed | GSE243993 | Transcriptome Analysis | The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2. | pubmed:37919423 | V2a sample2 354 B16 R1 | GSM7804103 | source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing | V2a sample2 354 B16 R1 | The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis | Spinal cord | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons | GSM7804103 | GSM7804103: V2a sample2 354 B16 R1; Danio rerio; RNA Seq | GSM7804103 r1 | GSM7804103 | 1 | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP463130 | SS2_18_354_B16_R1.fastq.gz | fastq | 34160791.0 | 794437.0 | GSM7804103 r1 | 0:43 | A:9178469;C:7729053;G:7901331;T:9351938;N:0 | 43 | 9178469 | 7729053 | 7901331 | 9351938 | 0 | SRX21885935 | SRS18977060 | SRA1719948 | Neuroscience, Karolinaska Institutet | Neuroscience, Karolinaska Institutet | 1 | 0.79028 | 0.25695 | 0.94627 | 0.51668 | 43 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_plate | smartseq | Sweden | 2023-09-25 | Juvenile | Juvenile | Spinal Cord | Nervous System | |||||||||||||||||||
| 26584 | 26584 | SRR26173885 | SRX21885934 | SRS18977059 | SRP463130 | PRJNA1020854 | Molecular blueprints for spinal circuit modules controlling locomotor speed | GSE243993 | Transcriptome Analysis | The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2. | pubmed:37919423 | V2a sample2 354 B15 R1 | GSM7804102 | source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing | V2a sample2 354 B15 R1 | The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis | Spinal cord | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons | GSM7804102 | GSM7804102: V2a sample2 354 B15 R1; Danio rerio; RNA Seq | GSM7804102 r1 | GSM7804102 | 1 | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP463130 | SS2_18_354_B15_R1.fastq.gz | fastq | 29152495.0 | 677965.0 | GSM7804102 r1 | 0:43 | A:7966546;C:6516464;G:6675123;T:7994362;N:0 | 43 | 7966546 | 6516464 | 6675123 | 7994362 | 0 | SRX21885934 | SRS18977059 | SRA1719948 | Neuroscience, Karolinaska Institutet | Neuroscience, Karolinaska Institutet | 1 | 0.83832 | 0.25969 | 0.92673 | 0.51661 | 43 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_plate | smartseq | Sweden | 2023-09-25 | Juvenile | Juvenile | Spinal Cord | Nervous System | |||||||||||||||||||
| 26585 | 26585 | SRR26173886 | SRX21885933 | SRS18977057 | SRP463130 | PRJNA1020854 | Molecular blueprints for spinal circuit modules controlling locomotor speed | GSE243993 | Transcriptome Analysis | The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2. | pubmed:37919423 | V2a sample2 354 B14 R1 | GSM7804101 | source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing | V2a sample2 354 B14 R1 | The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis | Spinal cord | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons | GSM7804101 | GSM7804101: V2a sample2 354 B14 R1; Danio rerio; RNA Seq | GSM7804101 r1 | GSM7804101 | 1 | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP463130 | SS2_18_354_B14_R1.fastq.gz | fastq | 23811379.0 | 553753.0 | GSM7804101 r1 | 0:43 | A:6532691;C:5215122;G:5353003;T:6710563;N:0 | 43 | 6532691 | 5215122 | 5353003 | 6710563 | 0 | SRX21885933 | SRS18977057 | SRA1719948 | Neuroscience, Karolinaska Institutet | Neuroscience, Karolinaska Institutet | 1 | 0.74067 | 0.3282 | 0.95272 | 0.49582 | 43 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_plate | smartseq | Sweden | 2023-09-25 | Juvenile | Juvenile | Spinal Cord | Nervous System | |||||||||||||||||||
| 26586 | 26586 | SRR26173887 | SRX21885932 | SRS18977058 | SRP463130 | PRJNA1020854 | Molecular blueprints for spinal circuit modules controlling locomotor speed | GSE243993 | Transcriptome Analysis | The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2. | pubmed:37919423 | V2a sample2 354 B13 R1 | GSM7804100 | source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing | V2a sample2 354 B13 R1 | The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis | Spinal cord | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons | GSM7804100 | GSM7804100: V2a sample2 354 B13 R1; Danio rerio; RNA Seq | GSM7804100 r1 | GSM7804100 | 1 | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP463130 | SS2_18_354_B13_R1.fastq.gz | fastq | 18141356.0 | 421892.0 | GSM7804100 r1 | 0:43 | A:4926550;C:4092334;G:4186281;T:4936191;N:0 | 43 | 4926550 | 4092334 | 4186281 | 4936191 | 0 | SRX21885932 | SRS18977058 | SRA1719948 | Neuroscience, Karolinaska Institutet | Neuroscience, Karolinaska Institutet | 1 | 0.87463 | 0.22642 | 0.89826 | 0.50541 | 43 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_plate | smartseq | Sweden | 2023-09-25 | Juvenile | Juvenile | Spinal Cord | Nervous System | |||||||||||||||||||
| 26587 | 26587 | SRR26173888 | SRX21885931 | SRS18977056 | SRP463130 | PRJNA1020854 | Molecular blueprints for spinal circuit modules controlling locomotor speed | GSE243993 | Transcriptome Analysis | The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2. | pubmed:37919423 | V2a sample2 354 B12 R1 | GSM7804099 | source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing | V2a sample2 354 B12 R1 | The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis | Spinal cord | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons | GSM7804099 | GSM7804099: V2a sample2 354 B12 R1; Danio rerio; RNA Seq | GSM7804099 r1 | GSM7804099 | 1 | Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP463130 | SS2_18_354_B12_R1.fastq.gz | fastq | 34932039.0 | 812373.0 | GSM7804099 r1 | 0:43 | A:9555191;C:7704451;G:7897587;T:9774810;N:0 | 43 | 9555191 | 7704451 | 7897587 | 9774810 | 0 | SRX21885931 | SRS18977056 | SRA1719948 | Neuroscience, Karolinaska Institutet | Neuroscience, Karolinaska Institutet | 1 | 0.80402 | 0.30224 | 0.93592 | 0.53659 | 43 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_plate | smartseq | Sweden | 2023-09-25 | Juvenile | Juvenile | Spinal Cord | Nervous System |
Advanced export
JSON shape: default, array, newline-delimited
CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;