metadata: run_metadata: 5,211 rows where experiment.library_selection = "cDNA", experiment.library_source = "TRANSCRIPTOMIC" and tissue_curation

5,211 rows where experiment.library_selection = "cDNA", experiment.library_source = "TRANSCRIPTOMIC" and tissue_curation_coarse = "Nervous System"

descending

Link	rowid ▼	run.accession	experiment.accession	sample.accession	study.accession	bioproject	study.title	study.alias	study.type	study.abstract	study.attributes	study.PMIDs	sample.description	sample.title	sample.alias	sample.centername	sample.attributes	GEOsample.title	GEOsample.dataprocessing	GEOsample.source	GEOsample.treatmentprotocol	GEOsample.extractprotocol	GEOsample.growthprotocol	GEOsample.characteristics	GEOsample.accession	experiment.title	experiment.alias	experiment.library_name	experiment.design_description	experiment.library_construction_protocol	experiment.attributes	experiment.library_strategy	experiment.library_source	experiment.library_selection	experiment.library_layout	experiment.platform	experiment.instrument_model	experiment.spot_descriptor	experiment.study_ref	run.title	run.attributes	run.filename	run.semantic_name	run.total_bases	run.total_spots	run.alias	run.read_lengths	run.base_counts	run.r1_length	run.r2_length	run.r3_length	run.Acount	run.Ccount	run.Gcount	run.Tcount	run.Ncount	run.experiment	run.pool_member	submission.accession	submission.srasource	submission.bioprojectsource	seqdetective.n_mates	seqdetective.mapping_rate.mate1	seqdetective.mapping_rate.mate2	seqdetective.nofeature_rate.mate1	seqdetective.nofeature_rate.mate2	seqdetective.sparsity.mate1	seqdetective.sparsity.mate2	seqdetective.pos_strand_rate.mate1	seqdetective.pos_strand_rate.mate2	seqdetective.readlen.mate1	seqdetective.readlen.mate2	seqdetective.judgement.mate1	seqdetective.judgement.mate2	seqdetective.judgement.reason	platform_family	instrument_generation	read_bias	selection_class	prep_kit	sc_or_bulk	tech_class	technology	submission.bioprojectsource.country	earliest_date	devstage_curation	devstage_curation_coarse	tissue_curation	tissue_curation_coarse
44	44	DRR668250	DRX648352	DRS458865	DRP012880	PRJDB18466	Comparison of spinal cord regeneration capacity in zebrafish and medaka	PRJDB18466	Other	Unlike mammals zebrafish have the remarkable ability to regenerate many tissues including the spinal cord. Medaka another model fish species has a low regenerative ability in the spinal cord. Therefore comparisons with them advantageous to revealing regeneration specific mechanisms in the spinal cord. The comparison of the spinal cord regeneration abilities of zebrafish and medaka could be a promising research field to elucidate new factors that determine spinal cord regeneration ability.		pubmed:40278963	Zebrafish 2 weeks post spinal cord injury replicate 3	Zebrafish 2wpi 3	SAMD00799623		sample name:Zebrafish 2wpi 3\|biological replicate:3\|biomaterial provider:Center of Medical Innovation and Translational Research Osaka University\|collection date:2023 04 25\|dev stage:Adult\|geo loc name:Japan\|sex:not determined\|strain:AB Zebrafish\|tissue:Spinal cord									DNBSEQ G400 paired end sequencing of SAMD00799623	DRX648352	RNA seq of spinal cord in zebrafish at 2wpi injured 3	1	Total RNA was extracted using RNeasy Micro Kit Qiagen 74104 with DNase treatment RNase Free DNase Set Qiagen 79254. Libraries were constructed from the amplified total RNA.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	DNBSEQ	DNBSEQ-G400		DRP012880	DNBSEQ G400 paired end sequencing of SAMD00799623				14782516800.0	73912584.0	DRR668250	0:100 1:100	A:4058090278;C:3335994894;G:3323563782;T:4062467903;N:2399943	100	100		4058090278	3335994894	3323563782	4062467903	2399943	DRX648352	DRS458865	DRA020617	Osaka University	Osaka University												B	B	biological fallback assumption	bgi	bgi	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	Japan	2025-05-12	Adult	Adult	Spinal Cord	Nervous System
45	45	DRR668249	DRX648351	DRS458864	DRP012880	PRJDB18466	Comparison of spinal cord regeneration capacity in zebrafish and medaka	PRJDB18466	Other	Unlike mammals zebrafish have the remarkable ability to regenerate many tissues including the spinal cord. Medaka another model fish species has a low regenerative ability in the spinal cord. Therefore comparisons with them advantageous to revealing regeneration specific mechanisms in the spinal cord. The comparison of the spinal cord regeneration abilities of zebrafish and medaka could be a promising research field to elucidate new factors that determine spinal cord regeneration ability.		pubmed:40278963	Zebrafish 2 weeks post spinal cord injury replicate 2	Zebrafish 2wpi 2	SAMD00799622		sample name:Zebrafish 2wpi 2\|biological replicate:2\|biomaterial provider:Center of Medical Innovation and Translational Research Osaka University\|collection date:2023 04 14\|dev stage:Adult\|geo loc name:Japan\|sex:not determined\|strain:AB Zebrafish\|tissue:Spinal cord									DNBSEQ G400 paired end sequencing of SAMD00799622	DRX648351	RNA seq of spinal cord in zebrafish at 2wpi injured 2	1	Total RNA was extracted using RNeasy Micro Kit Qiagen 74104 with DNase treatment RNase Free DNase Set Qiagen 79254. Libraries were constructed from the amplified total RNA.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	DNBSEQ	DNBSEQ-G400		DRP012880	DNBSEQ G400 paired end sequencing of SAMD00799622				13687641800.0	68438209.0	DRR668249	0:100 1:100	A:3759784620;C:3087398782;G:3083881581;T:3754378915;N:2197902	100	100		3759784620	3087398782	3083881581	3754378915	2197902	DRX648351	DRS458864	DRA020617	Osaka University	Osaka University												B	B	biological fallback assumption	bgi	bgi	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	Japan	2025-05-12	Adult	Adult	Spinal Cord	Nervous System
46	46	DRR668248	DRX648350	DRS458863	DRP012880	PRJDB18466	Comparison of spinal cord regeneration capacity in zebrafish and medaka	PRJDB18466	Other	Unlike mammals zebrafish have the remarkable ability to regenerate many tissues including the spinal cord. Medaka another model fish species has a low regenerative ability in the spinal cord. Therefore comparisons with them advantageous to revealing regeneration specific mechanisms in the spinal cord. The comparison of the spinal cord regeneration abilities of zebrafish and medaka could be a promising research field to elucidate new factors that determine spinal cord regeneration ability.		pubmed:40278963	Zebrafish 2 weeks post spinal cord injury replicate 1	Zebrafish 2wpi 1	SAMD00799621		sample name:Zebrafish 2wpi 1\|biological replicate:1\|biomaterial provider:Center of Medical Innovation and Translational Research Osaka University\|collection date:2023 04 14\|dev stage:Adult\|geo loc name:Japan\|sex:not determined\|strain:AB Zebrafish\|tissue:Spinal cord									DNBSEQ G400 paired end sequencing of SAMD00799621	DRX648350	RNA seq of spinal cord in zebrafish at 2wpi injured 1	1	Total RNA was extracted using RNeasy Micro Kit Qiagen 74104 with DNase treatment RNase Free DNase Set Qiagen 79254. Libraries were constructed from the amplified total RNA.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	DNBSEQ	DNBSEQ-G400		DRP012880	DNBSEQ G400 paired end sequencing of SAMD00799621				16376197200.0	81880986.0	DRR668248	0:100 1:100	A:4485868844;C:3700974430;G:3710833937;T:4475827800;N:2692189	100	100		4485868844	3700974430	3710833937	4475827800	2692189	DRX648350	DRS458863	DRA020617	Osaka University	Osaka University												B	B	biological fallback assumption	bgi	bgi	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	Japan	2025-05-12	Adult	Adult	Spinal Cord	Nervous System
47	47	DRR668247	DRX648349	DRS458862	DRP012880	PRJDB18466	Comparison of spinal cord regeneration capacity in zebrafish and medaka	PRJDB18466	Other	Unlike mammals zebrafish have the remarkable ability to regenerate many tissues including the spinal cord. Medaka another model fish species has a low regenerative ability in the spinal cord. Therefore comparisons with them advantageous to revealing regeneration specific mechanisms in the spinal cord. The comparison of the spinal cord regeneration abilities of zebrafish and medaka could be a promising research field to elucidate new factors that determine spinal cord regeneration ability.		pubmed:40278963	Zebrafish Intact biological replicate 3	Zebrafish Control 3	SAMD00799620		sample name:Zebrafish Control 3\|biological replicate:3\|biomaterial provider:Center of Medical Innovation and Translational Research Osaka University\|collection date:2023 04 21\|dev stage:Adult\|geo loc name:Japan\|sex:not determined\|strain:AB Zebrafish\|tissue:Spinal cord									DNBSEQ G400 paired end sequencing of SAMD00799620	DRX648349	RNA seq of spinal cord in zebrafish at 0wpi control 3	1	Total RNA was extracted using RNeasy Micro Kit Qiagen 74104 with DNase treatment RNase Free DNase Set Qiagen 79254. Libraries were constructed from the amplified total RNA.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	DNBSEQ	DNBSEQ-G400		DRP012880	DNBSEQ G400 paired end sequencing of SAMD00799620				13377538600.0	66887693.0	DRR668247	0:100 1:100	A:3725064764;C:2973653932;G:2980883214;T:3695767890;N:2168800	100	100		3725064764	2973653932	2980883214	3695767890	2168800	DRX648349	DRS458862	DRA020617	Osaka University	Osaka University												B	B	biological fallback assumption	bgi	bgi	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	Japan	2025-05-12	Adult	Adult	Spinal Cord	Nervous System
48	48	DRR668246	DRX648348	DRS458861	DRP012880	PRJDB18466	Comparison of spinal cord regeneration capacity in zebrafish and medaka	PRJDB18466	Other	Unlike mammals zebrafish have the remarkable ability to regenerate many tissues including the spinal cord. Medaka another model fish species has a low regenerative ability in the spinal cord. Therefore comparisons with them advantageous to revealing regeneration specific mechanisms in the spinal cord. The comparison of the spinal cord regeneration abilities of zebrafish and medaka could be a promising research field to elucidate new factors that determine spinal cord regeneration ability.		pubmed:40278963	Zebrafish Intact biological replicate 2	Zebrafish Control 2	SAMD00799619		sample name:Zebrafish Control 2\|biological replicate:2\|biomaterial provider:Center of Medical Innovation and Translational Research Osaka University\|collection date:2023 04 21\|dev stage:Adult\|geo loc name:Japan\|sex:not determined\|strain:AB Zebrafish\|tissue:Spinal cord									DNBSEQ G400 paired end sequencing of SAMD00799619	DRX648348	RNA seq of spinal cord in zebrafish at 0wpi control 2	1	Total RNA was extracted using RNeasy Micro Kit Qiagen 74104 with DNase treatment RNase Free DNase Set Qiagen 79254. Libraries were constructed from the amplified total RNA.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	DNBSEQ	DNBSEQ-G400		DRP012880	DNBSEQ G400 paired end sequencing of SAMD00799619				14971411400.0	74857057.0	DRR668246	0:100 1:100	A:4160326445;C:3329083037;G:3329123314;T:4150453700;N:2424904	100	100		4160326445	3329083037	3329123314	4150453700	2424904	DRX648348	DRS458861	DRA020617	Osaka University	Osaka University												B	B	biological fallback assumption	bgi	bgi	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	Japan	2025-05-12	Adult	Adult	Spinal Cord	Nervous System
49	49	DRR668245	DRX648347	DRS458860	DRP012880	PRJDB18466	Comparison of spinal cord regeneration capacity in zebrafish and medaka	PRJDB18466	Other	Unlike mammals zebrafish have the remarkable ability to regenerate many tissues including the spinal cord. Medaka another model fish species has a low regenerative ability in the spinal cord. Therefore comparisons with them advantageous to revealing regeneration specific mechanisms in the spinal cord. The comparison of the spinal cord regeneration abilities of zebrafish and medaka could be a promising research field to elucidate new factors that determine spinal cord regeneration ability.		pubmed:40278963	Zebrafish Intact biological replicate 1	Zebrafish Control 1	SAMD00799618		sample name:Zebrafish Control 1\|biological replicate:1\|biomaterial provider:Center of Medical Innovation and Translational Research Osaka University\|collection date:2024 05 04\|dev stage:Adult\|geo loc name:Japan\|sex:not determined\|strain:AB Zebrafish\|tissue:Spinal cord									DNBSEQ G400 paired end sequencing of SAMD00799618	DRX648347	RNA seq of spinal cord in zebrafish at 0wpi control 1	1	Total RNA was extracted using RNeasy Micro Kit Qiagen 74104 with DNase treatment RNase Free DNase Set Qiagen 79254. Libraries were constructed from the amplified total RNA.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	DNBSEQ	DNBSEQ-G400		DRP012880	DNBSEQ G400 paired end sequencing of SAMD00799618				13912523800.0	69562619.0	DRR668245	0:100 1:100	A:3888902049;C:3079617959;G:3075111814;T:3866655202;N:2236776	100	100		3888902049	3079617959	3075111814	3866655202	2236776	DRX648347	DRS458860	DRA020617	Osaka University	Osaka University												B	B	biological fallback assumption	bgi	bgi	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	Japan	2025-05-12	Adult	Adult	Spinal Cord	Nervous System
131	131	DRR189373	DRX179838	DRS200446	DRP003977	PRJDB4470	Gene expression analysis of the zebrafish brain	DRP003977	Other	Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.				Dissociated cells from telencephalon of wild type adult zebrafish 3	SAMD00182216		sample name:Cell Tel 3\|genotype:wild type\|tissue:brain									Illumina HiSeq 2500 paired end sequencing of SAMD00182216	DRX179838	Cell Tel 3	1	The cDNA was amplified using SMARTer v4. Sequence libraries were produced from cDNA using Nextera XT DNA library kit Illumina.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>200</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>101</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP003977	Illumina HiSeq 2500 paired end sequencing of SAMD00182216				4142772200.0	20713861.0	DRR189373	0:100 1:100	A:1185533233;C:877739936;G:877025820;T:1202041821;N:431390	100	100		1185533233	877739936	877025820	1202041821	431390	DRX179838	DRS200446	DRA008855	NIG\|National Institute of Genetics (Japan)	National Institute of Genetics (Japan)	2	0.9018	0.90073	0.24953	0.25062	0.67884	0.67957	0.49957	0.5402	100	100	B	B	biological fallback assumption	illumina	hiseq_era	full_length	cdna_unspecified	nextera	bulk	unknown	unknown	Japan	2021-08-08	Adult	Adult	Brain	Nervous System
132	132	DRR189372	DRX179837	DRS200445	DRP003977	PRJDB4470	Gene expression analysis of the zebrafish brain	DRP003977	Other	Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.				Dissociated cells from telencephalon of wild type adult zebrafish 2	SAMD00182215		sample name:Cell Tel 2\|genotype:wild type\|tissue:brain									Illumina HiSeq 2500 paired end sequencing of SAMD00182215	DRX179837	Cell Tel 2	1	The cDNA was amplified using SMARTer v4. Sequence libraries were produced from cDNA using Nextera XT DNA library kit Illumina.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>200</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>101</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP003977	Illumina HiSeq 2500 paired end sequencing of SAMD00182215				5233184600.0	26165923.0	DRR189372	0:100 1:100	A:1522745973;C:1082449570;G:1076728796;T:1550682585;N:577676	100	100		1522745973	1082449570	1076728796	1550682585	577676	DRX179837	DRS200445	DRA008855	NIG\|National Institute of Genetics (Japan)	National Institute of Genetics (Japan)	2	0.89481	0.89419	0.27137	0.27018	0.67639	0.67671	0.54949	0.55323	100	100	B	B	biological fallback assumption	illumina	hiseq_era	full_length	cdna_unspecified	nextera	bulk	unknown	unknown	Japan	2021-08-08	Adult	Adult	Brain	Nervous System
133	133	DRR189371	DRX179836	DRS200444	DRP003977	PRJDB4470	Gene expression analysis of the zebrafish brain	DRP003977	Other	Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.				Dissociated cells from telencephalon of wild type adult zebrafish 1	SAMD00182214		sample name:Cell Tel 1\|genotype:wild type\|tissue:brain									Illumina HiSeq 2500 paired end sequencing of SAMD00182214	DRX179836	Cell Tel 1	1	The cDNA was amplified using SMARTer v4. Sequence libraries were produced from cDNA using Nextera XT DNA library kit Illumina.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>200</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>101</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP003977	Illumina HiSeq 2500 paired end sequencing of SAMD00182214				4407578800.0	22037894.0	DRR189371	0:100 1:100	A:1270948410;C:923917605;G:922122984;T:1290126238;N:463563	100	100		1270948410	923917605	922122984	1290126238	463563	DRX179836	DRS200444	DRA008855	NIG\|National Institute of Genetics (Japan)	National Institute of Genetics (Japan)	2	0.90057	0.90117	0.24092	0.24074	0.67598	0.67775	0.53184	0.53433	100	100	B	B	biological fallback assumption	illumina	hiseq_era	full_length	cdna_unspecified	nextera	bulk	unknown	unknown	Japan	2021-08-08	Adult	Adult	Brain	Nervous System
134	134	DRR189370	DRX179835	DRS200415	DRP003977	PRJDB4470	Gene expression analysis of the zebrafish brain	DRP003977	Other	Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.				GFP cells form telencephalon of h62A;UAS:GFP adult zebrafish 5	SAMD00182213		sample name:h62A GFP Tel 5\|genotype:hspGFF62A;UAS:GFP\|tissue:brain									Illumina HiSeq 2500 paired end sequencing of SAMD00182213	DRX179835	h62A GFP Tel 5	1	The cDNA was amplified using SMARTer v4. Sequence libraries were produced from cDNA using Nextera XT DNA library kit Illumina.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>200</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>101</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP003977	Illumina HiSeq 2500 paired end sequencing of SAMD00182213				2904332400.0	14521662.0	DRR189370	0:100 1:100	A:821602205;C:620206517;G:623738781;T:838474359;N:310538	100	100		821602205	620206517	623738781	838474359	310538	DRX179835	DRS200415	DRA008854	NIG\|National Institute of Genetics (Japan)	National Institute of Genetics (Japan)	2	0.91925	0.91942	0.14636	0.14584	0.71127	0.71429	0.62818	0.40804	100	100	B	B	biological fallback assumption	illumina	hiseq_era	full_length	cdna_unspecified	nextera	bulk	unknown	unknown	Japan	2021-08-08	Adult	Adult	Brain	Nervous System
135	135	DRR189369	DRX179834	DRS200414	DRP003977	PRJDB4470	Gene expression analysis of the zebrafish brain	DRP003977	Other	Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.				GFP cells form telencephalon of h62A;UAS:GFP adult zebrafish 4	SAMD00182212		sample name:h62A GFP Tel 4\|genotype:hspGFF62A;UAS:GFP\|tissue:brain									Illumina HiSeq 2500 paired end sequencing of SAMD00182212	DRX179834	h62A GFP Tel 4	1	The cDNA was amplified using SMARTer v4. Sequence libraries were produced from cDNA using Nextera XT DNA library kit Illumina.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>200</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>101</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP003977	Illumina HiSeq 2500 paired end sequencing of SAMD00182212				4670374000.0	23351870.0	DRR189369	0:100 1:100	A:1294304230;C:1030286884;G:1032728119;T:1312561064;N:493703	100	100		1294304230	1030286884	1032728119	1312561064	493703	DRX179834	DRS200414	DRA008854	NIG\|National Institute of Genetics (Japan)	National Institute of Genetics (Japan)	2	0.92587	0.92725	0.12279	0.12312	0.71056	0.71293	0.57854	0.57882	100	100	B	B	biological fallback assumption	illumina	hiseq_era	full_length	cdna_unspecified	nextera	bulk	unknown	unknown	Japan	2021-08-08	Adult	Adult	Brain	Nervous System
136	136	DRR189368	DRX179833	DRS200413	DRP003977	PRJDB4470	Gene expression analysis of the zebrafish brain	DRP003977	Other	Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.				GFP cells form telencephalon of h62A;UAS:GFP adult zebrafish 3	SAMD00182211		sample name:h62A GFP Tel 3\|genotype:hspGFF62A;UAS:GFP\|tissue:brain									Illumina HiSeq 2500 paired end sequencing of SAMD00182211	DRX179833	h62A GFP Tel 3	1	The cDNA was amplified using SMARTer v4. Sequence libraries were produced from cDNA using Nextera XT DNA library kit Illumina.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>200</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>101</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP003977	Illumina HiSeq 2500 paired end sequencing of SAMD00182211				11487645000.0	57438225.0	DRR189368	0:100 1:100	A:3127119396;C:2611288030;G:2547219656;T:3194997425;N:7020493	100	100		3127119396	2611288030	2547219656	3194997425	7020493	DRX179833	DRS200413	DRA008854	NIG\|National Institute of Genetics (Japan)	National Institute of Genetics (Japan)	2	0.91389	0.91371	0.11188	0.11336	0.74576	0.74639	0.56209	0.56027	100	100	B	B	biological fallback assumption	illumina	hiseq_era	full_length	cdna_unspecified	nextera	bulk	unknown	unknown	Japan	2021-08-08	Adult	Adult	Brain	Nervous System
137	137	DRR189367	DRX179832	DRS200412	DRP003977	PRJDB4470	Gene expression analysis of the zebrafish brain	DRP003977	Other	Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.				GFP cells form telencephalon of h62A;UAS:GFP adult zebrafish 2	SAMD00182210		sample name:h62A GFP Tel 2\|genotype:hspGFF62A;UAS:GFP\|tissue:brain									Illumina HiSeq 2500 paired end sequencing of SAMD00182210	DRX179832	h62A GFP Tel 2	1	The cDNA was amplified using SMARTer v4. Sequence libraries were produced from cDNA using Nextera XT DNA library kit Illumina.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>200</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>101</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP003977	Illumina HiSeq 2500 paired end sequencing of SAMD00182210				13536257200.0	67681286.0	DRR189367	0:100 1:100	A:3723068804;C:3049411151;G:2951685691;T:3803778575;N:8312979	100	100		3723068804	3049411151	2951685691	3803778575	8312979	DRX179832	DRS200412	DRA008854	NIG\|National Institute of Genetics (Japan)	National Institute of Genetics (Japan)	2	0.9136	0.91493	0.14102	0.14249	0.70534	0.70569	0.58385	0.58171	100	100	B	B	biological fallback assumption	illumina	hiseq_era	full_length	cdna_unspecified	nextera	bulk	unknown	unknown	Japan	2021-08-08	Adult	Adult	Brain	Nervous System
138	138	DRR189366	DRX179831	DRS200411	DRP003977	PRJDB4470	Gene expression analysis of the zebrafish brain	DRP003977	Other	Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.				GFP cells form telencephalon of h62A;UAS:GFP adult zebrafish 1	SAMD00182209		sample name:h62A GFP Tel 1\|genotype:hspGFF62A;UAS:GFP\|tissue:brain									Illumina HiSeq 2500 paired end sequencing of SAMD00182209	DRX179831	h62A GFP Tel 1	1	The cDNA was amplified using SMARTer v4. Sequence libraries were produced from cDNA using Nextera XT DNA library kit Illumina.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>200</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>101</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP003977	Illumina HiSeq 2500 paired end sequencing of SAMD00182209				13057029600.0	65285148.0	DRR189366	0:100 1:100	A:3609997372;C:2912841795;G:2821782510;T:3704302917;N:8105006	100	100		3609997372	2912841795	2821782510	3704302917	8105006	DRX179831	DRS200411	DRA008854	NIG\|National Institute of Genetics (Japan)	National Institute of Genetics (Japan)	2	0.90766	0.90786	0.13813	0.14007	0.73677	0.73777	0.55675	0.55743	100	100	B	B	biological fallback assumption	illumina	hiseq_era	full_length	cdna_unspecified	nextera	bulk	unknown	unknown	Japan	2021-08-08	Adult	Adult	Brain	Nervous System
139	139	DRR189365	DRX179830	DRS200432	DRP003977	PRJDB4470	Gene expression analysis of the zebrafish brain	DRP003977	Other	Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.				GFP cells form telencephalon of SAGFF120A;UAS:GFP adult zebrafish 4	SAMD00182208		sample name:120A GFP Tel 4\|genotype:SAGFF120A;UAS:GFP\|tissue:brain									Illumina HiSeq 2000 paired end sequencing of SAMD00182208	DRX179830	120A GFP Tel 4	1	The cDNA was amplified using SMARTer v4. Sequence libraries were produced from cDNA using Nextera XT DNA library kit Illumina.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2000	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>200</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>101</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP003977	Illumina HiSeq 2000 paired end sequencing of SAMD00182208				4105132200.0	20525661.0	DRR189365	0:100 1:100	A:1171500567;C:874901685;G:872257219;T:1186025546;N:447183	100	100		1171500567	874901685	872257219	1186025546	447183	DRX179830	DRS200432	DRA008853	NIG\|National Institute of Genetics (Japan)	National Institute of Genetics (Japan)	2	0.91106	0.90924	0.18729	0.18688	0.69406	0.69589	0.51697	0.51253	100	100	B	B	biological fallback assumption	illumina	hiseq_era	full_length	cdna_unspecified	nextera	bulk	unknown	unknown	Japan	2021-08-08	Adult	Adult	Brain	Nervous System
140	140	DRR189364	DRX179829	DRS200431	DRP003977	PRJDB4470	Gene expression analysis of the zebrafish brain	DRP003977	Other	Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.				GFP cells form telencephalon of SAGFF120A;UAS:GFP adult zebrafish 3	SAMD00182207		sample name:120A GFP Tel 3\|genotype:SAGFF120A;UAS:GFP\|tissue:brain									Illumina HiSeq 2500 paired end sequencing of SAMD00182207	DRX179829	120A GFP Tel 3	1	The cDNA was amplified using SMARTer v4. Sequence libraries were produced from cDNA using Nextera XT DNA library kit Illumina.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>200</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>101</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP003977	Illumina HiSeq 2500 paired end sequencing of SAMD00182207				5062007400.0	25310037.0	DRR189364	0:100 1:100	A:1425414609;C:1105334563;G:1072448536;T:1458726402;N:83290	100	100		1425414609	1105334563	1072448536	1458726402	83290	DRX179829	DRS200431	DRA008853	NIG\|National Institute of Genetics (Japan)	National Institute of Genetics (Japan)	2	0.89598	0.89539	0.2645	0.2668	0.69591	0.6971	0.49901	0.49932	100	100	B	B	biological fallback assumption	illumina	hiseq_era	full_length	cdna_unspecified	nextera	bulk	unknown	unknown	Japan	2021-08-08	Adult	Adult	Brain	Nervous System
141	141	DRR189363	DRX179828	DRS200430	DRP003977	PRJDB4470	Gene expression analysis of the zebrafish brain	DRP003977	Other	Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.				GFP cells form telencephalon of SAGFF120A;UAS:GFP adult zebrafish 2	SAMD00182206		sample name:120A GFP Tel 2\|genotype:SAGFF120A;UAS:GFP\|tissue:brain									Illumina HiSeq 2500 paired end sequencing of SAMD00182206	DRX179828	120A GFP Tel 2	1	The cDNA was amplified using SMARTer v4. Sequence libraries were produced from cDNA using Nextera XT DNA library kit Illumina.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>200</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>101</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP003977	Illumina HiSeq 2500 paired end sequencing of SAMD00182206				4148886200.0	20744431.0	DRR189363	0:100 1:100	A:1121946535;C:959659540;G:901840216;T:1165367793;N:72116	100	100		1121946535	959659540	901840216	1165367793	72116	DRX179828	DRS200430	DRA008853	NIG\|National Institute of Genetics (Japan)	National Institute of Genetics (Japan)	2	0.89808	0.89803	0.14106	0.14229	0.74057	0.74073	0.58127	0.58258	100	100	B	B	biological fallback assumption	illumina	hiseq_era	full_length	cdna_unspecified	nextera	bulk	unknown	unknown	Japan	2021-08-08	Adult	Adult	Brain	Nervous System
142	142	DRR189362	DRX179827	DRS200429	DRP003977	PRJDB4470	Gene expression analysis of the zebrafish brain	DRP003977	Other	Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.				GFP cells form telencephalon of SAGFF120A;UAS:GFP adult zebrafish 1	SAMD00182205		sample name:120A GFP Tel 1\|genotype:SAGFF120A;UAS:GFP\|tissue:brain									Illumina HiSeq 2500 paired end sequencing of SAMD00182205	DRX179827	120A GFP Tel 1	1	The cDNA was amplified using SMARTer v4. Sequence libraries were produced from cDNA using Nextera XT DNA library kit Illumina.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>200</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>101</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP003977	Illumina HiSeq 2500 paired end sequencing of SAMD00182205				5621230800.0	28106154.0	DRR189362	0:100 1:100	A:1511319423;C:1299516107;G:1236814355;T:1573482053;N:98862	100	100		1511319423	1299516107	1236814355	1573482053	98862	DRX179827	DRS200429	DRA008853	NIG\|National Institute of Genetics (Japan)	National Institute of Genetics (Japan)	2	0.90171	0.90205	0.11967	0.12059	0.74083	0.74113	0.61779	0.61682	100	100	B	B	biological fallback assumption	illumina	hiseq_era	full_length	cdna_unspecified	nextera	bulk	unknown	unknown	Japan	2021-08-08	Adult	Adult	Brain	Nervous System
143	143	DRR189361	DRX179826	DRS200425	DRP003977	PRJDB4470	Gene expression analysis of the zebrafish brain	DRP003977	Other	Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.				GFP cells form whole brain of HuC:GFP adult zebrafish 4	SAMD00182204		sample name:HuC GFP WB 4\|genotype:HuC:GFP\|tissue:brain									Illumina HiSeq 2500 paired end sequencing of SAMD00182204	DRX179826	HuC GFP WB 4	1	The cDNA was amplified using SMARTer v4. Sequence libraries were produced from cDNA using Nextera XT DNA library kit Illumina.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>200</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>101</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP003977	Illumina HiSeq 2500 paired end sequencing of SAMD00182204				3641515200.0	18207576.0	DRR189361	0:100 1:100	A:1038686472;C:777269450;G:777179582;T:1047994354;N:385342	100	100		1038686472	777269450	777179582	1047994354	385342	DRX179826	DRS200425	DRA008852	NIG\|National Institute of Genetics (Japan)	National Institute of Genetics (Japan)	2	0.91246	0.9127	0.18566	0.18547	0.70201	0.7024	0.47049	0.47102	100	100	B	B	biological fallback assumption	illumina	hiseq_era	full_length	cdna_unspecified	nextera	bulk	unknown	unknown	Japan	2021-08-08	Adult	Adult	Brain	Nervous System
144	144	DRR189360	DRX179825	DRS200424	DRP003977	PRJDB4470	Gene expression analysis of the zebrafish brain	DRP003977	Other	Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.				GFP cells form whole brain of HuC:GFP adult zebrafish 3	SAMD00182203		sample name:HuC GFP WB 3\|genotype:HuC:GFP\|tissue:brain									Illumina HiSeq 2500 paired end sequencing of SAMD00182203	DRX179825	HuC GFP WB 3	1	The cDNA was amplified using SMARTer v4. Sequence libraries were produced from cDNA using Nextera XT DNA library kit Illumina.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>200</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>101</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP003977	Illumina HiSeq 2500 paired end sequencing of SAMD00182203				4692211000.0	23461055.0	DRR189360	0:100 1:100	A:1310884816;C:1036187295;G:997846600;T:1347212024;N:80265	100	100		1310884816	1036187295	997846600	1347212024	80265	DRX179825	DRS200424	DRA008852	NIG\|National Institute of Genetics (Japan)	National Institute of Genetics (Japan)	2	0.89626	0.89739	0.18174	0.18338	0.72443	0.72588	0.4577	0.46684	100	100	B	B	biological fallback assumption	illumina	hiseq_era	full_length	cdna_unspecified	nextera	bulk	unknown	unknown	Japan	2021-08-08	Adult	Adult	Brain	Nervous System
145	145	DRR189359	DRX179824	DRS200423	DRP003977	PRJDB4470	Gene expression analysis of the zebrafish brain	DRP003977	Other	Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.				GFP cells form whole brain of HuC:GFP adult zebrafish 2	SAMD00182202		sample name:HuC GFP WB 2\|genotype:HuC:GFP\|tissue:brain									Illumina HiSeq 2500 paired end sequencing of SAMD00182202	DRX179824	HuC GFP WB 2	1	The cDNA was amplified using SMARTer v4. Sequence libraries were produced from cDNA using Nextera XT DNA library kit Illumina.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>200</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>101</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP003977	Illumina HiSeq 2500 paired end sequencing of SAMD00182202				7514071000.0	37570355.0	DRR189359	0:100 1:100	A:2098251885;C:1661407212;G:1597423444;T:2156861774;N:126685	100	100		2098251885	1661407212	1597423444	2156861774	126685	DRX179824	DRS200423	DRA008852	NIG\|National Institute of Genetics (Japan)	National Institute of Genetics (Japan)	2	0.89548	0.89691	0.26231	0.26473	0.70358	0.70471	0.4732	0.4753	100	100	B	B	biological fallback assumption	illumina	hiseq_era	full_length	cdna_unspecified	nextera	bulk	unknown	unknown	Japan	2021-08-08	Adult	Adult	Brain	Nervous System
146	146	DRR189358	DRX179823	DRS200422	DRP003977	PRJDB4470	Gene expression analysis of the zebrafish brain	DRP003977	Other	Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.				GFP cells form whole brain of HuC:GFP adult zebrafish 1	SAMD00182201		sample name:HuC GFP WB 1\|genotype:HuC:GFP\|tissue:brain									Illumina HiSeq 2500 paired end sequencing of SAMD00182201	DRX179823	HuC GFP WB 1	1	The cDNA was amplified using SMARTer v4. Sequence libraries were produced from cDNA using Nextera XT DNA library kit Illumina.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>200</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>101</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP003977	Illumina HiSeq 2500 paired end sequencing of SAMD00182201				5175824800.0	25879124.0	DRR189358	0:100 1:100	A:1424688686;C:1174545239;G:1128653980;T:1447848363;N:88532	100	100		1424688686	1174545239	1128653980	1447848363	88532	DRX179823	DRS200422	DRA008852	NIG\|National Institute of Genetics (Japan)	National Institute of Genetics (Japan)	2	0.91906	0.91958	0.20879	0.21088	0.74787	0.74876	0.45243	0.45221	100	100	B	B	biological fallback assumption	illumina	hiseq_era	full_length	cdna_unspecified	nextera	bulk	unknown	unknown	Japan	2021-08-08	Adult	Adult	Brain	Nervous System
147	147	DRR051067	DRX045959	DRS057267	DRP003977	PRJDB4470	Gene expression analysis of the zebrafish brain	DRP003977	Other	Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.			These cells are from the same fish as h62A GFP plus Tel	GFP cells from telencephalon of hspGFF62A;UAS:GFP transgenic zebrafish	SAMD00044994		sample name:h62A GFP minus Tel\|tissue type:brain\|genotype:hspGFF62A;UAS:GFP									Illumina HiSeq 2500 paired end sequencing of SAMD00044994	DRX045959	h62A GFP minus Tel	1	cDNA synthesis : clontech SMARTer v3 > Library prep : Illumina Nextera XT DNA Library Preparation Kits		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>200</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>101</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP003977	Illumina HiSeq 2500 paired end sequencing of SAMD00044994				17913873600.0	89569368.0	DRR051067	0:100 1:100	A:5009629866;C:3957379257;G:3797879751;T:5144366288;N:4618438	100	100		5009629866	3957379257	3797879751	5144366288	4618438	DRX045959	DRS057267	DRA004277	NIG\|National Institute of Genetics (Japan)	National Institute of Genetics (Japan)	2	0.89075	0.89087	0.23044	0.23295	0.69493	0.69769	0.5366	0.54852	100	100	B	B	biological fallback assumption	illumina	hiseq_era	full_length	cdna_unspecified	nextera	bulk	unknown	unknown	Japan	2018-01-06	Undetermined	Undetermined	Brain	Nervous System
148	148	DRR051066	DRX045958	DRS057275	DRP003977	PRJDB4470	Gene expression analysis of the zebrafish brain	DRP003977	Other	Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.			Collected from 40 adult fish by using FACS	GFP+ cells from telencephalon of hspGFF62A;UAS:GFP transgenic zebrafish	SAMD00044995		sample name:h62A GFP plus Tel\|tissue type:brain\|genotype:hspGFF62A;UAS:GFP									Illumina HiSeq 2500 paired end sequencing of SAMD00044995	DRX045958	h62A GFP plus Tel	1	cDNA synthesis : clontech SMARTer v3 > Library prep : Illumina Nextera XT DNA Library Preparation Kits		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>200</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>101</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP003977	Illumina HiSeq 2500 paired end sequencing of SAMD00044995				17421256000.0	87106280.0	DRR051066	0:100 1:100	A:4859368314;C:3846634012;G:3717526030;T:4993260256;N:4467388	100	100		4859368314	3846634012	3717526030	4993260256	4467388	DRX045958	DRS057275	DRA004276	NIG\|National Institute of Genetics (Japan)	National Institute of Genetics (Japan)	2	0.88127	0.88114	0.22941	0.23155	0.72161	0.72437	0.49284	0.49449	100	100	B	B	biological fallback assumption	illumina	hiseq_era	full_length	cdna_unspecified	nextera	bulk	unknown	unknown	Japan	2018-01-06	Adult	Adult	Brain	Nervous System
149	149	DRR051065	DRX045957	DRS057272	DRP003977	PRJDB4470	Gene expression analysis of the zebrafish brain	DRP003977	Other	Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.			Telencephalon from adult zebrafrish 30 min post light and electrical shock association in non trace Two Way Active Avoidance conditioning	CS+US telencephalon 30 min post TWAA	SAMD00044990		sample name:CS+US Tel 30\|tissue type:brain\|genotype:WT									Illumina HiSeq 2500 paired end sequencing of SAMD00044990	DRX045957	CS+US Tel 30	1	Illumina Truseq RNA Library Prep Kit v2		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>200</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>101</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP003977	Illumina HiSeq 2500 paired end sequencing of SAMD00044990				20239329200.0	101196646.0	DRR051065	0:100 1:100	A:5347169722;C:4777492672;G:4750401220;T:5361888239;N:2377347	100	100		5347169722	4777492672	4750401220	5361888239	2377347	DRX045957	DRS057272	DRA004275	NIG\|National Institute of Genetics (Japan)	National Institute of Genetics (Japan)	2	0.93576	0.93353	0.13979	0.14019	0.70043	0.70203	0.48989	0.49214	100	100	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	trueseq	bulk	unknown	unknown	Japan	2018-01-06	Adult	Adult	Brain	Nervous System
150	150	DRR051064	DRX045956	DRS057265	DRP003977	PRJDB4470	Gene expression analysis of the zebrafish brain	DRP003977	Other	Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.			Telencephalon from adult zebrafrish 30 min post light stimulation in Two Way Active Avoidance coditioning	CS telencephalon 30 min post TWAA	SAMD00044991		sample name:CS Tel 30\|tissue type:brain\|genotype:WT									Illumina HiSeq 2500 paired end sequencing of SAMD00044991	DRX045956	CS Tel 30	1	Illumina Truseq RNA Library Prep Kit v2		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>200</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>101</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP003977	Illumina HiSeq 2500 paired end sequencing of SAMD00044991				29268319600.0	146341598.0	DRR051064	0:100 1:100	A:7777792429;C:6878969107;G:6819275179;T:7788795270;N:3487615	100	100		7777792429	6878969107	6819275179	7788795270	3487615	DRX045956	DRS057265	DRA004274	NIG\|National Institute of Genetics (Japan)	National Institute of Genetics (Japan)	2	0.93646	0.93664	0.14051	0.14191	0.70199	0.70374	0.49256	0.49684	100	100	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	trueseq	bulk	unknown	unknown	Japan	2018-01-06	Adult	Adult	Brain	Nervous System
151	151	DRR051063	DRX045955	DRS057266	DRP003977	PRJDB4470	Gene expression analysis of the zebrafish brain	DRP003977	Other	Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.			These cells are from the same fish as 120A GFP plus Tel	GFP cells from telencephalon of SAGFFLF120A;UAS:GFP transgenic zebrafish	SAMD00044987		sample name:120A GFP minus Tel\|tissue type:brain\|genotype:SAGFFLF120A;UAS:GFP									Illumina HiSeq 2500 paired end sequencing of SAMD00044987	DRX045955	120A GFP minus Tel	1	cDNA synthesis : clontech SMARTer v2 > Library prep : Illumina TrunSeq DNA Sample Preparation Kits		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>202</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>102</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP003977	Illumina HiSeq 2500 paired end sequencing of SAMD00044987				15411400120.0	76294060.0	DRR051063	0:101 1:101	A:4583085286;C:3082552426;G:3134669086;T:4606055524;N:5037798	101	101		4583085286	3082552426	3134669086	4606055524	5037798	DRX045955	DRS057266	DRA004273	NIG\|National Institute of Genetics (Japan)	National Institute of Genetics (Japan)	2	0.89184	0.8842	0.30246	0.30334	0.69232	0.705	0.52824	0.51492	101	101	B	B	biological fallback assumption	illumina	hiseq_era	full_length	cdna_unspecified	smarter	bulk	unknown	unknown	Japan	2018-01-06	Undetermined	Undetermined	Brain	Nervous System
152	152	DRR051062	DRX045954	DRS057271	DRP003977	PRJDB4470	Gene expression analysis of the zebrafish brain	DRP003977	Other	Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.			Collected from 40 adult fish by using FACS	GFP+ cells from telencephalon of SAGFFLF120A;UAS:GFP transgenic zebrafish	SAMD00044988		sample name:120A GFP plus Tel\|tissue type:brain\|genotype:SAGFFLF120A;UAS:GFP									Illumina HiSeq 2500 paired end sequencing of SAMD00044988	DRX045954	120A GFP plus Tel	1	cDNA synthesis : clontech SMARTer v2 > Library prep : Illumina TrunSeq DNA Sample Preparation Kits		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>202</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>102</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP003977	Illumina HiSeq 2500 paired end sequencing of SAMD00044988				9916242014.0	49090307.0	DRR051062	0:101 1:101	A:2991626000;C:1935418605;G:1974202781;T:3011783158;N:3211470	101	101		2991626000	1935418605	1974202781	3011783158	3211470	DRX045954	DRS057271	DRA004272	NIG\|National Institute of Genetics (Japan)	National Institute of Genetics (Japan)	2	0.87779	0.86382	0.2948	0.28993	0.72809	0.74075	0.50317	0.49169	101	101	B	B	biological fallback assumption	illumina	hiseq_era	full_length	cdna_unspecified	smarter	bulk	unknown	unknown	Japan	2018-01-06	Adult	Adult	Brain	Nervous System
153	153	DRR051061	DRX045953	DRS057274	DRP003977	PRJDB4470	Gene expression analysis of the zebrafish brain	DRP003977	Other	Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.			Collected from 10 adult fish by using FACS	GFP+ cells from whole brain of SAGFFLF231A;UAS:GFP transgenic zebrafish	SAMD00044989		sample name:231A GFP plus WB\|tissue type:brain\|genotype:SAGFFLF231A;UAS:GFP									Illumina HiSeq 2500 paired end sequencing of SAMD00044989	DRX045953	231A GFP plus WB	1	cDNA synthesis : clontech SMARTer v2 > Library prep : Illumina TrunSeq DNA Sample Preparation Kits		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>202</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>102</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP003977	Illumina HiSeq 2500 paired end sequencing of SAMD00044989				27230654000.0	136153270.0	DRR051061	0:101 1:99	A:7929214734;C:5506861409;G:5563593280;T:8059057191;N:171927386	101	99		7929214734	5506861409	5563593280	8059057191	171927386	DRX045953	DRS057274	DRA004271	NIG\|National Institute of Genetics (Japan)	National Institute of Genetics (Japan)	2	0.88462	0.88282	0.26215	0.26067	0.72468	0.73555	0.48369	0.48285	101	99	B	B	biological fallback assumption	illumina	hiseq_era	full_length	cdna_unspecified	smarter	bulk	unknown	unknown	Japan	2018-01-06	Adult	Adult	Brain	Nervous System
154	154	DRR051060	DRX045952	DRS057269	DRP003977	PRJDB4470	Gene expression analysis of the zebrafish brain	DRP003977	Other	Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.			Telencephalon of adult zebrafrish barin	zebrafihsh telencephalon	SAMD00044992		sample name:Tel\|tissue type:brain\|genotype:WT									Illumina HiSeq 2500 paired end sequencing of SAMD00044992	DRX045952	Tel	1	Illumina Truseq RNA Library Prep Kit v2		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>202</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>102</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP003977	Illumina HiSeq 2500 paired end sequencing of SAMD00044992				20006128076.0	99040238.0	DRR051060	0:101 1:101	A:5393556813;C:4623783008;G:4592812230;T:5384415659;N:11560366	101	101		5393556813	4623783008	4592812230	5384415659	11560366	DRX045952	DRS057269	DRA004270	NIG\|National Institute of Genetics (Japan)	National Institute of Genetics (Japan)	2	0.94215	0.94001	0.16398	0.16585	0.69331	0.69479	0.4872	0.48516	101	101	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	trueseq	bulk	unknown	unknown	Japan	2018-01-06	Adult	Adult	Brain	Nervous System
155	155	DRR051059	DRX045951	DRS057270	DRP003977	PRJDB4470	Gene expression analysis of the zebrafish brain	DRP003977	Other	Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.			Whole brain of adult zebrafish	zebrafish whole brain	SAMD00044993		sample name:WB\|tissue type:brain\|genotype:WT									Illumina HiSeq 2500 paired end sequencing of SAMD00044993	DRX045951	WB	1	Illumina Truseq RNA Library Prep Kit v2		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>202</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>102</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP003977	Illumina HiSeq 2500 paired end sequencing of SAMD00044993				25283347776.0	125165088.0	DRR051059	0:101 1:101	A:6845696813;C:5810492697;G:5775241119;T:6837142940;N:14774207	101	101		6845696813	5810492697	5775241119	6837142940	14774207	DRX045951	DRS057270	DRA004269	NIG\|National Institute of Genetics (Japan)	National Institute of Genetics (Japan)	2	0.94203	0.94067	0.15107	0.15158	0.68651	0.6882	0.49596	0.49589	101	101	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	trueseq	bulk	unknown	unknown	Japan	2018-01-06	Adult	Adult	Brain	Nervous System
156	156	DRR067143	DRX061087	DRS034141	DRP003275	PRJDB4941	Gene expression profiling of granule cells and Purkinje cells in zebrafish cerebellum	DRP003275	Other	An RNA seq analysis was performed using zebrafish granule cells Purkinje cells IO neurons and glial cells. The transcriptomes were sequenced using Illumina HiSeq with paired end libraries employing the Quartz seq method for low amount total RNA.				Zebrafish RNA seq for Bergmann glial cells using Tg line SAGFFLF251A sample 2	SAMD00057666		sample name:Zebrafish 251A 02\|strain:Tg\|biomaterial provider:Bioscience and Biotechnology Center Nagoya University\|tissue type:cerebellum\|cell type:bergmann glial cells\|dev stage:14 dpf\|replicate:biological replicate 2									Illumina HiSeq 1500 paired end sequencing of SAMD00057666	DRX061087	1	1	Quartz seq for low amount total RNA		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 1500	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>202</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>102</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP003275	Illumina HiSeq 1500 paired end sequencing of SAMD00057666				2040373922.0	10100861.0	DRR067143	0:101 1:101	A:577691972;C:445051245;G:472607289;T:544962357;N:61059	101	101		577691972	445051245	472607289	544962357	61059	DRX061087	DRS034141	DRA004955	RIKEN_CLST_DBFDI\|Phyloinformatics Unit	RIKEN CLST	2	0.83407	0.83802	0.12612	0.12666	0.73675	0.74079	0.4948	0.49282	101	101	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	quartzseq	Japan	2016-09-19	Larval	Larval	Brain	Nervous System
157	157	DRR067142	DRX061086	DRS034140	DRP003275	PRJDB4941	Gene expression profiling of granule cells and Purkinje cells in zebrafish cerebellum	DRP003275	Other	An RNA seq analysis was performed using zebrafish granule cells Purkinje cells IO neurons and glial cells. The transcriptomes were sequenced using Illumina HiSeq with paired end libraries employing the Quartz seq method for low amount total RNA.				Zebrafish RNA seq for Bergmann glial cells using Tg line SAGFFLF251A sample 1	SAMD00057665		sample name:Zebrafish 251A 01\|strain:Tg\|biomaterial provider:Bioscience and Biotechnology Center Nagoya University\|tissue type:cerebellum\|cell type:bergmann glial cells\|dev stage:14 dpf\|replicate:biological replicate 1									Illumina HiSeq 1500 paired end sequencing of SAMD00057665	DRX061086	1	1	Quartz seq for low amount total RNA		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 1500	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>202</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>102</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP003275	Illumina HiSeq 1500 paired end sequencing of SAMD00057665				2033951534.0	10069067.0	DRR067142	0:101 1:101	A:589558269;C:431084184;G:460501802;T:552746498;N:60781	101	101		589558269	431084184	460501802	552746498	60781	DRX061086	DRS034140	DRA004955	RIKEN_CLST_DBFDI\|Phyloinformatics Unit	RIKEN CLST	2	0.8958	0.90339	0.13764	0.1385	0.72563	0.72865	0.49373	0.49916	101	101	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	quartzseq	Japan	2016-09-19	Larval	Larval	Brain	Nervous System
158	158	DRR067141	DRX061085	DRS034139	DRP003275	PRJDB4941	Gene expression profiling of granule cells and Purkinje cells in zebrafish cerebellum	DRP003275	Other	An RNA seq analysis was performed using zebrafish granule cells Purkinje cells IO neurons and glial cells. The transcriptomes were sequenced using Illumina HiSeq with paired end libraries employing the Quartz seq method for low amount total RNA.				Zebrafish RNA seq for Purkinje cells using Tg line aldoca:GAP Venus sample 3	SAMD00057664		sample name:Zebrafish aldoca 03\|strain:Tg\|biomaterial provider:Bioscience and Biotechnology Center Nagoya University\|tissue type:cerebellum\|cell type:purkinje cells\|dev stage:14 dpf\|replicate:biological replicate 3									Illumina HiSeq 1500 paired end sequencing of SAMD00057664	DRX061085	1	1	Quartz seq for low amount total RNA		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 1500	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>202</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>102</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP003275	Illumina HiSeq 1500 paired end sequencing of SAMD00057664				1931908608.0	9563904.0	DRR067141	0:101 1:101	A:558444394;C:409856521;G:429168864;T:534380258;N:58571	101	101		558444394	409856521	429168864	534380258	58571	DRX061085	DRS034139	DRA004955	RIKEN_CLST_DBFDI\|Phyloinformatics Unit	RIKEN CLST	2	0.88632	0.89109	0.15695	0.15773	0.75694	0.7599	0.46875	0.49236	101	101	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	quartzseq	Japan	2016-09-19	Larval	Larval	Brain	Nervous System
159	159	DRR067140	DRX061084	DRS034138	DRP003275	PRJDB4941	Gene expression profiling of granule cells and Purkinje cells in zebrafish cerebellum	DRP003275	Other	An RNA seq analysis was performed using zebrafish granule cells Purkinje cells IO neurons and glial cells. The transcriptomes were sequenced using Illumina HiSeq with paired end libraries employing the Quartz seq method for low amount total RNA.				Zebrafish RNA seq for Purkinje cells using Tg line aldoca:GAP Venus sample 2	SAMD00057663		sample name:Zebrafish aldoca 02\|strain:Tg\|biomaterial provider:Bioscience and Biotechnology Center Nagoya University\|tissue type:cerebellum\|cell type:purkinje cells\|dev stage:14 dpf\|replicate:biological replicate 2									Illumina HiSeq 1500 paired end sequencing of SAMD00057663	DRX061084	1	1	Quartz seq for low amount total RNA		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 1500	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>202</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>102</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP003275	Illumina HiSeq 1500 paired end sequencing of SAMD00057663				1851108406.0	9163903.0	DRR067140	0:101 1:101	A:537339104;C:390802782;G:416335529;T:506575762;N:55229	101	101		537339104	390802782	416335529	506575762	55229	DRX061084	DRS034138	DRA004955	RIKEN_CLST_DBFDI\|Phyloinformatics Unit	RIKEN CLST	2	0.9055	0.91341	0.1515	0.15333	0.76495	0.76719	0.49219	0.49012	101	101	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	quartzseq	Japan	2016-09-19	Larval	Larval	Brain	Nervous System
160	160	DRR067139	DRX061083	DRS034137	DRP003275	PRJDB4941	Gene expression profiling of granule cells and Purkinje cells in zebrafish cerebellum	DRP003275	Other	An RNA seq analysis was performed using zebrafish granule cells Purkinje cells IO neurons and glial cells. The transcriptomes were sequenced using Illumina HiSeq with paired end libraries employing the Quartz seq method for low amount total RNA.				Zebrafish RNA seq for Purkinje cells using Tg line aldoca:GAP Venus sample 1	SAMD00057662		sample name:Zebrafish aldoca 01\|strain:Tg\|biomaterial provider:Bioscience and Biotechnology Center Nagoya University\|tissue type:cerebellum\|cell type:purkinje cells\|dev stage:14 dpf\|replicate:biological replicate 1									Illumina HiSeq 1500 paired end sequencing of SAMD00057662	DRX061083	1	1	Quartz seq for low amount total RNA		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 1500	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>202</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>102</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP003275	Illumina HiSeq 1500 paired end sequencing of SAMD00057662				2000078962.0	9901381.0	DRR067139	0:101 1:101	A:583169141;C:420603631;G:446949308;T:549297272;N:59610	101	101		583169141	420603631	446949308	549297272	59610	DRX061083	DRS034137	DRA004955	RIKEN_CLST_DBFDI\|Phyloinformatics Unit	RIKEN CLST	2	0.9056	0.90932	0.15092	0.15179	0.76173	0.7654	0.49028	0.49604	101	101	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	quartzseq	Japan	2016-09-19	Larval	Larval	Brain	Nervous System
161	161	DRR067138	DRX061082	DRS034136	DRP003275	PRJDB4941	Gene expression profiling of granule cells and Purkinje cells in zebrafish cerebellum	DRP003275	Other	An RNA seq analysis was performed using zebrafish granule cells Purkinje cells IO neurons and glial cells. The transcriptomes were sequenced using Illumina HiSeq with paired end libraries employing the Quartz seq method for low amount total RNA.				Zebrafish RNA seq for granule cells using Tg line gSA2AzGFF152B sample 2	SAMD00057661		sample name:Zebrafish 152B 02\|strain:Tg\|biomaterial provider:Bioscience and Biotechnology Center Nagoya University\|tissue type:cerebellum\|cell type:granule cells\|dev stage:14 dpf\|replicate:biological replicate 2									Illumina HiSeq 1500 paired end sequencing of SAMD00057661	DRX061082	1	1	Quartz seq for low amount total RNA		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 1500	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>202</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>102</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP003275	Illumina HiSeq 1500 paired end sequencing of SAMD00057661				1997432156.0	9888278.0	DRR067138	0:101 1:101	A:578466824;C:423038930;G:449779231;T:546086391;N:60780	101	101		578466824	423038930	449779231	546086391	60780	DRX061082	DRS034136	DRA004955	RIKEN_CLST_DBFDI\|Phyloinformatics Unit	RIKEN CLST	2	0.90322	0.91109	0.1463	0.14811	0.75452	0.75633	0.48303	0.48557	101	101	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	quartzseq	Japan	2016-09-19	Larval	Larval	Brain	Nervous System
162	162	DRR067137	DRX061081	DRS034135	DRP003275	PRJDB4941	Gene expression profiling of granule cells and Purkinje cells in zebrafish cerebellum	DRP003275	Other	An RNA seq analysis was performed using zebrafish granule cells Purkinje cells IO neurons and glial cells. The transcriptomes were sequenced using Illumina HiSeq with paired end libraries employing the Quartz seq method for low amount total RNA.				Zebrafish RNA seq for granule cells using Tg line gSA2AzGFF152B sample 1	SAMD00057660		sample name:Zebrafish 152B 01\|strain:Tg\|biomaterial provider:Bioscience and Biotechnology Center Nagoya University\|tissue type:cerebellum\|cell type:granule cells\|dev stage:14 dpf\|replicate:biological replicate 1									Illumina HiSeq 1500 paired end sequencing of SAMD00057660	DRX061081	1	1	Quartz seq for low amount total RNA		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 1500	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>202</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>102</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP003275	Illumina HiSeq 1500 paired end sequencing of SAMD00057660				1908437218.0	9447709.0	DRR067137	0:101 1:101	A:552150223;C:401993096;G:427236477;T:527000978;N:56444	101	101		552150223	401993096	427236477	527000978	56444	DRX061081	DRS034135	DRA004955	RIKEN_CLST_DBFDI\|Phyloinformatics Unit	RIKEN CLST	2	0.90474	0.91043	0.17336	0.17401	0.76108	0.76359	0.483	0.48537	101	101	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	quartzseq	Japan	2016-09-19	Larval	Larval	Brain	Nervous System
163	163	DRR067136	DRX061080	DRS034134	DRP003275	PRJDB4941	Gene expression profiling of granule cells and Purkinje cells in zebrafish cerebellum	DRP003275	Other	An RNA seq analysis was performed using zebrafish granule cells Purkinje cells IO neurons and glial cells. The transcriptomes were sequenced using Illumina HiSeq with paired end libraries employing the Quartz seq method for low amount total RNA.				Zebrafish RNA seq for Inferior olive nuclei using Tg line hspGFFDMC28C sample 3	SAMD00057659		sample name:Zebrafish 28C 03\|strain:Tg\|biomaterial provider:Bioscience and Biotechnology Center Nagoya University\|tissue type:hindbrain\|cell type:inferior olive nuclei\|dev stage:14 dpf\|replicate:biological replicate 3									Illumina HiSeq 1500 paired end sequencing of SAMD00057659	DRX061080	1	1	Quartz seq for low amount total RNA		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 1500	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>202</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>102</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP003275	Illumina HiSeq 1500 paired end sequencing of SAMD00057659				1982971178.0	9816689.0	DRR067136	0:101 1:101	A:504064758;C:488246993;G:520130333;T:470469799;N:59295	101	101		504064758	488246993	520130333	470469799	59295	DRX061080	DRS034134	DRA004955	RIKEN_CLST_DBFDI\|Phyloinformatics Unit	RIKEN CLST	2	0.53386	0.54375	0.06072	0.06189	0.76351	0.76641	0.4872	0.48857	101	101	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	quartzseq	Japan	2016-09-19	Larval	Larval	Brain	Nervous System
164	164	DRR067135	DRX061079	DRS034133	DRP003275	PRJDB4941	Gene expression profiling of granule cells and Purkinje cells in zebrafish cerebellum	DRP003275	Other	An RNA seq analysis was performed using zebrafish granule cells Purkinje cells IO neurons and glial cells. The transcriptomes were sequenced using Illumina HiSeq with paired end libraries employing the Quartz seq method for low amount total RNA.				Zebrafish RNA seq for Inferior olive nuclei using Tg line hspGFFDMC28C sample 2	SAMD00057658		sample name:Zebrafish 28C 02\|strain:Tg\|biomaterial provider:Bioscience and Biotechnology Center Nagoya University\|tissue type:hindbrain\|cell type:inferior olive nuclei\|dev stage:14 dpf\|replicate:biological replicate 2									Illumina HiSeq 1500 paired end sequencing of SAMD00057658	DRX061079	1	1	Quartz seq for low amount total RNA		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 1500	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>202</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>102</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP003275	Illumina HiSeq 1500 paired end sequencing of SAMD00057658				1961048320.0	9708160.0	DRR067135	0:101 1:101	A:557469151;C:424691789;G:455244994;T:523583601;N:58785	101	101		557469151	424691789	455244994	523583601	58785	DRX061079	DRS034133	DRA004955	RIKEN_CLST_DBFDI\|Phyloinformatics Unit	RIKEN CLST	2	0.84854	0.8526	0.10311	0.1042	0.75227	0.75499	0.49321	0.49435	101	101	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	quartzseq	Japan	2016-09-19	Larval	Larval	Brain	Nervous System
165	165	DRR067134	DRX061078	DRS034132	DRP003275	PRJDB4941	Gene expression profiling of granule cells and Purkinje cells in zebrafish cerebellum	DRP003275	Other	An RNA seq analysis was performed using zebrafish granule cells Purkinje cells IO neurons and glial cells. The transcriptomes were sequenced using Illumina HiSeq with paired end libraries employing the Quartz seq method for low amount total RNA.				Zebrafish RNA seq for Inferior olive nuclei using Tg line hspGFFDMC28C sample 1	SAMD00057657		sample name:Zebrafish 28C 01\|strain:Tg\|biomaterial provider:Bioscience and Biotechnology Center Nagoya University\|tissue type:hindbrain\|cell type:inferior olive nuclei\|dev stage:14 dpf\|replicate:biological replicate 1									Illumina HiSeq 1500 paired end sequencing of SAMD00057657	DRX061078	1	1	Quartz seq for low amount total RNA		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 1500	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>202</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>102</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP003275	Illumina HiSeq 1500 paired end sequencing of SAMD00057657				1931802760.0	9563380.0	DRR067134	0:101 1:101	A:546501397;C:422500710;G:452200521;T:510543489;N:56643	101	101		546501397	422500710	452200521	510543489	56643	DRX061078	DRS034132	DRA004955	RIKEN_CLST_DBFDI\|Phyloinformatics Unit	RIKEN CLST	2	0.85439	0.85613	0.09867	0.09897	0.76871	0.77082	0.48943	0.48936	101	101	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	quartzseq	Japan	2016-09-19	Larval	Larval	Brain	Nervous System
166	166	DRR067133	DRX061077	DRS034131	DRP003275	PRJDB4941	Gene expression profiling of granule cells and Purkinje cells in zebrafish cerebellum	DRP003275	Other	An RNA seq analysis was performed using zebrafish granule cells Purkinje cells IO neurons and glial cells. The transcriptomes were sequenced using Illumina HiSeq with paired end libraries employing the Quartz seq method for low amount total RNA.				Zebrafish RNA seq for eurydendroid cells using Tg line hspzGFFgDMC156A sample 2	SAMD00057656		sample name:Zebrafish 156A 02\|strain:Tg\|biomaterial provider:Bioscience and Biotechnology Center Nagoya University\|tissue type:cerebellum\|cell type:eurydendroid cells\|dev stage:14 dpf\|replicate:biological replicate 2									Illumina HiSeq 1500 paired end sequencing of SAMD00057656	DRX061077	1	1	Quartz seq for low amount total RNA		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 1500	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>202</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>102</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP003275	Illumina HiSeq 1500 paired end sequencing of SAMD00057656				2054289096.0	10169748.0	DRR067133	0:101 1:101	A:563764176;C:464768863;G:497506420;T:528187503;N:62134	101	101		563764176	464768863	497506420	528187503	62134	DRX061077	DRS034131	DRA004955	RIKEN_CLST_DBFDI\|Phyloinformatics Unit	RIKEN CLST	2	0.69311	0.6968	0.12309	0.12389	0.76428	0.76676	0.48379	0.48227	101	101	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	quartzseq	Japan	2016-09-19	Larval	Larval	Brain	Nervous System
167	167	DRR067132	DRX061076	DRS034130	DRP003275	PRJDB4941	Gene expression profiling of granule cells and Purkinje cells in zebrafish cerebellum	DRP003275	Other	An RNA seq analysis was performed using zebrafish granule cells Purkinje cells IO neurons and glial cells. The transcriptomes were sequenced using Illumina HiSeq with paired end libraries employing the Quartz seq method for low amount total RNA.				Zebrafish RNA seq for eurydendroid cells using Tg line hspzGFFgDMC156A sample 1	SAMD00057655		sample name:Zebrafish 156A 01\|strain:Tg\|biomaterial provider:Bioscience and Biotechnology Center Nagoya University\|tissue type:cerebellum\|cell type:eurydendroid cells\|dev stage:14 dpf\|replicate:biological replicate 1									Illumina HiSeq 1500 paired end sequencing of SAMD00057655	DRX061076	1	1	Quartz seq for low amount total RNA		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 1500	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>202</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>102</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP003275	Illumina HiSeq 1500 paired end sequencing of SAMD00057655				2152665722.0	10656761.0	DRR067132	0:101 1:101	A:585252781;C:495382257;G:522677749;T:549287359;N:65576	101	101		585252781	495382257	522677749	549287359	65576	DRX061076	DRS034130	DRA004955	RIKEN_CLST_DBFDI\|Phyloinformatics Unit	RIKEN CLST	2	0.67771	0.68253	0.12949	0.1303	0.77216	0.77542	0.4951	0.49452	101	101	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	quartzseq	Japan	2016-09-19	Larval	Larval	Brain	Nervous System
260	260	DRR162481	DRX153100	DRS083161	DRP004696	PRJDB7713	Age associated transcriptome analysis in 5 tissues of zebrafish	DRP004696	Transcriptome Analysis	We performed transcriptome analysis for brain gill heart liver and muscle from 2 month 7 month 16 month and 39 mpf zebrafish. We analyzed age associated gene expression pattern in zebrafish and compared with similar public transcriptome data of rat Yu et al. 2014.				brain sample from 39 mpf zebrafish replicate5	SAMD00152429		sample name:b39 5\|age:39 month\|biological replicate:5\|tissue:brain									Illumina HiSeq 2000 paired end sequencing of SAMD00152429	DRX153100	1	1	Illumina TruSeq Stranded mRNA HT Kit		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2000	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>200</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>101</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP004696	Illumina HiSeq 2000 paired end sequencing of SAMD00152429				1252728200.0	6263641.0	DRR162481	0:100 1:100	A:367502128;C:257734618;G:257260262;T:368202459;N:2028733	100	100		367502128	257734618	257260262	368202459	2028733	DRX153100	DRS083161	DRA007711	UT-AQUA\|Laboratory of Aquatic Molecular Biology and Biotechnology	Department of Aquatic Bioscience, Graduate School of Agriculture and Life Sciences, The University of Tokyo	2	0.92142	0.8899	0.17636	0.1685	0.70686	0.7166	0.53271	0.54366	100	100	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	trueseq	bulk	unknown	unknown	Japan	2018-12-24	Adult	Adult	Brain	Nervous System
261	261	DRR162480	DRX153099	DRS083160	DRP004696	PRJDB7713	Age associated transcriptome analysis in 5 tissues of zebrafish	DRP004696	Transcriptome Analysis	We performed transcriptome analysis for brain gill heart liver and muscle from 2 month 7 month 16 month and 39 mpf zebrafish. We analyzed age associated gene expression pattern in zebrafish and compared with similar public transcriptome data of rat Yu et al. 2014.				brain sample from 39 mpf zebrafish replicate4	SAMD00152428		sample name:b39 4\|age:39 month\|biological replicate:4\|tissue:brain									Illumina HiSeq 2000 paired end sequencing of SAMD00152428	DRX153099	1	1	Illumina TruSeq Stranded mRNA HT Kit		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2000	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>200</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>101</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP004696	Illumina HiSeq 2000 paired end sequencing of SAMD00152428				1426772800.0	7133864.0	DRR162480	0:100 1:100	A:408404333;C:303657580;G:303201065;T:408996815;N:2513007	100	100		408404333	303657580	303201065	408996815	2513007	DRX153099	DRS083160	DRA007711	UT-AQUA\|Laboratory of Aquatic Molecular Biology and Biotechnology	Department of Aquatic Bioscience, Graduate School of Agriculture and Life Sciences, The University of Tokyo	2	0.92435	0.89379	0.16127	0.15446	0.69844	0.70554	0.53646	0.533	100	100	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	trueseq	bulk	unknown	unknown	Japan	2018-12-24	Adult	Adult	Brain	Nervous System
262	262	DRR162479	DRX153098	DRS083159	DRP004696	PRJDB7713	Age associated transcriptome analysis in 5 tissues of zebrafish	DRP004696	Transcriptome Analysis	We performed transcriptome analysis for brain gill heart liver and muscle from 2 month 7 month 16 month and 39 mpf zebrafish. We analyzed age associated gene expression pattern in zebrafish and compared with similar public transcriptome data of rat Yu et al. 2014.				brain sample from 39 mpf zebrafish replicate3	SAMD00152427		sample name:b39 3\|age:39 month\|biological replicate:3\|tissue:brain									Illumina HiSeq 2000 paired end sequencing of SAMD00152427	DRX153098	1	1	Illumina TruSeq Stranded mRNA HT Kit		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2000	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>200</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>101</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP004696	Illumina HiSeq 2000 paired end sequencing of SAMD00152427				1197809800.0	5989049.0	DRR162479	0:100 1:100	A:348955835;C:249141949;G:248747996;T:348970452;N:1993568	100	100		348955835	249141949	248747996	348970452	1993568	DRX153098	DRS083159	DRA007711	UT-AQUA\|Laboratory of Aquatic Molecular Biology and Biotechnology	Department of Aquatic Bioscience, Graduate School of Agriculture and Life Sciences, The University of Tokyo	2	0.92402	0.89389	0.1731	0.1668	0.70938	0.72892	0.55061	0.56711	100	100	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	trueseq	bulk	unknown	unknown	Japan	2018-12-24	Adult	Adult	Brain	Nervous System
263	263	DRR162478	DRX153097	DRS083158	DRP004696	PRJDB7713	Age associated transcriptome analysis in 5 tissues of zebrafish	DRP004696	Transcriptome Analysis	We performed transcriptome analysis for brain gill heart liver and muscle from 2 month 7 month 16 month and 39 mpf zebrafish. We analyzed age associated gene expression pattern in zebrafish and compared with similar public transcriptome data of rat Yu et al. 2014.				brain sample from 39 mpf zebrafish replicate2	SAMD00152426		sample name:b39 2\|age:39 month\|biological replicate:2\|tissue:brain									Illumina HiSeq 2000 paired end sequencing of SAMD00152426	DRX153097	1	1	Illumina TruSeq Stranded mRNA HT Kit		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2000	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>200</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>101</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP004696	Illumina HiSeq 2000 paired end sequencing of SAMD00152426				1389632200.0	6948161.0	DRR162478	0:100 1:100	A:397337261;C:295934915;G:295794427;T:398240347;N:2325250	100	100		397337261	295934915	295794427	398240347	2325250	DRX153097	DRS083158	DRA007711	UT-AQUA\|Laboratory of Aquatic Molecular Biology and Biotechnology	Department of Aquatic Bioscience, Graduate School of Agriculture and Life Sciences, The University of Tokyo	2	0.92803	0.89621	0.15624	0.14998	0.69988	0.70985	0.54263	0.53655	100	100	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	trueseq	bulk	unknown	unknown	Japan	2018-12-24	Adult	Adult	Brain	Nervous System
264	264	DRR162477	DRX153096	DRS083157	DRP004696	PRJDB7713	Age associated transcriptome analysis in 5 tissues of zebrafish	DRP004696	Transcriptome Analysis	We performed transcriptome analysis for brain gill heart liver and muscle from 2 month 7 month 16 month and 39 mpf zebrafish. We analyzed age associated gene expression pattern in zebrafish and compared with similar public transcriptome data of rat Yu et al. 2014.				brain sample from 39 mpf zebrafish replicate1	SAMD00152425		sample name:b39 1\|age:39 month\|biological replicate:1\|tissue:brain									Illumina HiSeq 2000 paired end sequencing of SAMD00152425	DRX153096	1	1	Illumina TruSeq Stranded mRNA HT Kit		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2000	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>200</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>101</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP004696	Illumina HiSeq 2000 paired end sequencing of SAMD00152425				1413538400.0	7067692.0	DRR162477	0:100 1:100	A:427890787;C:277522619;G:278488081;T:427755965;N:1880948	100	100		427890787	277522619	278488081	427755965	1880948	DRX153096	DRS083157	DRA007711	UT-AQUA\|Laboratory of Aquatic Molecular Biology and Biotechnology	Department of Aquatic Bioscience, Graduate School of Agriculture and Life Sciences, The University of Tokyo	2	0.90967	0.88004	0.20536	0.19647	0.71384	0.72021	0.55413	0.55769	100	100	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	trueseq	bulk	unknown	unknown	Japan	2018-12-24	Adult	Adult	Brain	Nervous System
265	265	DRR162476	DRX153095	DRS083156	DRP004696	PRJDB7713	Age associated transcriptome analysis in 5 tissues of zebrafish	DRP004696	Transcriptome Analysis	We performed transcriptome analysis for brain gill heart liver and muscle from 2 month 7 month 16 month and 39 mpf zebrafish. We analyzed age associated gene expression pattern in zebrafish and compared with similar public transcriptome data of rat Yu et al. 2014.				brain sample from 16 mpf zebrafish replicate5	SAMD00152424		sample name:b16 5\|age:16 month\|biological replicate:5\|tissue:brain									Illumina HiSeq 2000 paired end sequencing of SAMD00152424	DRX153095	1	1	Illumina TruSeq Stranded mRNA HT Kit		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2000	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>200</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>101</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP004696	Illumina HiSeq 2000 paired end sequencing of SAMD00152424				1256635000.0	6283175.0	DRR162476	0:100 1:100	A:385448452;C:241878013;G:242164401;T:385408510;N:1735624	100	100		385448452	241878013	242164401	385408510	1735624	DRX153095	DRS083156	DRA007711	UT-AQUA\|Laboratory of Aquatic Molecular Biology and Biotechnology	Department of Aquatic Bioscience, Graduate School of Agriculture and Life Sciences, The University of Tokyo	2	0.91032	0.87693	0.19953	0.19064	0.72575	0.73474	0.49199	0.5657	100	100	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	trueseq	bulk	unknown	unknown	Japan	2018-12-24	Adult	Adult	Brain	Nervous System
266	266	DRR162475	DRX153094	DRS083155	DRP004696	PRJDB7713	Age associated transcriptome analysis in 5 tissues of zebrafish	DRP004696	Transcriptome Analysis	We performed transcriptome analysis for brain gill heart liver and muscle from 2 month 7 month 16 month and 39 mpf zebrafish. We analyzed age associated gene expression pattern in zebrafish and compared with similar public transcriptome data of rat Yu et al. 2014.				brain sample from 16 mpf zebrafish replicate4	SAMD00152423		sample name:b16 4\|age:16 month\|biological replicate:4\|tissue:brain									Illumina HiSeq 2000 paired end sequencing of SAMD00152423	DRX153094	1	1	Illumina TruSeq Stranded mRNA HT Kit		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2000	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>200</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>101</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP004696	Illumina HiSeq 2000 paired end sequencing of SAMD00152423				2577820600.0	12889103.0	DRR162475	0:100 1:100	A:783031561;C:503484597;G:503899732;T:784003178;N:3401532	100	100		783031561	503484597	503899732	784003178	3401532	DRX153094	DRS083155	DRA007711	UT-AQUA\|Laboratory of Aquatic Molecular Biology and Biotechnology	Department of Aquatic Bioscience, Graduate School of Agriculture and Life Sciences, The University of Tokyo	2	0.91098	0.87948	0.20945	0.19993	0.71758	0.72543	0.56796	0.56453	100	100	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	trueseq	bulk	unknown	unknown	Japan	2018-12-24	Adult	Adult	Brain	Nervous System
267	267	DRR162474	DRX153093	DRS083154	DRP004696	PRJDB7713	Age associated transcriptome analysis in 5 tissues of zebrafish	DRP004696	Transcriptome Analysis	We performed transcriptome analysis for brain gill heart liver and muscle from 2 month 7 month 16 month and 39 mpf zebrafish. We analyzed age associated gene expression pattern in zebrafish and compared with similar public transcriptome data of rat Yu et al. 2014.				brain sample from 16 mpf zebrafish replicate3	SAMD00152422		sample name:b16 3\|age:16 month\|biological replicate:3\|tissue:brain									Illumina HiSeq 2000 paired end sequencing of SAMD00152422	DRX153093	1	1	Illumina TruSeq Stranded mRNA HT Kit		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2000	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>200</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>101</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP004696	Illumina HiSeq 2000 paired end sequencing of SAMD00152422				1147257600.0	5736288.0	DRR162474	0:100 1:100	A:357829214;C:214920802;G:215124134;T:357870811;N:1512639	100	100		357829214	214920802	215124134	357870811	1512639	DRX153093	DRS083154	DRA007711	UT-AQUA\|Laboratory of Aquatic Molecular Biology and Biotechnology	Department of Aquatic Bioscience, Graduate School of Agriculture and Life Sciences, The University of Tokyo	2	0.90822	0.88184	0.20468	0.19612	0.73992	0.74627	0.58395	0.50711	100	100	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	trueseq	bulk	unknown	unknown	Japan	2018-12-24	Adult	Adult	Brain	Nervous System
268	268	DRR162473	DRX153092	DRS083153	DRP004696	PRJDB7713	Age associated transcriptome analysis in 5 tissues of zebrafish	DRP004696	Transcriptome Analysis	We performed transcriptome analysis for brain gill heart liver and muscle from 2 month 7 month 16 month and 39 mpf zebrafish. We analyzed age associated gene expression pattern in zebrafish and compared with similar public transcriptome data of rat Yu et al. 2014.				brain sample from 16 mpf zebrafish replicate2	SAMD00152421		sample name:b16 2\|age:16 month\|biological replicate:2\|tissue:brain									Illumina HiSeq 2000 paired end sequencing of SAMD00152421	DRX153092	1	1	Illumina TruSeq Stranded mRNA HT Kit		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2000	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>200</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>101</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP004696	Illumina HiSeq 2000 paired end sequencing of SAMD00152421				1399740200.0	6998701.0	DRR162473	0:100 1:100	A:420492615;C:278464854;G:278362101;T:420657546;N:1763084	100	100		420492615	278464854	278362101	420657546	1763084	DRX153092	DRS083153	DRA007711	UT-AQUA\|Laboratory of Aquatic Molecular Biology and Biotechnology	Department of Aquatic Bioscience, Graduate School of Agriculture and Life Sciences, The University of Tokyo	2	0.91795	0.88458	0.19015	0.18122	0.71374	0.72318	0.55157	0.55554	100	100	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	trueseq	bulk	unknown	unknown	Japan	2018-12-24	Adult	Adult	Brain	Nervous System
269	269	DRR162472	DRX153091	DRS083152	DRP004696	PRJDB7713	Age associated transcriptome analysis in 5 tissues of zebrafish	DRP004696	Transcriptome Analysis	We performed transcriptome analysis for brain gill heart liver and muscle from 2 month 7 month 16 month and 39 mpf zebrafish. We analyzed age associated gene expression pattern in zebrafish and compared with similar public transcriptome data of rat Yu et al. 2014.				brain sample from 16 mpf zebrafish replicate1	SAMD00152420		sample name:b16 1\|age:16 month\|biological replicate:1\|tissue:brain									Illumina HiSeq 2000 paired end sequencing of SAMD00152420	DRX153091	1	1	Illumina TruSeq Stranded mRNA HT Kit		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2000	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>200</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>101</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP004696	Illumina HiSeq 2000 paired end sequencing of SAMD00152420				1109512400.0	5547562.0	DRR162472	0:100 1:100	A:336800225;C:217086705;G:217195789;T:336929233;N:1500448	100	100		336800225	217086705	217195789	336929233	1500448	DRX153091	DRS083152	DRA007711	UT-AQUA\|Laboratory of Aquatic Molecular Biology and Biotechnology	Department of Aquatic Bioscience, Graduate School of Agriculture and Life Sciences, The University of Tokyo	2	0.91025	0.87734	0.20046	0.19197	0.71774	0.72482	0.52937	0.56111	100	100	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	trueseq	bulk	unknown	unknown	Japan	2018-12-24	Adult	Adult	Brain	Nervous System
270	270	DRR162471	DRX153090	DRS083151	DRP004696	PRJDB7713	Age associated transcriptome analysis in 5 tissues of zebrafish	DRP004696	Transcriptome Analysis	We performed transcriptome analysis for brain gill heart liver and muscle from 2 month 7 month 16 month and 39 mpf zebrafish. We analyzed age associated gene expression pattern in zebrafish and compared with similar public transcriptome data of rat Yu et al. 2014.				brain sample from 7 mpf zebrafish replicate5	SAMD00152419		sample name:b07 5\|age:7 month\|biological replicate:5\|tissue:brain									Illumina HiSeq 2000 paired end sequencing of SAMD00152419	DRX153090	1	1	Illumina TruSeq Stranded mRNA HT Kit		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2000	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>200</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>101</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP004696	Illumina HiSeq 2000 paired end sequencing of SAMD00152419				1472475400.0	7362377.0	DRR162471	0:100 1:100	A:448100356;C:287211180;G:287652290;T:447581010;N:1930564	100	100		448100356	287211180	287652290	447581010	1930564	DRX153090	DRS083151	DRA007711	UT-AQUA\|Laboratory of Aquatic Molecular Biology and Biotechnology	Department of Aquatic Bioscience, Graduate School of Agriculture and Life Sciences, The University of Tokyo	2	0.90584	0.87079	0.21738	0.2083	0.71415	0.7344	0.5518	0.55812	100	100	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	trueseq	bulk	unknown	unknown	Japan	2018-12-24	Adult	Adult	Brain	Nervous System
271	271	DRR162470	DRX153089	DRS083150	DRP004696	PRJDB7713	Age associated transcriptome analysis in 5 tissues of zebrafish	DRP004696	Transcriptome Analysis	We performed transcriptome analysis for brain gill heart liver and muscle from 2 month 7 month 16 month and 39 mpf zebrafish. We analyzed age associated gene expression pattern in zebrafish and compared with similar public transcriptome data of rat Yu et al. 2014.				brain sample from 7 mpf zebrafish replicate4	SAMD00152418		sample name:b07 4\|age:7 month\|biological replicate:4\|tissue:brain									Illumina HiSeq 2000 paired end sequencing of SAMD00152418	DRX153089	1	1	Illumina TruSeq Stranded mRNA HT Kit		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2000	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>200</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>101</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP004696	Illumina HiSeq 2000 paired end sequencing of SAMD00152418				1173234000.0	5866170.0	DRR162470	0:100 1:100	A:349147253;C:236479543;G:237153294;T:348938811;N:1515099	100	100		349147253	236479543	237153294	348938811	1515099	DRX153089	DRS083150	DRA007711	UT-AQUA\|Laboratory of Aquatic Molecular Biology and Biotechnology	Department of Aquatic Bioscience, Graduate School of Agriculture and Life Sciences, The University of Tokyo	2	0.91933	0.88973	0.18681	0.17878	0.71108	0.71867	0.5448	0.55274	100	100	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	trueseq	bulk	unknown	unknown	Japan	2018-12-24	Adult	Adult	Brain	Nervous System
272	272	DRR162469	DRX153088	DRS083149	DRP004696	PRJDB7713	Age associated transcriptome analysis in 5 tissues of zebrafish	DRP004696	Transcriptome Analysis	We performed transcriptome analysis for brain gill heart liver and muscle from 2 month 7 month 16 month and 39 mpf zebrafish. We analyzed age associated gene expression pattern in zebrafish and compared with similar public transcriptome data of rat Yu et al. 2014.				brain sample from 7 mpf zebrafish replicate3	SAMD00152417		sample name:b07 3\|age:7 month\|biological replicate:3\|tissue:brain									Illumina HiSeq 2000 paired end sequencing of SAMD00152417	DRX153088	1	1	Illumina TruSeq Stranded mRNA HT Kit		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2000	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>200</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>101</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP004696	Illumina HiSeq 2000 paired end sequencing of SAMD00152417				1322055600.0	6610278.0	DRR162469	0:100 1:100	A:387777992;C:270907178;G:273067585;T:387904272;N:2398573	100	100		387777992	270907178	273067585	387904272	2398573	DRX153088	DRS083149	DRA007711	UT-AQUA\|Laboratory of Aquatic Molecular Biology and Biotechnology	Department of Aquatic Bioscience, Graduate School of Agriculture and Life Sciences, The University of Tokyo	2	0.91753	0.88469	0.17775	0.17007	0.70656	0.71685	0.5466	0.54528	100	100	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	trueseq	bulk	unknown	unknown	Japan	2018-12-24	Adult	Adult	Brain	Nervous System
273	273	DRR162468	DRX153087	DRS083148	DRP004696	PRJDB7713	Age associated transcriptome analysis in 5 tissues of zebrafish	DRP004696	Transcriptome Analysis	We performed transcriptome analysis for brain gill heart liver and muscle from 2 month 7 month 16 month and 39 mpf zebrafish. We analyzed age associated gene expression pattern in zebrafish and compared with similar public transcriptome data of rat Yu et al. 2014.				brain sample from 7 mpf zebrafish replicate2	SAMD00152416		sample name:b07 2\|age:7 month\|biological replicate:2\|tissue:brain									Illumina HiSeq 2000 paired end sequencing of SAMD00152416	DRX153087	1	1	Illumina TruSeq Stranded mRNA HT Kit		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2000	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>200</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>101</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP004696	Illumina HiSeq 2000 paired end sequencing of SAMD00152416				1160349000.0	5801745.0	DRR162468	0:100 1:100	A:350211581;C:228387129;G:229679563;T:349919152;N:2151575	100	100		350211581	228387129	229679563	349919152	2151575	DRX153087	DRS083148	DRA007711	UT-AQUA\|Laboratory of Aquatic Molecular Biology and Biotechnology	Department of Aquatic Bioscience, Graduate School of Agriculture and Life Sciences, The University of Tokyo	2	0.91146	0.87717	0.20422	0.19494	0.7083	0.72082	0.55642	0.56386	100	100	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	trueseq	bulk	unknown	unknown	Japan	2018-12-24	Adult	Adult	Brain	Nervous System
274	274	DRR162467	DRX153086	DRS083147	DRP004696	PRJDB7713	Age associated transcriptome analysis in 5 tissues of zebrafish	DRP004696	Transcriptome Analysis	We performed transcriptome analysis for brain gill heart liver and muscle from 2 month 7 month 16 month and 39 mpf zebrafish. We analyzed age associated gene expression pattern in zebrafish and compared with similar public transcriptome data of rat Yu et al. 2014.				brain sample from 7 mpf zebrafish replicate1	SAMD00152415		sample name:b07 1\|age:7 month\|biological replicate:1\|tissue:brain									Illumina HiSeq 2000 paired end sequencing of SAMD00152415	DRX153086	1	1	Illumina TruSeq Stranded mRNA HT Kit		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2000	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>200</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>101</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP004696	Illumina HiSeq 2000 paired end sequencing of SAMD00152415				1162314600.0	5811573.0	DRR162467	0:100 1:100	A:344932586;C:233867698;G:235450342;T:345967852;N:2096122	100	100		344932586	233867698	235450342	345967852	2096122	DRX153086	DRS083147	DRA007711	UT-AQUA\|Laboratory of Aquatic Molecular Biology and Biotechnology	Department of Aquatic Bioscience, Graduate School of Agriculture and Life Sciences, The University of Tokyo	2	0.91102	0.88248	0.1897	0.18307	0.70786	0.71687	0.55008	0.54646	100	100	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	trueseq	bulk	unknown	unknown	Japan	2018-12-24	Adult	Adult	Brain	Nervous System
275	275	DRR162466	DRX153085	DRS083146	DRP004696	PRJDB7713	Age associated transcriptome analysis in 5 tissues of zebrafish	DRP004696	Transcriptome Analysis	We performed transcriptome analysis for brain gill heart liver and muscle from 2 month 7 month 16 month and 39 mpf zebrafish. We analyzed age associated gene expression pattern in zebrafish and compared with similar public transcriptome data of rat Yu et al. 2014.				brain sample from 2 mpf zebrafish replicate5	SAMD00152414		sample name:b02 5\|age:2 month\|biological replicate:5\|tissue:brain									Illumina HiSeq 2000 paired end sequencing of SAMD00152414	DRX153085	1	1	Illumina TruSeq Stranded mRNA HT Kit		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2000	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>200</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>101</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP004696	Illumina HiSeq 2000 paired end sequencing of SAMD00152414				1184455800.0	5922279.0	DRR162466	0:100 1:100	A:357035323;C:233685447;G:235595745;T:356085837;N:2053448	100	100		357035323	233685447	235595745	356085837	2053448	DRX153085	DRS083146	DRA007711	UT-AQUA\|Laboratory of Aquatic Molecular Biology and Biotechnology	Department of Aquatic Bioscience, Graduate School of Agriculture and Life Sciences, The University of Tokyo	2	0.90819	0.87146	0.20659	0.19751	0.71246	0.72251	0.52523	0.52531	100	100	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	trueseq	bulk	unknown	unknown	Japan	2018-12-24	Juvenile	Juvenile	Brain	Nervous System
276	276	DRR162465	DRX153084	DRS083145	DRP004696	PRJDB7713	Age associated transcriptome analysis in 5 tissues of zebrafish	DRP004696	Transcriptome Analysis	We performed transcriptome analysis for brain gill heart liver and muscle from 2 month 7 month 16 month and 39 mpf zebrafish. We analyzed age associated gene expression pattern in zebrafish and compared with similar public transcriptome data of rat Yu et al. 2014.				brain sample from 2 mpf zebrafish replicate4	SAMD00152413		sample name:b02 4\|age:2 month\|biological replicate:4\|tissue:brain									Illumina HiSeq 2000 paired end sequencing of SAMD00152413	DRX153084	1	1	Illumina TruSeq Stranded mRNA HT Kit		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2000	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>200</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>101</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP004696	Illumina HiSeq 2000 paired end sequencing of SAMD00152413				1389141000.0	6945705.0	DRR162465	0:100 1:100	A:423029010;C:270113394;G:270981952;T:422602360;N:2414284	100	100		423029010	270113394	270981952	422602360	2414284	DRX153084	DRS083145	DRA007711	UT-AQUA\|Laboratory of Aquatic Molecular Biology and Biotechnology	Department of Aquatic Bioscience, Graduate School of Agriculture and Life Sciences, The University of Tokyo	2	0.90961	0.87739	0.21147	0.20152	0.71492	0.72563	0.53639	0.53779	100	100	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	trueseq	bulk	unknown	unknown	Japan	2018-12-24	Juvenile	Juvenile	Brain	Nervous System
277	277	DRR162464	DRX153083	DRS083144	DRP004696	PRJDB7713	Age associated transcriptome analysis in 5 tissues of zebrafish	DRP004696	Transcriptome Analysis	We performed transcriptome analysis for brain gill heart liver and muscle from 2 month 7 month 16 month and 39 mpf zebrafish. We analyzed age associated gene expression pattern in zebrafish and compared with similar public transcriptome data of rat Yu et al. 2014.				brain sample from 2 mpf zebrafish replicate3	SAMD00152412		sample name:b02 3\|age:2 month\|biological replicate:3\|tissue:brain									Illumina HiSeq 2000 paired end sequencing of SAMD00152412	DRX153083	1	1	Illumina TruSeq Stranded mRNA HT Kit		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2000	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>200</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>101</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP004696	Illumina HiSeq 2000 paired end sequencing of SAMD00152412				2322459000.0	11612295.0	DRR162464	0:100 1:100	A:701085106;C:457451297;G:460424165;T:699185460;N:4312972	100	100		701085106	457451297	460424165	699185460	4312972	DRX153083	DRS083144	DRA007711	UT-AQUA\|Laboratory of Aquatic Molecular Biology and Biotechnology	Department of Aquatic Bioscience, Graduate School of Agriculture and Life Sciences, The University of Tokyo	2	0.92479	0.89382	0.16108	0.1547	0.73312	0.74121	0.55089	0.55507	100	100	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	trueseq	bulk	unknown	unknown	Japan	2018-12-24	Juvenile	Juvenile	Brain	Nervous System
278	278	DRR162463	DRX153082	DRS083143	DRP004696	PRJDB7713	Age associated transcriptome analysis in 5 tissues of zebrafish	DRP004696	Transcriptome Analysis	We performed transcriptome analysis for brain gill heart liver and muscle from 2 month 7 month 16 month and 39 mpf zebrafish. We analyzed age associated gene expression pattern in zebrafish and compared with similar public transcriptome data of rat Yu et al. 2014.				brain sample from 2 mpf zebrafish replicate2	SAMD00152411		sample name:b02 2\|age:2 month\|biological replicate:2\|tissue:brain									Illumina HiSeq 2000 paired end sequencing of SAMD00152411	DRX153082	1	1	Illumina TruSeq Stranded mRNA HT Kit		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2000	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>200</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>101</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP004696	Illumina HiSeq 2000 paired end sequencing of SAMD00152411				1188406400.0	5942032.0	DRR162463	0:100 1:100	A:354575190;C:238508166;G:239587004;T:353623510;N:2112530	100	100		354575190	238508166	239587004	353623510	2112530	DRX153082	DRS083143	DRA007711	UT-AQUA\|Laboratory of Aquatic Molecular Biology and Biotechnology	Department of Aquatic Bioscience, Graduate School of Agriculture and Life Sciences, The University of Tokyo	2	0.90922	0.8787	0.20709	0.2009	0.71614	0.7362	0.52768	0.53049	100	100	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	trueseq	bulk	unknown	unknown	Japan	2018-12-24	Juvenile	Juvenile	Brain	Nervous System
279	279	DRR162462	DRX153081	DRS083142	DRP004696	PRJDB7713	Age associated transcriptome analysis in 5 tissues of zebrafish	DRP004696	Transcriptome Analysis	We performed transcriptome analysis for brain gill heart liver and muscle from 2 month 7 month 16 month and 39 mpf zebrafish. We analyzed age associated gene expression pattern in zebrafish and compared with similar public transcriptome data of rat Yu et al. 2014.				brain sample from 2 mpf zebrafish replicate1	SAMD00152410		sample name:b02 1\|age:2 month\|biological replicate:1\|tissue:brain									Illumina HiSeq 2000 paired end sequencing of SAMD00152410	DRX153081	1	1	Illumina TruSeq Stranded mRNA HT Kit		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2000	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>200</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>101</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	DRP004696	Illumina HiSeq 2000 paired end sequencing of SAMD00152410				1033492200.0	5167461.0	DRR162462	0:100 1:100	A:310135217;C:205335529;G:207428012;T:308760225;N:1833217	100	100		310135217	205335529	207428012	308760225	1833217	DRX153081	DRS083142	DRA007711	UT-AQUA\|Laboratory of Aquatic Molecular Biology and Biotechnology	Department of Aquatic Bioscience, Graduate School of Agriculture and Life Sciences, The University of Tokyo	2	0.9176	0.8829	0.18651	0.17848	0.72099	0.73119	0.54307	0.54697	100	100	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	trueseq	bulk	unknown	unknown	Japan	2018-12-24	Juvenile	Juvenile	Brain	Nervous System
8064	8064	ERR035545	ERX013540	ERS017861	ERP000447	PRJEB2368	Sanger zebrafish sequencing	E-MTAB-460	Other				Protocols: Zebrafish tissue was collected from Singapore strain incross fish grown at 28C. Collected samples were snap frozen on dry ice and stored at 70 C Total RNA was extracted using Trizol Reagent Invitrogen following the manufacturer's instructions. Pellets were re suspended in 10 mM Tris pH 7.5 and the RNA was quantified using a NanoDrop ND 1000 Spectrophotometer Axon Instruments.	Zebrafish adult brain	SAMEA782568	Wellcome Sanger Institute	ENA first public:2011 02 03\|ENA last update:2018 03 08\|External Id:SAMEA782568\|INSDC center alias:SC\|INSDC center name:Wellcome Sanger Institute\|INSDC first public:2011 02 03T12:40:41Z\|INSDC last update:2018 03 08T15:25:22Z\|INSDC status:public\|StrainOrLine:Singapore\|Submitter Id:E MTAB 460:Zebrafish adult brain\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:adult\|organism part:brain\|sample name:E MTAB 460:Zebrafish adult brain\|sex:mixed									Sanger zebrafish sequencing	E MTAB 460 part2:5625 1	ZFbrain 2 RNA 1523492	Sanger zebrafish sequencing	Zebrafish tissue was collected from Singapore strain incross fish grown at 28C. Collected samples were snap frozen on dry ice and stored at 70 C Total RNA was extracted using Trizol Reagent Invitrogen following the manufacturer's instructions. Pellets were re suspended in 10 mM Tris pH 7.5 and the RNA was quantified using a NanoDrop ND 1000 Spectrophotometer Axon Instruments. Total RNA was enriched for polyA+ RNA by 2 rounds of polyA pull down with magnetic beads and included a DNase treatment between the 2 rounds. RNA was chemically fragmented LiCl precipitated reverse transcribed with random primers a second strand synthesized and made into a standard Illumina library with a fragment size of 250 to 300 bp.	Experimental Factor: ORGANISM PART:brain	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina Genome Analyzer II	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>160</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>77</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>2</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>85</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	ERP000447	Illumina Genome Analyzer II paired end sequencing; Sanger zebrafish sequencing	ENA FIRST PUBLIC:2011 06 14\|ENA LAST UPDATE:2018 11 16	5625_1.srf	srf	4576566720.0	28603542.0	E MTAB 460 part2:5625 1.srf	0:76 1:8 2:76	A:1227184716;C:942715631;G:951021478;T:1219839320;N:6977239	76	8	76	1227184716	942715631	951021478	1219839320	6977239	ERX013540	ERS017861	ERA033503	SC\|Wellcome Trust Sanger Institute	SC\|Wellcome Trust Sanger Institute	2	0.86503	0.86182	0.22392	0.22256	0.69664	0.69865	0.51454	0.51606	76	76	B	B	biological fallback assumption	illumina	early_illumina	unknown	poly_a	unknown	bulk	unknown	unknown	United Kingdom	2011-02-03	Adult	Adult	Brain	Nervous System
8069	8069	ERR023147	ERX009449	ERS017861	ERP000447	PRJEB2368	Sanger zebrafish sequencing	E-MTAB-460	Other				Protocols: Zebrafish tissue was collected from Singapore strain incross fish grown at 28C. Collected samples were snap frozen on dry ice and stored at 70 C Total RNA was extracted using Trizol Reagent Invitrogen following the manufacturer's instructions. Pellets were re suspended in 10 mM Tris pH 7.5 and the RNA was quantified using a NanoDrop ND 1000 Spectrophotometer Axon Instruments.	Zebrafish adult brain	SAMEA782568	Wellcome Sanger Institute	ENA first public:2011 02 03\|ENA last update:2018 03 08\|External Id:SAMEA782568\|INSDC center alias:SC\|INSDC center name:Wellcome Sanger Institute\|INSDC first public:2011 02 03T12:40:41Z\|INSDC last update:2018 03 08T15:25:22Z\|INSDC status:public\|StrainOrLine:Singapore\|Submitter Id:E MTAB 460:Zebrafish adult brain\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:adult\|organism part:brain\|sample name:E MTAB 460:Zebrafish adult brain\|sex:mixed									Sanger zebrafish sequencing	E MTAB 460:3537 7	RNA from Zebrafish adult brain	Sanger zebrafish sequencing	Zebrafish tissue was collected from Singapore strain incross fish grown at 28C. Collected samples were snap frozen on dry ice and stored at 70 C Total RNA was extracted using Trizol Reagent Invitrogen following the manufacturer's instructions. Pellets were re suspended in 10 mM Tris pH 7.5 and the RNA was quantified using a NanoDrop ND 1000 Spectrophotometer Axon Instruments.	Experimental Factor: ORGANISM PART:brain	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina Genome Analyzer II	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>152</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>77</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	ERP000447	Illumina Genome Analyzer II paired end sequencing; Sanger zebrafish sequencing	ENA FIRST PUBLIC:2011 02 03\|ENA LAST UPDATE:2018 11 16	3537_7.srf	srf	3047469128.0	20049139.0	E MTAB 460:3537 7.srf	0:76 1:76	A:951431181;C:561974807;G:565451314;T:964940357;N:3671469	76	76		951431181	561974807	565451314	964940357	3671469	ERX009449	ERS017861	ERA015648	SC\|Wellcome Trust Sanger Institute	SC\|Wellcome Trust Sanger Institute	2	0.89672	0.89537	0.31092	0.31152	0.75724	0.7583	0.56639	0.56663	76	76	B	B	biological fallback assumption	illumina	early_illumina	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	United Kingdom	2011-02-03	Adult	Adult	Brain	Nervous System
8070	8070	ERR023144	ERX009448	ERS017861	ERP000447	PRJEB2368	Sanger zebrafish sequencing	E-MTAB-460	Other				Protocols: Zebrafish tissue was collected from Singapore strain incross fish grown at 28C. Collected samples were snap frozen on dry ice and stored at 70 C Total RNA was extracted using Trizol Reagent Invitrogen following the manufacturer's instructions. Pellets were re suspended in 10 mM Tris pH 7.5 and the RNA was quantified using a NanoDrop ND 1000 Spectrophotometer Axon Instruments.	Zebrafish adult brain	SAMEA782568	Wellcome Sanger Institute	ENA first public:2011 02 03\|ENA last update:2018 03 08\|External Id:SAMEA782568\|INSDC center alias:SC\|INSDC center name:Wellcome Sanger Institute\|INSDC first public:2011 02 03T12:40:41Z\|INSDC last update:2018 03 08T15:25:22Z\|INSDC status:public\|StrainOrLine:Singapore\|Submitter Id:E MTAB 460:Zebrafish adult brain\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:adult\|organism part:brain\|sample name:E MTAB 460:Zebrafish adult brain\|sex:mixed									Sanger zebrafish sequencing	E MTAB 460:3212 6	RNA from Zebrafish adult brain	Sanger zebrafish sequencing	Zebrafish tissue was collected from Singapore strain incross fish grown at 28C. Collected samples were snap frozen on dry ice and stored at 70 C Total RNA was extracted using Trizol Reagent Invitrogen following the manufacturer's instructions. Pellets were re suspended in 10 mM Tris pH 7.5 and the RNA was quantified using a NanoDrop ND 1000 Spectrophotometer Axon Instruments.	Experimental Factor: ORGANISM PART:brain	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina Genome Analyzer II	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>152</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>77</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	ERP000447	Illumina Genome Analyzer II paired end sequencing; Sanger zebrafish sequencing	ENA FIRST PUBLIC:2011 02 03\|ENA LAST UPDATE:2018 11 16	3212_6.srf	srf	1970995248.0	12967074.0	E MTAB 460:3212 6.srf	0:76 1:76	A:601407561;C:370471604;G:371296333;T:608476094;N:19343656	76	76		601407561	370471604	371296333	608476094	19343656	ERX009448	ERS017861	ERA015648	SC\|Wellcome Trust Sanger Institute	SC\|Wellcome Trust Sanger Institute	2	0.90042	0.89919	0.30246	0.30122	0.75534	0.75349	0.57375	0.56725	76	76	B	B	biological fallback assumption	illumina	early_illumina	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	United Kingdom	2011-02-03	Adult	Adult	Brain	Nervous System
10170	10170	ERR375749	ERX348126	ERS337052	ERP003756	PRJEB4464	Zebrafish olfactory transcriptomics	Zebrafish_olfactory_transcriptomics-sc-2013-08-12T10:32:48Z-2742	Transcriptome Analysis	The olfactory gene repertoire is largely species specific shaped by the nature and necessity of chemosensory information for survival in each species' niche. The relative expression of olfactory receptors can be quantified by RNA sequencing. We investigated the olfactory transcriptome of zebrafish because : i of its phylogenetic location in the vertebrate tree ii it has only one olfactory organ yet it has representatives of all the mammalian chemosensory receptor families iii its biology is well known iv is a commonly used model organism and it is suitable for subsequent functional analysis.					SAMEA2168448	SC	ArrayExpress Genotype:Wildtype\|ArrayExpress OrganismPart:Olfactory epithelium\|ArrayExpress Sex:male\|ArrayExpress Species:Danio rerio\|ENA FIRST PUBLIC:2013 11 25T10:18:08Z\|ENA LAST UPDATE:2018 03 08T16:38:06Z\|External Id:SAMEA2168448\|INSDC center name:SC\|INSDC first public:2013 11 25T10:18:08Z\|INSDC last update:2018 03 08T16:38:06Z\|INSDC status:public\|Submitter Id:ZF OE3 sc 2013 08 12T10:36:21Z 1677721\|common name:zebrafish\|sample description:RNA from OE\|sample name:ZF OE3 sc 2013 08 12T10:36:21Z 1677721\|scientific name:Danio rerio									Illumina HiSeq 2000 paired end sequencing	SC EXP 10586 2#3	7941068	Illumina sequencing of library 7941068 constructed from sample accession ERS337052 for study accession ERP003756. This is part of an Illumina multiplexed sequencing run 10586 2. This submission includes reads tagged with the sequence TTAGGC.	Illumina cDNA protocol		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2000		ERP003756	Illumina HiSeq 2000 paired end sequencing	ENA FIRST PUBLIC:2013 11 25\|ENA LAST UPDATE:2018 11 16	10586_2#3.cram	cram	11298599000.0	56492995.0	SC RUN 10586 2#3	0:100 1:100	A:3356877540;C:2323057831;G:2299363865;T:3303865798;N:15433966	100	100		3356877540	2323057831	2299363865	3303865798	15433966	ERX348126	ERS337052	ERA267455	SC	Wellcome Sanger Institute	2	0.91061	0.90958	0.1659	0.16567	0.68398	0.68645	0.53954	0.54231	100	100	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	United Kingdom	2013-11-25	Undetermined	Undetermined	Brain	Nervous System
10171	10171	ERR375748	ERX348125	ERS337051	ERP003756	PRJEB4464	Zebrafish olfactory transcriptomics	Zebrafish_olfactory_transcriptomics-sc-2013-08-12T10:32:48Z-2742	Transcriptome Analysis	The olfactory gene repertoire is largely species specific shaped by the nature and necessity of chemosensory information for survival in each species' niche. The relative expression of olfactory receptors can be quantified by RNA sequencing. We investigated the olfactory transcriptome of zebrafish because : i of its phylogenetic location in the vertebrate tree ii it has only one olfactory organ yet it has representatives of all the mammalian chemosensory receptor families iii its biology is well known iv is a commonly used model organism and it is suitable for subsequent functional analysis.					SAMEA2168447	SC	ArrayExpress Genotype:Wildtype\|ArrayExpress OrganismPart:Olfactory epithelium\|ArrayExpress Sex:male\|ArrayExpress Species:Danio rerio\|ENA FIRST PUBLIC:2013 11 25T10:18:08Z\|ENA LAST UPDATE:2018 03 08T16:38:13Z\|External Id:SAMEA2168447\|INSDC center name:SC\|INSDC first public:2013 11 25T10:18:08Z\|INSDC last update:2018 03 08T16:38:13Z\|INSDC status:public\|Submitter Id:ZF OE2 sc 2013 08 12T10:36:20Z 1677720\|common name:zebrafish\|sample description:RNA from OE\|sample name:ZF OE2 sc 2013 08 12T10:36:20Z 1677720\|scientific name:Danio rerio									Illumina HiSeq 2000 paired end sequencing	SC EXP 10586 2#2	7941067	Illumina sequencing of library 7941067 constructed from sample accession ERS337051 for study accession ERP003756. This is part of an Illumina multiplexed sequencing run 10586 2. This submission includes reads tagged with the sequence CGATGT.	Illumina cDNA protocol		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2000		ERP003756	Illumina HiSeq 2000 paired end sequencing	ENA FIRST PUBLIC:2013 11 25\|ENA LAST UPDATE:2018 11 16	10586_2#2.cram	cram	10462424000.0	52312120.0	SC RUN 10586 2#2	0:100 1:100	A:3035632557;C:2208885147;G:2197231235;T:3006145790;N:14529271	100	100		3035632557	2208885147	2197231235	3006145790	14529271	ERX348125	ERS337051	ERA267455	SC	Wellcome Sanger Institute	2	0.91417	0.91329	0.15428	0.15477	0.66882	0.66896	0.52191	0.51898	100	100	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	United Kingdom	2013-11-25	Undetermined	Undetermined	Brain	Nervous System
10172	10172	ERR375747	ERX348124	ERS337050	ERP003756	PRJEB4464	Zebrafish olfactory transcriptomics	Zebrafish_olfactory_transcriptomics-sc-2013-08-12T10:32:48Z-2742	Transcriptome Analysis	The olfactory gene repertoire is largely species specific shaped by the nature and necessity of chemosensory information for survival in each species' niche. The relative expression of olfactory receptors can be quantified by RNA sequencing. We investigated the olfactory transcriptome of zebrafish because : i of its phylogenetic location in the vertebrate tree ii it has only one olfactory organ yet it has representatives of all the mammalian chemosensory receptor families iii its biology is well known iv is a commonly used model organism and it is suitable for subsequent functional analysis.					SAMEA2168446	SC	ArrayExpress Genotype:Wildtype\|ArrayExpress OrganismPart:Olfactory epithelium\|ArrayExpress Sex:male\|ArrayExpress Species:Danio rerio\|ENA FIRST PUBLIC:2013 11 25T10:18:08Z\|ENA LAST UPDATE:2018 03 08T16:38:06Z\|External Id:SAMEA2168446\|INSDC center name:SC\|INSDC first public:2013 11 25T10:18:08Z\|INSDC last update:2018 03 08T16:38:06Z\|INSDC status:public\|Submitter Id:ZF OE1 sc 2013 08 12T10:36:17Z 1677719\|common name:zebrafish\|sample description:RNA from OE\|sample name:ZF OE1 sc 2013 08 12T10:36:17Z 1677719\|scientific name:Danio rerio									Illumina HiSeq 2000 paired end sequencing	SC EXP 10586 2#1	7941066	Illumina sequencing of library 7941066 constructed from sample accession ERS337050 for study accession ERP003756. This is part of an Illumina multiplexed sequencing run 10586 2. This submission includes reads tagged with the sequence ATCACG.	Illumina cDNA protocol		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2000		ERP003756	Illumina HiSeq 2000 paired end sequencing	ENA FIRST PUBLIC:2013 11 25\|ENA LAST UPDATE:2018 11 16	10586_2#1.cram	cram	10377603200.0	51888016.0	SC RUN 10586 2#1	0:100 1:100	A:3021582125;C:2187474575;G:2170525378;T:2983668309;N:14352813	100	100		3021582125	2187474575	2170525378	2983668309	14352813	ERX348124	ERS337050	ERA267455	SC	Wellcome Sanger Institute	2	0.90978	0.90815	0.15565	0.15454	0.67322	0.67476	0.52923	0.51842	100	100	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	United Kingdom	2013-11-25	Undetermined	Undetermined	Brain	Nervous System
10173	10173	ERR375746	ERX348123	ERS337052	ERP003756	PRJEB4464	Zebrafish olfactory transcriptomics	Zebrafish_olfactory_transcriptomics-sc-2013-08-12T10:32:48Z-2742	Transcriptome Analysis	The olfactory gene repertoire is largely species specific shaped by the nature and necessity of chemosensory information for survival in each species' niche. The relative expression of olfactory receptors can be quantified by RNA sequencing. We investigated the olfactory transcriptome of zebrafish because : i of its phylogenetic location in the vertebrate tree ii it has only one olfactory organ yet it has representatives of all the mammalian chemosensory receptor families iii its biology is well known iv is a commonly used model organism and it is suitable for subsequent functional analysis.					SAMEA2168448	SC	ArrayExpress Genotype:Wildtype\|ArrayExpress OrganismPart:Olfactory epithelium\|ArrayExpress Sex:male\|ArrayExpress Species:Danio rerio\|ENA FIRST PUBLIC:2013 11 25T10:18:08Z\|ENA LAST UPDATE:2018 03 08T16:38:06Z\|External Id:SAMEA2168448\|INSDC center name:SC\|INSDC first public:2013 11 25T10:18:08Z\|INSDC last update:2018 03 08T16:38:06Z\|INSDC status:public\|Submitter Id:ZF OE3 sc 2013 08 12T10:36:21Z 1677721\|common name:zebrafish\|sample description:RNA from OE\|sample name:ZF OE3 sc 2013 08 12T10:36:21Z 1677721\|scientific name:Danio rerio									Illumina HiSeq 2000 paired end sequencing	SC EXP 10586 1#3	7941068	Illumina sequencing of library 7941068 constructed from sample accession ERS337052 for study accession ERP003756. This is part of an Illumina multiplexed sequencing run 10586 1. This submission includes reads tagged with the sequence TTAGGC.	Illumina cDNA protocol		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2000		ERP003756	Illumina HiSeq 2000 paired end sequencing	ENA FIRST PUBLIC:2013 11 25\|ENA LAST UPDATE:2018 11 16	10586_1#3.cram	cram	11455059800.0	57275299.0	SC RUN 10586 1#3	0:100 1:100	A:3406564785;C:2353388363;G:2329218644;T:3351844154;N:14043854	100	100		3406564785	2353388363	2329218644	3351844154	14043854	ERX348123	ERS337052	ERA267455	SC	Wellcome Sanger Institute	2	0.91087	0.90879	0.16647	0.16616	0.6832	0.68436	0.54098	0.53604	100	100	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	United Kingdom	2013-11-25	Undetermined	Undetermined	Brain	Nervous System
10174	10174	ERR375745	ERX348122	ERS337051	ERP003756	PRJEB4464	Zebrafish olfactory transcriptomics	Zebrafish_olfactory_transcriptomics-sc-2013-08-12T10:32:48Z-2742	Transcriptome Analysis	The olfactory gene repertoire is largely species specific shaped by the nature and necessity of chemosensory information for survival in each species' niche. The relative expression of olfactory receptors can be quantified by RNA sequencing. We investigated the olfactory transcriptome of zebrafish because : i of its phylogenetic location in the vertebrate tree ii it has only one olfactory organ yet it has representatives of all the mammalian chemosensory receptor families iii its biology is well known iv is a commonly used model organism and it is suitable for subsequent functional analysis.					SAMEA2168447	SC	ArrayExpress Genotype:Wildtype\|ArrayExpress OrganismPart:Olfactory epithelium\|ArrayExpress Sex:male\|ArrayExpress Species:Danio rerio\|ENA FIRST PUBLIC:2013 11 25T10:18:08Z\|ENA LAST UPDATE:2018 03 08T16:38:13Z\|External Id:SAMEA2168447\|INSDC center name:SC\|INSDC first public:2013 11 25T10:18:08Z\|INSDC last update:2018 03 08T16:38:13Z\|INSDC status:public\|Submitter Id:ZF OE2 sc 2013 08 12T10:36:20Z 1677720\|common name:zebrafish\|sample description:RNA from OE\|sample name:ZF OE2 sc 2013 08 12T10:36:20Z 1677720\|scientific name:Danio rerio									Illumina HiSeq 2000 paired end sequencing	SC EXP 10586 1#2	7941067	Illumina sequencing of library 7941067 constructed from sample accession ERS337051 for study accession ERP003756. This is part of an Illumina multiplexed sequencing run 10586 1. This submission includes reads tagged with the sequence CGATGT.	Illumina cDNA protocol		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2000		ERP003756	Illumina HiSeq 2000 paired end sequencing	ENA FIRST PUBLIC:2013 11 25\|ENA LAST UPDATE:2018 11 16	10586_1#2.cram	cram	10636681200.0	53183406.0	SC RUN 10586 1#2	0:100 1:100	A:3088549841;C:2244455059;G:2232424530;T:3058125106;N:13126664	100	100		3088549841	2244455059	2232424530	3058125106	13126664	ERX348122	ERS337051	ERA267455	SC	Wellcome Sanger Institute	2	0.9134	0.91251	0.15433	0.154	0.66849	0.66949	0.52089	0.53096	100	100	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	United Kingdom	2013-11-25	Undetermined	Undetermined	Brain	Nervous System
10175	10175	ERR375744	ERX348121	ERS337050	ERP003756	PRJEB4464	Zebrafish olfactory transcriptomics	Zebrafish_olfactory_transcriptomics-sc-2013-08-12T10:32:48Z-2742	Transcriptome Analysis	The olfactory gene repertoire is largely species specific shaped by the nature and necessity of chemosensory information for survival in each species' niche. The relative expression of olfactory receptors can be quantified by RNA sequencing. We investigated the olfactory transcriptome of zebrafish because : i of its phylogenetic location in the vertebrate tree ii it has only one olfactory organ yet it has representatives of all the mammalian chemosensory receptor families iii its biology is well known iv is a commonly used model organism and it is suitable for subsequent functional analysis.					SAMEA2168446	SC	ArrayExpress Genotype:Wildtype\|ArrayExpress OrganismPart:Olfactory epithelium\|ArrayExpress Sex:male\|ArrayExpress Species:Danio rerio\|ENA FIRST PUBLIC:2013 11 25T10:18:08Z\|ENA LAST UPDATE:2018 03 08T16:38:06Z\|External Id:SAMEA2168446\|INSDC center name:SC\|INSDC first public:2013 11 25T10:18:08Z\|INSDC last update:2018 03 08T16:38:06Z\|INSDC status:public\|Submitter Id:ZF OE1 sc 2013 08 12T10:36:17Z 1677719\|common name:zebrafish\|sample description:RNA from OE\|sample name:ZF OE1 sc 2013 08 12T10:36:17Z 1677719\|scientific name:Danio rerio									Illumina HiSeq 2000 paired end sequencing	SC EXP 10586 1#1	7941066	Illumina sequencing of library 7941066 constructed from sample accession ERS337050 for study accession ERP003756. This is part of an Illumina multiplexed sequencing run 10586 1. This submission includes reads tagged with the sequence ATCACG.	Illumina cDNA protocol		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2000		ERP003756	Illumina HiSeq 2000 paired end sequencing	ENA FIRST PUBLIC:2013 11 25\|ENA LAST UPDATE:2018 11 16	10586_1#1.cram	cram	10534775800.0	52673879.0	SC RUN 10586 1#1	0:100 1:100	A:3069581091;C:2219273001;G:2202030288;T:3030929981;N:12961439	100	100		3069581091	2219273001	2202030288	3030929981	12961439	ERX348121	ERS337050	ERA267455	SC	Wellcome Sanger Institute	2	0.91028	0.90986	0.15668	0.15607	0.67456	0.67472	0.52998	0.49845	100	100	B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	United Kingdom	2013-11-25	Undetermined	Undetermined	Brain	Nervous System
19493	19493	ERR14085264	ERX13487656	ERS22622156	ERP167301	PRJEB83711	From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration	inda-STUDY-IIT-Delhi,Indraprastha Institute of Information Technology Shilpi Minocha, KSBS, IIT-Delhi New Delhi,India-2024-12-18 14:20:14.533-243	Other	Regeneration of damaged brain tissue is a complex biological process that varies significantly across species. Zebrafish possess a remarkable ability to regenerate central nervous system structures making them an invaluable model for studying the molecular and cellular mechanisms underlying neuroregeneration. In this study we employed a previously standardized telencephalic stab wound injury model to investigate transcriptional and cellular responses during zebrafish brain regeneration. This well characterized model allows for precise analysis of injury induced regenerative processes by comparing different temporal stages of recovery. Using RNA sequencing at four key time points: control 1 day post lesion 4 dpl and 7 dpl we identified dynamic changes in gene expression and revealed critical signaling pathways associated with regeneration. Among these the p38 MAPK signaling cascade emerged as a key regulator. Our findings underscore the multifaceted role of p38 MAPK which modulates progenitor cell proliferation differentiation and neurogenesis during regeneration. These insights align with known roles of p38 MAPK in neural stem cell biology while highlighting its distinct contributions in a regenerative context. This work provides a comprehensive overview of early transcriptional events and highlights novel molecular players involved in CNS repair further establishing the zebrafish as a robust model for regenerative research. Our findings open avenues for applying these pathways to develop therapeutic strategies aimed at enhancing brain repair in humans.	ENA FIRST PUBLIC:2024 12 19\|ENA LAST UPDATE:2024 12 19		RNA seq Day 1 Replicate 3	Day 1 Replicate 3	SAMEA117549392	Indian Institute of Technology Delhi,Indraprastha Institute of Information Technology	ENA first public:2024 12 19\|INSDC center name:Indian Institute of Technology Delhi Indraprastha Institute of Information Technology\|INSDC status:public\|Submitter Id:SAMIN0009436 Day 1 Replicate 3\|broker name:IBDC\|collection date:2022 12 23\|common name:zebrafish\|geographic location country and/or sea:India\|geographic location region and locality:New Delhi India\|sample name:SAMIN0009436 Day 1 Replicate 3\|scientific name:Danio rerio									From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration	From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration 9517	1	1	NaN		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000		ERP167301	Illumina NovaSeq 6000 paired end sequencing; From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration	ENA FIRST PUBLIC:2024 12 19\|ENA LAST UPDATE:2024 12 19	19137_1dpl3_R1.fastq.gz 19138_1dpl3_R2.fastq.gz	fastq fastq	9165478634.0	30349267.0	RUN From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration 9517	0:151 1:151	A:2646232308;C:1796801479;G:2124056448;T:2588021406;N:10366993	151	151		2646232308	1796801479	2124056448	2588021406	10366993	ERX13487656	ERS22622156	ERA31046063	Indian Biological Data Centre\|European Nucleotide Archive	Indian Biological Data Centre												B	B	biological fallback assumption	illumina	novaseq_era	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	India	2024-12-19	Undetermined	Undetermined	Brain	Nervous System
19494	19494	ERR14085263	ERX13487655	ERS22622154	ERP167301	PRJEB83711	From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration	inda-STUDY-IIT-Delhi,Indraprastha Institute of Information Technology Shilpi Minocha, KSBS, IIT-Delhi New Delhi,India-2024-12-18 14:20:14.533-243	Other	Regeneration of damaged brain tissue is a complex biological process that varies significantly across species. Zebrafish possess a remarkable ability to regenerate central nervous system structures making them an invaluable model for studying the molecular and cellular mechanisms underlying neuroregeneration. In this study we employed a previously standardized telencephalic stab wound injury model to investigate transcriptional and cellular responses during zebrafish brain regeneration. This well characterized model allows for precise analysis of injury induced regenerative processes by comparing different temporal stages of recovery. Using RNA sequencing at four key time points: control 1 day post lesion 4 dpl and 7 dpl we identified dynamic changes in gene expression and revealed critical signaling pathways associated with regeneration. Among these the p38 MAPK signaling cascade emerged as a key regulator. Our findings underscore the multifaceted role of p38 MAPK which modulates progenitor cell proliferation differentiation and neurogenesis during regeneration. These insights align with known roles of p38 MAPK in neural stem cell biology while highlighting its distinct contributions in a regenerative context. This work provides a comprehensive overview of early transcriptional events and highlights novel molecular players involved in CNS repair further establishing the zebrafish as a robust model for regenerative research. Our findings open avenues for applying these pathways to develop therapeutic strategies aimed at enhancing brain repair in humans.	ENA FIRST PUBLIC:2024 12 19\|ENA LAST UPDATE:2024 12 19		RNA seq Day 1 Replicate 2	Day 1 Replicate 2	SAMEA117549391	Indian Institute of Technology Delhi,Indraprastha Institute of Information Technology	ENA first public:2024 12 19\|INSDC center name:Indian Institute of Technology Delhi Indraprastha Institute of Information Technology\|INSDC status:public\|Submitter Id:SAMIN0009435 Day 1 Replicate 2\|broker name:IBDC\|collection date:2022 12 23\|common name:zebrafish\|geographic location country and/or sea:India\|geographic location region and locality:New Delhi India\|sample name:SAMIN0009435 Day 1 Replicate 2\|scientific name:Danio rerio									From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration	From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration 9516	1	1	NaN		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000		ERP167301	Illumina NovaSeq 6000 paired end sequencing; From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration	ENA FIRST PUBLIC:2024 12 19\|ENA LAST UPDATE:2024 12 19	19135_1dpl2_R1.fastq.gz 19136_1dpl2_R2.fastq.gz	fastq fastq	9442039362.0	31265031.0	RUN From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration 9516	0:151 1:151	A:2725446078;C:1808614751;G:2223018565;T:2675393466;N:9566502	151	151		2725446078	1808614751	2223018565	2675393466	9566502	ERX13487655	ERS22622154	ERA31046062	Indian Biological Data Centre\|European Nucleotide Archive	Indian Biological Data Centre												B	B	biological fallback assumption	illumina	novaseq_era	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	India	2024-12-19	Undetermined	Undetermined	Brain	Nervous System
19495	19495	ERR14085271	ERX13487663	ERS22622318	ERP167301	PRJEB83711	From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration	inda-STUDY-IIT-Delhi,Indraprastha Institute of Information Technology Shilpi Minocha, KSBS, IIT-Delhi New Delhi,India-2024-12-18 14:20:14.533-243	Other	Regeneration of damaged brain tissue is a complex biological process that varies significantly across species. Zebrafish possess a remarkable ability to regenerate central nervous system structures making them an invaluable model for studying the molecular and cellular mechanisms underlying neuroregeneration. In this study we employed a previously standardized telencephalic stab wound injury model to investigate transcriptional and cellular responses during zebrafish brain regeneration. This well characterized model allows for precise analysis of injury induced regenerative processes by comparing different temporal stages of recovery. Using RNA sequencing at four key time points: control 1 day post lesion 4 dpl and 7 dpl we identified dynamic changes in gene expression and revealed critical signaling pathways associated with regeneration. Among these the p38 MAPK signaling cascade emerged as a key regulator. Our findings underscore the multifaceted role of p38 MAPK which modulates progenitor cell proliferation differentiation and neurogenesis during regeneration. These insights align with known roles of p38 MAPK in neural stem cell biology while highlighting its distinct contributions in a regenerative context. This work provides a comprehensive overview of early transcriptional events and highlights novel molecular players involved in CNS repair further establishing the zebrafish as a robust model for regenerative research. Our findings open avenues for applying these pathways to develop therapeutic strategies aimed at enhancing brain repair in humans.	ENA FIRST PUBLIC:2024 12 19\|ENA LAST UPDATE:2024 12 19		RNA seq Day 7 Replicate 3	Day 7 Replicate 3	SAMEA117549418	Indian Institute of Technology Delhi,Indraprastha Institute of Information Technology	ENA first public:2024 12 19\|INSDC center name:Indian Institute of Technology Delhi Indraprastha Institute of Information Technology\|INSDC status:public\|Submitter Id:SAMIN0009442 Day 7 Replicate 3\|broker name:IBDC\|collection date:2022 12 23\|common name:zebrafish\|geographic location country and/or sea:India\|geographic location region and locality:New Delhi India\|sample name:SAMIN0009442 Day 7 Replicate 3\|scientific name:Danio rerio									From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration	From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration 9523	1	1	NaN		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000		ERP167301	Illumina NovaSeq 6000 paired end sequencing; From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration	ENA FIRST PUBLIC:2024 12 19\|ENA LAST UPDATE:2024 12 19	19149_7dpl5_R1.fastq.gz 19150_7dpl5_R2.fastq.gz	fastq fastq	9932206502.0	32888101.0	RUN From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration 9523	0:151 1:151	A:2877130874;C:2050638794;G:2165950578;T:2827301936;N:11184320	151	151		2877130874	2050638794	2165950578	2827301936	11184320	ERX13487663	ERS22622318	ERA31046070	Indian Biological Data Centre\|European Nucleotide Archive	Indian Biological Data Centre												B	B	biological fallback assumption	illumina	novaseq_era	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	India	2024-12-19	Undetermined	Undetermined	Brain	Nervous System
19496	19496	ERR14085261	ERX13487653	ERS22622089	ERP167301	PRJEB83711	From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration	inda-STUDY-IIT-Delhi,Indraprastha Institute of Information Technology Shilpi Minocha, KSBS, IIT-Delhi New Delhi,India-2024-12-18 14:20:14.533-243	Other	Regeneration of damaged brain tissue is a complex biological process that varies significantly across species. Zebrafish possess a remarkable ability to regenerate central nervous system structures making them an invaluable model for studying the molecular and cellular mechanisms underlying neuroregeneration. In this study we employed a previously standardized telencephalic stab wound injury model to investigate transcriptional and cellular responses during zebrafish brain regeneration. This well characterized model allows for precise analysis of injury induced regenerative processes by comparing different temporal stages of recovery. Using RNA sequencing at four key time points: control 1 day post lesion 4 dpl and 7 dpl we identified dynamic changes in gene expression and revealed critical signaling pathways associated with regeneration. Among these the p38 MAPK signaling cascade emerged as a key regulator. Our findings underscore the multifaceted role of p38 MAPK which modulates progenitor cell proliferation differentiation and neurogenesis during regeneration. These insights align with known roles of p38 MAPK in neural stem cell biology while highlighting its distinct contributions in a regenerative context. This work provides a comprehensive overview of early transcriptional events and highlights novel molecular players involved in CNS repair further establishing the zebrafish as a robust model for regenerative research. Our findings open avenues for applying these pathways to develop therapeutic strategies aimed at enhancing brain repair in humans.	ENA FIRST PUBLIC:2024 12 19\|ENA LAST UPDATE:2024 12 19		RNA seq Day 1 Replicate 1	Day 1 Replicate 1	SAMEA117549390	Indian Institute of Technology Delhi,Indraprastha Institute of Information Technology	ENA first public:2024 12 19\|INSDC center name:Indian Institute of Technology Delhi Indraprastha Institute of Information Technology\|INSDC status:public\|Submitter Id:SAMIN0009434 Day 1 Replicate 1\|broker name:IBDC\|collection date:2022 12 23\|common name:zebrafish\|geographic location country and/or sea:India\|geographic location region and locality:New Delhi India\|sample name:SAMIN0009434 Day 1 Replicate 1\|scientific name:Danio rerio									From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration	From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration 9515	1	1	NaN		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000		ERP167301	Illumina NovaSeq 6000 paired end sequencing; From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration	ENA FIRST PUBLIC:2024 12 19\|ENA LAST UPDATE:2024 12 19	19133_1dpl1_R1.fastq.gz 19134_1dpl1_R2.fastq.gz	fastq fastq	9389201442.0	31090071.0	RUN From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration 9515	0:151 1:151	A:2731715362;C:1816017173;G:2148260573;T:2683133097;N:10075237	151	151		2731715362	1816017173	2148260573	2683133097	10075237	ERX13487653	ERS22622089	ERA31046060	Indian Biological Data Centre\|European Nucleotide Archive	Indian Biological Data Centre												B	B	biological fallback assumption	illumina	novaseq_era	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	India	2024-12-19	Undetermined	Undetermined	Brain	Nervous System
19497	19497	ERR14085274	ERX13487666	ERS22622321	ERP167301	PRJEB83711	From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration	inda-STUDY-IIT-Delhi,Indraprastha Institute of Information Technology Shilpi Minocha, KSBS, IIT-Delhi New Delhi,India-2024-12-18 14:20:14.533-243	Other	Regeneration of damaged brain tissue is a complex biological process that varies significantly across species. Zebrafish possess a remarkable ability to regenerate central nervous system structures making them an invaluable model for studying the molecular and cellular mechanisms underlying neuroregeneration. In this study we employed a previously standardized telencephalic stab wound injury model to investigate transcriptional and cellular responses during zebrafish brain regeneration. This well characterized model allows for precise analysis of injury induced regenerative processes by comparing different temporal stages of recovery. Using RNA sequencing at four key time points: control 1 day post lesion 4 dpl and 7 dpl we identified dynamic changes in gene expression and revealed critical signaling pathways associated with regeneration. Among these the p38 MAPK signaling cascade emerged as a key regulator. Our findings underscore the multifaceted role of p38 MAPK which modulates progenitor cell proliferation differentiation and neurogenesis during regeneration. These insights align with known roles of p38 MAPK in neural stem cell biology while highlighting its distinct contributions in a regenerative context. This work provides a comprehensive overview of early transcriptional events and highlights novel molecular players involved in CNS repair further establishing the zebrafish as a robust model for regenerative research. Our findings open avenues for applying these pathways to develop therapeutic strategies aimed at enhancing brain repair in humans.	ENA FIRST PUBLIC:2024 12 19\|ENA LAST UPDATE:2024 12 19		RNA seq Control Replicate 3	Control Replicate 3	SAMEA117549421	Indian Institute of Technology Delhi,Indraprastha Institute of Information Technology	ENA first public:2024 12 19\|INSDC center name:Indian Institute of Technology Delhi Indraprastha Institute of Information Technology\|INSDC status:public\|Submitter Id:SAMIN0009445 Control Replicate 3\|broker name:IBDC\|collection date:2022 12 23\|common name:zebrafish\|geographic location country and/or sea:India\|geographic location region and locality:New Delhi India\|sample name:SAMIN0009445 Control Replicate 3\|scientific name:Danio rerio									From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration	From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration 9526	1	1	NaN		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000		ERP167301	Illumina NovaSeq 6000 paired end sequencing; From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration	ENA FIRST PUBLIC:2024 12 19\|ENA LAST UPDATE:2024 12 19	19155_C7_R1.fastq.gz 19156_C7_R2.fastq.gz	fastq fastq	9909221282.0	32811991.0	RUN From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration 9526	0:151 1:151	A:2850780132;C:1946613930;G:2307229799;T:2793332914;N:11264507	151	151		2850780132	1946613930	2307229799	2793332914	11264507	ERX13487666	ERS22622321	ERA31046073	Indian Biological Data Centre\|European Nucleotide Archive	Indian Biological Data Centre												B	B	biological fallback assumption	illumina	novaseq_era	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	India	2024-12-19	Undetermined	Undetermined	Brain	Nervous System
19498	19498	ERR14085268	ERX13487660	ERS22622316	ERP167301	PRJEB83711	From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration	inda-STUDY-IIT-Delhi,Indraprastha Institute of Information Technology Shilpi Minocha, KSBS, IIT-Delhi New Delhi,India-2024-12-18 14:20:14.533-243	Other	Regeneration of damaged brain tissue is a complex biological process that varies significantly across species. Zebrafish possess a remarkable ability to regenerate central nervous system structures making them an invaluable model for studying the molecular and cellular mechanisms underlying neuroregeneration. In this study we employed a previously standardized telencephalic stab wound injury model to investigate transcriptional and cellular responses during zebrafish brain regeneration. This well characterized model allows for precise analysis of injury induced regenerative processes by comparing different temporal stages of recovery. Using RNA sequencing at four key time points: control 1 day post lesion 4 dpl and 7 dpl we identified dynamic changes in gene expression and revealed critical signaling pathways associated with regeneration. Among these the p38 MAPK signaling cascade emerged as a key regulator. Our findings underscore the multifaceted role of p38 MAPK which modulates progenitor cell proliferation differentiation and neurogenesis during regeneration. These insights align with known roles of p38 MAPK in neural stem cell biology while highlighting its distinct contributions in a regenerative context. This work provides a comprehensive overview of early transcriptional events and highlights novel molecular players involved in CNS repair further establishing the zebrafish as a robust model for regenerative research. Our findings open avenues for applying these pathways to develop therapeutic strategies aimed at enhancing brain repair in humans.	ENA FIRST PUBLIC:2024 12 19\|ENA LAST UPDATE:2024 12 19		RNA seq Day 7 Replicate 1	Day 7 Replicate 1	SAMEA117549416	Indian Institute of Technology Delhi,Indraprastha Institute of Information Technology	ENA first public:2024 12 19\|INSDC center name:Indian Institute of Technology Delhi Indraprastha Institute of Information Technology\|INSDC status:public\|Submitter Id:SAMIN0009440 Day 7 Replicate 1\|broker name:IBDC\|collection date:2022 12 23\|common name:zebrafish\|geographic location country and/or sea:India\|geographic location region and locality:New Delhi India\|sample name:SAMIN0009440 Day 7 Replicate 1\|scientific name:Danio rerio									From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration	From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration 9521	1	1	NaN		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000		ERP167301	Illumina NovaSeq 6000 paired end sequencing; From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration	ENA FIRST PUBLIC:2024 12 19\|ENA LAST UPDATE:2024 12 19	19145_7dpl1_R1.fastq.gz 19146_7dpl1_R2.fastq.gz	fastq fastq	9208706914.0	30492407.0	RUN From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration 9521	0:151 1:151	A:2666375656;C:1820213036;G:2101314534;T:2611250093;N:9553595	151	151		2666375656	1820213036	2101314534	2611250093	9553595	ERX13487660	ERS22622316	ERA31046067	Indian Biological Data Centre\|European Nucleotide Archive	Indian Biological Data Centre												B	B	biological fallback assumption	illumina	novaseq_era	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	India	2024-12-19	Undetermined	Undetermined	Brain	Nervous System
19499	19499	ERR14085276	ERX13487668	ERS22622315	ERP167301	PRJEB83711	From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration	inda-STUDY-IIT-Delhi,Indraprastha Institute of Information Technology Shilpi Minocha, KSBS, IIT-Delhi New Delhi,India-2024-12-18 14:20:14.533-243	Other	Regeneration of damaged brain tissue is a complex biological process that varies significantly across species. Zebrafish possess a remarkable ability to regenerate central nervous system structures making them an invaluable model for studying the molecular and cellular mechanisms underlying neuroregeneration. In this study we employed a previously standardized telencephalic stab wound injury model to investigate transcriptional and cellular responses during zebrafish brain regeneration. This well characterized model allows for precise analysis of injury induced regenerative processes by comparing different temporal stages of recovery. Using RNA sequencing at four key time points: control 1 day post lesion 4 dpl and 7 dpl we identified dynamic changes in gene expression and revealed critical signaling pathways associated with regeneration. Among these the p38 MAPK signaling cascade emerged as a key regulator. Our findings underscore the multifaceted role of p38 MAPK which modulates progenitor cell proliferation differentiation and neurogenesis during regeneration. These insights align with known roles of p38 MAPK in neural stem cell biology while highlighting its distinct contributions in a regenerative context. This work provides a comprehensive overview of early transcriptional events and highlights novel molecular players involved in CNS repair further establishing the zebrafish as a robust model for regenerative research. Our findings open avenues for applying these pathways to develop therapeutic strategies aimed at enhancing brain repair in humans.	ENA FIRST PUBLIC:2024 12 19\|ENA LAST UPDATE:2024 12 19		RNA seq Day 4 Replicate 3	Day 4 Replicate 3	SAMEA117549415	Indian Institute of Technology Delhi,Indraprastha Institute of Information Technology	ENA first public:2024 12 19\|INSDC center name:Indian Institute of Technology Delhi Indraprastha Institute of Information Technology\|INSDC status:public\|Submitter Id:SAMIN0009439 Day 4 Replicate 3\|broker name:IBDC\|collection date:2022 12 23\|common name:zebrafish\|geographic location country and/or sea:India\|geographic location region and locality:New Delhi India\|sample name:SAMIN0009439 Day 4 Replicate 3\|scientific name:Danio rerio									From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration	From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration 9520	1	1	NaN		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000		ERP167301	Illumina NovaSeq 6000 paired end sequencing; From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration	ENA FIRST PUBLIC:2024 12 19\|ENA LAST UPDATE:2024 12 19	19143_4dpl4_R1.fastq.gz 19144_4dpl4_R2.fastq.gz	fastq fastq	9313489740.0	30839370.0	RUN From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration 9520	0:151 1:151	A:2667044089;C:1836529353;G:2193641971;T:2605720804;N:10553523	151	151		2667044089	1836529353	2193641971	2605720804	10553523	ERX13487668	ERS22622315	ERA31046075	Indian Biological Data Centre\|European Nucleotide Archive	Indian Biological Data Centre												B	B	biological fallback assumption	illumina	novaseq_era	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	India	2024-12-19	Undetermined	Undetermined	Brain	Nervous System
19500	19500	ERR14085272	ERX13487664	ERS22622319	ERP167301	PRJEB83711	From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration	inda-STUDY-IIT-Delhi,Indraprastha Institute of Information Technology Shilpi Minocha, KSBS, IIT-Delhi New Delhi,India-2024-12-18 14:20:14.533-243	Other	Regeneration of damaged brain tissue is a complex biological process that varies significantly across species. Zebrafish possess a remarkable ability to regenerate central nervous system structures making them an invaluable model for studying the molecular and cellular mechanisms underlying neuroregeneration. In this study we employed a previously standardized telencephalic stab wound injury model to investigate transcriptional and cellular responses during zebrafish brain regeneration. This well characterized model allows for precise analysis of injury induced regenerative processes by comparing different temporal stages of recovery. Using RNA sequencing at four key time points: control 1 day post lesion 4 dpl and 7 dpl we identified dynamic changes in gene expression and revealed critical signaling pathways associated with regeneration. Among these the p38 MAPK signaling cascade emerged as a key regulator. Our findings underscore the multifaceted role of p38 MAPK which modulates progenitor cell proliferation differentiation and neurogenesis during regeneration. These insights align with known roles of p38 MAPK in neural stem cell biology while highlighting its distinct contributions in a regenerative context. This work provides a comprehensive overview of early transcriptional events and highlights novel molecular players involved in CNS repair further establishing the zebrafish as a robust model for regenerative research. Our findings open avenues for applying these pathways to develop therapeutic strategies aimed at enhancing brain repair in humans.	ENA FIRST PUBLIC:2024 12 19\|ENA LAST UPDATE:2024 12 19		RNA seq Control Replicate 1	Control Replicate 1	SAMEA117549419	Indian Institute of Technology Delhi,Indraprastha Institute of Information Technology	ENA first public:2024 12 19\|INSDC center name:Indian Institute of Technology Delhi Indraprastha Institute of Information Technology\|INSDC status:public\|Submitter Id:SAMIN0009443 Control Replicate 1\|broker name:IBDC\|collection date:2022 12 23\|common name:zebrafish\|geographic location country and/or sea:India\|geographic location region and locality:New Delhi India\|sample name:SAMIN0009443 Control Replicate 1\|scientific name:Danio rerio									From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration	From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration 9524	1	1	NaN		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000		ERP167301	Illumina NovaSeq 6000 paired end sequencing; From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration	ENA FIRST PUBLIC:2024 12 19\|ENA LAST UPDATE:2024 12 19	19151_C5_R1.fastq.gz 19152_C5_R2.fastq.gz	fastq fastq	13295515874.0	44024887.0	RUN From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration 9524	0:151 1:151	A:3841326329;C:2750684077;G:2915049240;T:3777029141;N:11427087	151	151		3841326329	2750684077	2915049240	3777029141	11427087	ERX13487664	ERS22622319	ERA31046071	Indian Biological Data Centre\|European Nucleotide Archive	Indian Biological Data Centre												B	B	biological fallback assumption	illumina	novaseq_era	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	India	2024-12-19	Undetermined	Undetermined	Brain	Nervous System
19501	19501	ERR14085265	ERX13487657	ERS22622177	ERP167301	PRJEB83711	From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration	inda-STUDY-IIT-Delhi,Indraprastha Institute of Information Technology Shilpi Minocha, KSBS, IIT-Delhi New Delhi,India-2024-12-18 14:20:14.533-243	Other	Regeneration of damaged brain tissue is a complex biological process that varies significantly across species. Zebrafish possess a remarkable ability to regenerate central nervous system structures making them an invaluable model for studying the molecular and cellular mechanisms underlying neuroregeneration. In this study we employed a previously standardized telencephalic stab wound injury model to investigate transcriptional and cellular responses during zebrafish brain regeneration. This well characterized model allows for precise analysis of injury induced regenerative processes by comparing different temporal stages of recovery. Using RNA sequencing at four key time points: control 1 day post lesion 4 dpl and 7 dpl we identified dynamic changes in gene expression and revealed critical signaling pathways associated with regeneration. Among these the p38 MAPK signaling cascade emerged as a key regulator. Our findings underscore the multifaceted role of p38 MAPK which modulates progenitor cell proliferation differentiation and neurogenesis during regeneration. These insights align with known roles of p38 MAPK in neural stem cell biology while highlighting its distinct contributions in a regenerative context. This work provides a comprehensive overview of early transcriptional events and highlights novel molecular players involved in CNS repair further establishing the zebrafish as a robust model for regenerative research. Our findings open avenues for applying these pathways to develop therapeutic strategies aimed at enhancing brain repair in humans.	ENA FIRST PUBLIC:2024 12 19\|ENA LAST UPDATE:2024 12 19		RNA seq Day 4 Replicate 1	Day 4 Replicate 1	SAMEA117549413	Indian Institute of Technology Delhi,Indraprastha Institute of Information Technology	ENA first public:2024 12 19\|INSDC center name:Indian Institute of Technology Delhi Indraprastha Institute of Information Technology\|INSDC status:public\|Submitter Id:SAMIN0009437 Day 4 Replicate 1\|broker name:IBDC\|collection date:2022 12 23\|common name:zebrafish\|geographic location country and/or sea:India\|geographic location region and locality:New Delhi India\|sample name:SAMIN0009437 Day 4 Replicate 1\|scientific name:Danio rerio									From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration	From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration 9518	1	1	NaN		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000		ERP167301	Illumina NovaSeq 6000 paired end sequencing; From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration	ENA FIRST PUBLIC:2024 12 19\|ENA LAST UPDATE:2024 12 19	19139_4dpl2_R1.fastq.gz 19140_4dpl2_R2.fastq.gz	fastq fastq	12509373332.0	41421766.0	RUN From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration 9518	0:151 1:151	A:3636942004;C:2502487228;G:2790329437;T:3565530654;N:14084009	151	151		3636942004	2502487228	2790329437	3565530654	14084009	ERX13487657	ERS22622177	ERA31046064	Indian Biological Data Centre\|European Nucleotide Archive	Indian Biological Data Centre												B	B	biological fallback assumption	illumina	novaseq_era	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	India	2024-12-19	Undetermined	Undetermined	Brain	Nervous System
19502	19502	ERR14085266	ERX13487658	ERS22622210	ERP167301	PRJEB83711	From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration	inda-STUDY-IIT-Delhi,Indraprastha Institute of Information Technology Shilpi Minocha, KSBS, IIT-Delhi New Delhi,India-2024-12-18 14:20:14.533-243	Other	Regeneration of damaged brain tissue is a complex biological process that varies significantly across species. Zebrafish possess a remarkable ability to regenerate central nervous system structures making them an invaluable model for studying the molecular and cellular mechanisms underlying neuroregeneration. In this study we employed a previously standardized telencephalic stab wound injury model to investigate transcriptional and cellular responses during zebrafish brain regeneration. This well characterized model allows for precise analysis of injury induced regenerative processes by comparing different temporal stages of recovery. Using RNA sequencing at four key time points: control 1 day post lesion 4 dpl and 7 dpl we identified dynamic changes in gene expression and revealed critical signaling pathways associated with regeneration. Among these the p38 MAPK signaling cascade emerged as a key regulator. Our findings underscore the multifaceted role of p38 MAPK which modulates progenitor cell proliferation differentiation and neurogenesis during regeneration. These insights align with known roles of p38 MAPK in neural stem cell biology while highlighting its distinct contributions in a regenerative context. This work provides a comprehensive overview of early transcriptional events and highlights novel molecular players involved in CNS repair further establishing the zebrafish as a robust model for regenerative research. Our findings open avenues for applying these pathways to develop therapeutic strategies aimed at enhancing brain repair in humans.	ENA FIRST PUBLIC:2024 12 19\|ENA LAST UPDATE:2024 12 19		RNA seq Day 4 Replicate 2	Day 4 Replicate 2	SAMEA117549414	Indian Institute of Technology Delhi,Indraprastha Institute of Information Technology	ENA first public:2024 12 19\|INSDC center name:Indian Institute of Technology Delhi Indraprastha Institute of Information Technology\|INSDC status:public\|Submitter Id:SAMIN0009438 Day 4 Replicate 2\|broker name:IBDC\|collection date:2022 12 23\|common name:zebrafish\|geographic location country and/or sea:India\|geographic location region and locality:New Delhi India\|sample name:SAMIN0009438 Day 4 Replicate 2\|scientific name:Danio rerio									From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration	From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration 9519	1	1	NaN		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000		ERP167301	Illumina NovaSeq 6000 paired end sequencing; From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration	ENA FIRST PUBLIC:2024 12 19\|ENA LAST UPDATE:2024 12 19	19141_4dpl3_R1.fastq.gz 19142_4dpl3_R2.fastq.gz	fastq fastq	9691702460.0	32091730.0	RUN From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration 9519	0:151 1:151	A:2791714294;C:1934967288;G:2210755028;T:2743302083;N:10963767	151	151		2791714294	1934967288	2210755028	2743302083	10963767	ERX13487658	ERS22622210	ERA31046065	Indian Biological Data Centre\|European Nucleotide Archive	Indian Biological Data Centre												B	B	biological fallback assumption	illumina	novaseq_era	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	India	2024-12-19	Undetermined	Undetermined	Brain	Nervous System
19503	19503	ERR14085269	ERX13487661	ERS22622317	ERP167301	PRJEB83711	From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration	inda-STUDY-IIT-Delhi,Indraprastha Institute of Information Technology Shilpi Minocha, KSBS, IIT-Delhi New Delhi,India-2024-12-18 14:20:14.533-243	Other	Regeneration of damaged brain tissue is a complex biological process that varies significantly across species. Zebrafish possess a remarkable ability to regenerate central nervous system structures making them an invaluable model for studying the molecular and cellular mechanisms underlying neuroregeneration. In this study we employed a previously standardized telencephalic stab wound injury model to investigate transcriptional and cellular responses during zebrafish brain regeneration. This well characterized model allows for precise analysis of injury induced regenerative processes by comparing different temporal stages of recovery. Using RNA sequencing at four key time points: control 1 day post lesion 4 dpl and 7 dpl we identified dynamic changes in gene expression and revealed critical signaling pathways associated with regeneration. Among these the p38 MAPK signaling cascade emerged as a key regulator. Our findings underscore the multifaceted role of p38 MAPK which modulates progenitor cell proliferation differentiation and neurogenesis during regeneration. These insights align with known roles of p38 MAPK in neural stem cell biology while highlighting its distinct contributions in a regenerative context. This work provides a comprehensive overview of early transcriptional events and highlights novel molecular players involved in CNS repair further establishing the zebrafish as a robust model for regenerative research. Our findings open avenues for applying these pathways to develop therapeutic strategies aimed at enhancing brain repair in humans.	ENA FIRST PUBLIC:2024 12 19\|ENA LAST UPDATE:2024 12 19		RNA seq Day 7 Replicate 2	Day 7 Replicate 2	SAMEA117549417	Indian Institute of Technology Delhi,Indraprastha Institute of Information Technology	ENA first public:2024 12 19\|INSDC center name:Indian Institute of Technology Delhi Indraprastha Institute of Information Technology\|INSDC status:public\|Submitter Id:SAMIN0009441 Day 7 Replicate 2\|broker name:IBDC\|collection date:2022 12 23\|common name:zebrafish\|geographic location country and/or sea:India\|geographic location region and locality:New Delhi India\|sample name:SAMIN0009441 Day 7 Replicate 2\|scientific name:Danio rerio									From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration	From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration 9522	1	1	NaN		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000		ERP167301	Illumina NovaSeq 6000 paired end sequencing; From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration	ENA FIRST PUBLIC:2024 12 19\|ENA LAST UPDATE:2024 12 19	19147_7dpl4_R1.fastq.gz 19148_7dpl4_R2.fastq.gz	fastq fastq	9862024420.0	32655710.0	RUN From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration 9522	0:151 1:151	A:2841799545;C:2048598598;G:2166200803;T:2794242657;N:11182817	151	151		2841799545	2048598598	2166200803	2794242657	11182817	ERX13487661	ERS22622317	ERA31046068	Indian Biological Data Centre\|European Nucleotide Archive	Indian Biological Data Centre												B	B	biological fallback assumption	illumina	novaseq_era	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	India	2024-12-19	Undetermined	Undetermined	Brain	Nervous System
19504	19504	ERR14085273	ERX13487665	ERS22622320	ERP167301	PRJEB83711	From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration	inda-STUDY-IIT-Delhi,Indraprastha Institute of Information Technology Shilpi Minocha, KSBS, IIT-Delhi New Delhi,India-2024-12-18 14:20:14.533-243	Other	Regeneration of damaged brain tissue is a complex biological process that varies significantly across species. Zebrafish possess a remarkable ability to regenerate central nervous system structures making them an invaluable model for studying the molecular and cellular mechanisms underlying neuroregeneration. In this study we employed a previously standardized telencephalic stab wound injury model to investigate transcriptional and cellular responses during zebrafish brain regeneration. This well characterized model allows for precise analysis of injury induced regenerative processes by comparing different temporal stages of recovery. Using RNA sequencing at four key time points: control 1 day post lesion 4 dpl and 7 dpl we identified dynamic changes in gene expression and revealed critical signaling pathways associated with regeneration. Among these the p38 MAPK signaling cascade emerged as a key regulator. Our findings underscore the multifaceted role of p38 MAPK which modulates progenitor cell proliferation differentiation and neurogenesis during regeneration. These insights align with known roles of p38 MAPK in neural stem cell biology while highlighting its distinct contributions in a regenerative context. This work provides a comprehensive overview of early transcriptional events and highlights novel molecular players involved in CNS repair further establishing the zebrafish as a robust model for regenerative research. Our findings open avenues for applying these pathways to develop therapeutic strategies aimed at enhancing brain repair in humans.	ENA FIRST PUBLIC:2024 12 19\|ENA LAST UPDATE:2024 12 19		RNA seq Control Replicate 2	Control Replicate 2	SAMEA117549420	Indian Institute of Technology Delhi,Indraprastha Institute of Information Technology	ENA first public:2024 12 19\|INSDC center name:Indian Institute of Technology Delhi Indraprastha Institute of Information Technology\|INSDC status:public\|Submitter Id:SAMIN0009444 Control Replicate 2\|broker name:IBDC\|collection date:2022 12 23\|common name:zebrafish\|geographic location country and/or sea:India\|geographic location region and locality:New Delhi India\|sample name:SAMIN0009444 Control Replicate 2\|scientific name:Danio rerio									From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration	From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration 9525	1	1	NaN		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000		ERP167301	Illumina NovaSeq 6000 paired end sequencing; From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration	ENA FIRST PUBLIC:2024 12 19\|ENA LAST UPDATE:2024 12 19	19153_C6_R1.fastq.gz 19154_C6_R2.fastq.gz	fastq fastq	11398526732.0	37743466.0	RUN From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration 9525	0:151 1:151	A:3315198872;C:2268180334;G:2561003095;T:3244771542;N:9372889	151	151		3315198872	2268180334	2561003095	3244771542	9372889	ERX13487665	ERS22622320	ERA31046072	Indian Biological Data Centre\|European Nucleotide Archive	Indian Biological Data Centre												B	B	biological fallback assumption	illumina	novaseq_era	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	India	2024-12-19	Undetermined	Undetermined	Brain	Nervous System
24927	24927	SRR25557778	SRX21286665	SRS18536778	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant XI	GSM7688794		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant XI	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688794	GSM7688794: Morphant XI; Danio rerio; RNA Seq	GSM7688794 r1	GSM7688794	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500		SRP453884		loader:fastq load.py	Morphant-XI_S7_L001_R1_001.fastq.gz	fastq	420092501.0	5668059.0	GSM7688794 r1	0:74.12	A:113006440;C:96725832;G:99320773;T:110915967;N:123489	74			113006440	96725832	99320773	110915967	123489	SRX21286665	SRS18536778	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94757		0.06229		0.72364		0.46676		74		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24928	24928	SRR25557779	SRX21286665	SRS18536778	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant XI	GSM7688794		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant XI	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688794	GSM7688794: Morphant XI; Danio rerio; RNA Seq	GSM7688794 r1	GSM7688794	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500		SRP453884		loader:fastq load.py	Morphant-XI_S7_L002_R1_001.fastq.gz	fastq	421869780.0	5690053.0	GSM7688794 r2	0:74.14	A:113530489;C:97144227;G:99697959;T:111388539;N:108566	74			113530489	97144227	99697959	111388539	108566	SRX21286665	SRS18536778	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94921		0.06226		0.72462		0.4738		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24929	24929	SRR25557780	SRX21286665	SRS18536778	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant XI	GSM7688794		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant XI	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688794	GSM7688794: Morphant XI; Danio rerio; RNA Seq	GSM7688794 r1	GSM7688794	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500		SRP453884		loader:fastq load.py	Morphant-XI_S7_L003_R1_001.fastq.gz	fastq	425064659.0	5734041.0	GSM7688794 r3	0:74.13	A:114342253;C:97873100;G:100532599;T:112196433;N:120274	74			114342253	97873100	100532599	112196433	120274	SRX21286665	SRS18536778	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94886		0.06112		0.72425		0.47055		74		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24930	24930	SRR25557781	SRX21286665	SRS18536778	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant XI	GSM7688794		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant XI	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688794	GSM7688794: Morphant XI; Danio rerio; RNA Seq	GSM7688794 r1	GSM7688794	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500		SRP453884		loader:fastq load.py	Morphant-XI_S7_L004_R1_001.fastq.gz	fastq	416990548.0	5624902.0	GSM7688794 r4	0:74.13	A:112153356;C:96009158;G:98613145;T:110097476;N:117413	74			112153356	96009158	98613145	110097476	117413	SRX21286665	SRS18536778	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94869		0.06229		0.72506		0.47222		74		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24931	24931	SRR25557782	SRX21286664	SRS18536777	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant X	GSM7688793		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant X	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688793	GSM7688793: Morphant X; Danio rerio; RNA Seq	GSM7688793 r1	GSM7688793	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500		SRP453884		loader:fastq load.py	Morphant-X_S6_L001_R1_001.fastq.gz	fastq	434485284.0	5881416.0	GSM7688793 r1	0:73.87	A:116640351;C:100176557;G:102659919;T:114799536;N:208921	73			116640351	100176557	102659919	114799536	208921	SRX21286664	SRS18536777	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94533		0.07176		0.72464		0.47632		74		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24932	24932	SRR25557783	SRX21286664	SRS18536777	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant X	GSM7688793		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant X	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688793	GSM7688793: Morphant X; Danio rerio; RNA Seq	GSM7688793 r1	GSM7688793	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500		SRP453884		loader:fastq load.py	Morphant-X_S6_L002_R1_001.fastq.gz	fastq	435203869.0	5886556.0	GSM7688793 r2	0:73.93	A:116869356;C:100363580;G:102830644;T:114973504;N:166785	73			116869356	100363580	102830644	114973504	166785	SRX21286664	SRS18536777	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94542		0.07203		0.72421		0.47733		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24933	24933	SRR25557784	SRX21286664	SRS18536777	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant X	GSM7688793		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant X	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688793	GSM7688793: Morphant X; Danio rerio; RNA Seq	GSM7688793 r1	GSM7688793	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500		SRP453884		loader:fastq load.py	Morphant-X_S6_L003_R1_001.fastq.gz	fastq	439897269.0	5951878.0	GSM7688793 r3	0:73.91	A:118101648;C:101426657;G:103990006;T:116184480;N:194478	73			118101648	101426657	103990006	116184480	194478	SRX21286664	SRS18536777	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94486		0.07224		0.72448		0.47915		74		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24934	24934	SRR25557785	SRX21286664	SRS18536777	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant X	GSM7688793		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant X	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688793	GSM7688793: Morphant X; Danio rerio; RNA Seq	GSM7688793 r1	GSM7688793	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500		SRP453884		loader:fastq load.py	Morphant-X_S6_L004_R1_001.fastq.gz	fastq	431385256.0	5836029.0	GSM7688793 r4	0:73.92	A:115804970;C:99459059;G:101962932;T:113975935;N:182360	73			115804970	99459059	101962932	113975935	182360	SRX21286664	SRS18536777	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94432		0.07229		0.7261		0.47463		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24935	24935	SRR25557786	SRX21286663	SRS18536776	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant IX	GSM7688792		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant IX	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688792	GSM7688792: Morphant IX; Danio rerio; RNA Seq	GSM7688792 r1	GSM7688792	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500		SRP453884		loader:fastq load.py	Morphant-IX_S16_L001_R1_001.fastq.gz	fastq	513309395.0	6929648.0	GSM7688792 r1	0:74.07	A:137428462;C:118688804;G:122019962;T:134991729;N:180438	74			137428462	118688804	122019962	134991729	180438	SRX21286663	SRS18536776	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94188		0.07029		0.73772		0.47692		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24936	24936	SRR25557787	SRX21286663	SRS18536776	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant IX	GSM7688792		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant IX	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688792	GSM7688792: Morphant IX; Danio rerio; RNA Seq	GSM7688792 r1	GSM7688792	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500		SRP453884		loader:fastq load.py	Morphant-IX_S16_L002_R1_001.fastq.gz	fastq	517356735.0	6982196.0	GSM7688792 r2	0:74.10	A:138524037;C:119650852;G:122965491;T:136056171;N:160184	74			138524037	119650852	122965491	136056171	160184	SRX21286663	SRS18536776	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94281		0.06967		0.73963		0.48142		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24937	24937	SRR25557788	SRX21286663	SRS18536776	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant IX	GSM7688792		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant IX	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688792	GSM7688792: Morphant IX; Danio rerio; RNA Seq	GSM7688792 r1	GSM7688792	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500		SRP453884		loader:fastq load.py	Morphant-IX_S16_L003_R1_001.fastq.gz	fastq	519422328.0	7010631.0	GSM7688792 r3	0:74.09	A:139040684;C:120128748;G:123529198;T:136551898;N:171800	74			139040684	120128748	123529198	136551898	171800	SRX21286663	SRS18536776	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94297		0.06942		0.73726		0.47499		74		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24938	24938	SRR25557789	SRX21286663	SRS18536776	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant IX	GSM7688792		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant IX	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688792	GSM7688792: Morphant IX; Danio rerio; RNA Seq	GSM7688792 r1	GSM7688792	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500		SRP453884		loader:fastq load.py	Morphant-IX_S16_L004_R1_001.fastq.gz	fastq	511640294.0	6905748.0	GSM7688792 r4	0:74.09	A:136914638;C:118302866;G:121704665;T:134543505;N:174620	74			136914638	118302866	121704665	134543505	174620	SRX21286663	SRS18536776	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94176		0.07029		0.73868		0.47987		74		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24939	24939	SRR25557790	SRX21286662	SRS18536775	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant VIII	GSM7688791		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant VIII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688791	GSM7688791: Morphant VIII; Danio rerio; RNA Seq	GSM7688791 r1	GSM7688791	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500		SRP453884		loader:fastq load.py	Morphant-VIII_S14_L001_R1_001.fastq.gz	fastq	429446821.0	5803178.0	GSM7688791 r1	0:74.00	A:114793535;C:99506379;G:102226914;T:112748761;N:171232	74			114793535	99506379	102226914	112748761	171232	SRX21286662	SRS18536775	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94175		0.06669		0.73673		0.48179		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24940	24940	SRR25557791	SRX21286662	SRS18536775	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant VIII	GSM7688791		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant VIII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688791	GSM7688791: Morphant VIII; Danio rerio; RNA Seq	GSM7688791 r1	GSM7688791	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500		SRP453884		loader:fastq load.py	Morphant-VIII_S14_L002_R1_001.fastq.gz	fastq	434629893.0	5870828.0	GSM7688791 r2	0:74.03	A:116216940;C:100703527;G:103463365;T:114092681;N:153380	74			116216940	100703527	103463365	114092681	153380	SRX21286662	SRS18536775	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94143		0.0676		0.73791		0.48091		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24941	24941	SRR25557792	SRX21286662	SRS18536775	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant VIII	GSM7688791		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant VIII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688791	GSM7688791: Morphant VIII; Danio rerio; RNA Seq	GSM7688791 r1	GSM7688791	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500		SRP453884		loader:fastq load.py	Morphant-VIII_S14_L003_R1_001.fastq.gz	fastq	435879881.0	5888685.0	GSM7688791 r3	0:74.02	A:116548094;C:100971153;G:103794902;T:114400770;N:164962	74			116548094	100971153	103794902	114400770	164962	SRX21286662	SRS18536775	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94195		0.06686		0.73785		0.48044		73		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24942	24942	SRR25557793	SRX21286662	SRS18536775	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520		Morphant VIII	GSM7688791		source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant VIII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688791	GSM7688791: Morphant VIII; Danio rerio; RNA Seq	GSM7688791 r1	GSM7688791	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500		SRP453884		loader:fastq load.py	Morphant-VIII_S14_L004_R1_001.fastq.gz	fastq	429478475.0	5801978.0	GSM7688791 r4	0:74.02	A:114799280;C:99474677;G:102302775;T:112737475;N:164268	74			114799280	99474677	102302775	112737475	164268	SRX21286662	SRS18536775	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94118		0.06706		0.73892		0.47732		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System

Advanced export

JSON shape: default, array, newline-delimited

CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;