run_metadata
693 rows where experiment.library_selection = "cDNA", experiment.library_source = "TRANSCRIPTOMIC" and tissue_curation = "Spinal Cord"
This data as json, CSV (advanced)
| Link | rowid ▼ | run.accession | experiment.accession | sample.accession | study.accession | bioproject | study.title | study.alias | study.type | study.abstract | study.attributes | study.PMIDs | sample.description | sample.title | sample.alias | sample.centername | sample.attributes | GEOsample.title | GEOsample.dataprocessing | GEOsample.source | GEOsample.treatmentprotocol | GEOsample.extractprotocol | GEOsample.growthprotocol | GEOsample.characteristics | GEOsample.accession | experiment.title | experiment.alias | experiment.library_name | experiment.design_description | experiment.library_construction_protocol | experiment.attributes | experiment.library_strategy | experiment.library_source | experiment.library_selection | experiment.library_layout | experiment.platform | experiment.instrument_model | experiment.spot_descriptor | experiment.study_ref | run.title | run.attributes | run.filename | run.semantic_name | run.total_bases | run.total_spots | run.alias | run.read_lengths | run.base_counts | run.r1_length | run.r2_length | run.r3_length | run.r4_length | run.Acount | run.Ccount | run.Gcount | run.Tcount | run.Ncount | run.experiment | run.pool_member | submission.accession | submission.srasource | submission.bioprojectsource | seqdetective.n_mates | seqdetective.mapping_rate.mate1 | seqdetective.mapping_rate.mate2 | seqdetective.nofeature_rate.mate1 | seqdetective.nofeature_rate.mate2 | seqdetective.sparsity.mate1 | seqdetective.sparsity.mate2 | seqdetective.pos_strand_rate.mate1 | seqdetective.pos_strand_rate.mate2 | seqdetective.readlen.mate1 | seqdetective.readlen.mate2 | seqdetective.judgement.mate1 | seqdetective.judgement.mate2 | seqdetective.judgement.reason | platform_family | instrument_generation | read_bias | selection_class | prep_kit | sc_or_bulk | tech_class | technology | tech_variant | submission.bioprojectsource.country | earliest_date | devstage_curation | devstage_curation_coarse | tissue_curation | tissue_curation_coarse |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 44 | 44 | DRR668250 | DRX648352 | DRS458865 | DRP012880 | PRJDB18466 | Comparison of spinal cord regeneration capacity in zebrafish and medaka | PRJDB18466 | Other | Unlike mammals zebrafish have the remarkable ability to regenerate many tissues including the spinal cord. Medaka another model fish species has a low regenerative ability in the spinal cord. Therefore comparisons with them advantageous to revealing regeneration specific mechanisms in the spinal cord. The comparison of the spinal cord regeneration abilities of zebrafish and medaka could be a promising research field to elucidate new factors that determine spinal cord regeneration ability. | pubmed:40278963 | Zebrafish 2 weeks post spinal cord injury replicate 3 | Zebrafish 2wpi 3 | SAMD00799623 | sample name:Zebrafish 2wpi 3|biological replicate:3|biomaterial provider:Center of Medical Innovation and Translational Research Osaka University|collection date:2023 04 25|dev stage:Adult|geo loc name:Japan|sex:not determined|strain:AB Zebrafish|tissue:Spinal cord | DNBSEQ G400 paired end sequencing of SAMD00799623 | DRX648352 | RNA seq of spinal cord in zebrafish at 2wpi injured 3 | 1 | Total RNA was extracted using RNeasy Micro Kit Qiagen 74104 with DNase treatment RNase Free DNase Set Qiagen 79254. Libraries were constructed from the amplified total RNA. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | DNBSEQ | DNBSEQ-G400 | DRP012880 | DNBSEQ G400 paired end sequencing of SAMD00799623 | 14782516800.0 | 73912584.0 | DRR668250 | 0:100 1:100 | A:4058090278;C:3335994894;G:3323563782;T:4062467903;N:2399943 | 100 | 100 | 4058090278 | 3335994894 | 3323563782 | 4062467903 | 2399943 | DRX648352 | DRS458865 | DRA020617 | Osaka University | Osaka University | B | B | biological fallback assumption | bgi | bgi | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | Japan | 2025-05-12 | Adult | Adult | Spinal Cord | Nervous System | |||||||||||||||||||||||||||||
| 45 | 45 | DRR668249 | DRX648351 | DRS458864 | DRP012880 | PRJDB18466 | Comparison of spinal cord regeneration capacity in zebrafish and medaka | PRJDB18466 | Other | Unlike mammals zebrafish have the remarkable ability to regenerate many tissues including the spinal cord. Medaka another model fish species has a low regenerative ability in the spinal cord. Therefore comparisons with them advantageous to revealing regeneration specific mechanisms in the spinal cord. The comparison of the spinal cord regeneration abilities of zebrafish and medaka could be a promising research field to elucidate new factors that determine spinal cord regeneration ability. | pubmed:40278963 | Zebrafish 2 weeks post spinal cord injury replicate 2 | Zebrafish 2wpi 2 | SAMD00799622 | sample name:Zebrafish 2wpi 2|biological replicate:2|biomaterial provider:Center of Medical Innovation and Translational Research Osaka University|collection date:2023 04 14|dev stage:Adult|geo loc name:Japan|sex:not determined|strain:AB Zebrafish|tissue:Spinal cord | DNBSEQ G400 paired end sequencing of SAMD00799622 | DRX648351 | RNA seq of spinal cord in zebrafish at 2wpi injured 2 | 1 | Total RNA was extracted using RNeasy Micro Kit Qiagen 74104 with DNase treatment RNase Free DNase Set Qiagen 79254. Libraries were constructed from the amplified total RNA. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | DNBSEQ | DNBSEQ-G400 | DRP012880 | DNBSEQ G400 paired end sequencing of SAMD00799622 | 13687641800.0 | 68438209.0 | DRR668249 | 0:100 1:100 | A:3759784620;C:3087398782;G:3083881581;T:3754378915;N:2197902 | 100 | 100 | 3759784620 | 3087398782 | 3083881581 | 3754378915 | 2197902 | DRX648351 | DRS458864 | DRA020617 | Osaka University | Osaka University | B | B | biological fallback assumption | bgi | bgi | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | Japan | 2025-05-12 | Adult | Adult | Spinal Cord | Nervous System | |||||||||||||||||||||||||||||
| 46 | 46 | DRR668248 | DRX648350 | DRS458863 | DRP012880 | PRJDB18466 | Comparison of spinal cord regeneration capacity in zebrafish and medaka | PRJDB18466 | Other | Unlike mammals zebrafish have the remarkable ability to regenerate many tissues including the spinal cord. Medaka another model fish species has a low regenerative ability in the spinal cord. Therefore comparisons with them advantageous to revealing regeneration specific mechanisms in the spinal cord. The comparison of the spinal cord regeneration abilities of zebrafish and medaka could be a promising research field to elucidate new factors that determine spinal cord regeneration ability. | pubmed:40278963 | Zebrafish 2 weeks post spinal cord injury replicate 1 | Zebrafish 2wpi 1 | SAMD00799621 | sample name:Zebrafish 2wpi 1|biological replicate:1|biomaterial provider:Center of Medical Innovation and Translational Research Osaka University|collection date:2023 04 14|dev stage:Adult|geo loc name:Japan|sex:not determined|strain:AB Zebrafish|tissue:Spinal cord | DNBSEQ G400 paired end sequencing of SAMD00799621 | DRX648350 | RNA seq of spinal cord in zebrafish at 2wpi injured 1 | 1 | Total RNA was extracted using RNeasy Micro Kit Qiagen 74104 with DNase treatment RNase Free DNase Set Qiagen 79254. Libraries were constructed from the amplified total RNA. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | DNBSEQ | DNBSEQ-G400 | DRP012880 | DNBSEQ G400 paired end sequencing of SAMD00799621 | 16376197200.0 | 81880986.0 | DRR668248 | 0:100 1:100 | A:4485868844;C:3700974430;G:3710833937;T:4475827800;N:2692189 | 100 | 100 | 4485868844 | 3700974430 | 3710833937 | 4475827800 | 2692189 | DRX648350 | DRS458863 | DRA020617 | Osaka University | Osaka University | B | B | biological fallback assumption | bgi | bgi | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | Japan | 2025-05-12 | Adult | Adult | Spinal Cord | Nervous System | |||||||||||||||||||||||||||||
| 47 | 47 | DRR668247 | DRX648349 | DRS458862 | DRP012880 | PRJDB18466 | Comparison of spinal cord regeneration capacity in zebrafish and medaka | PRJDB18466 | Other | Unlike mammals zebrafish have the remarkable ability to regenerate many tissues including the spinal cord. Medaka another model fish species has a low regenerative ability in the spinal cord. Therefore comparisons with them advantageous to revealing regeneration specific mechanisms in the spinal cord. The comparison of the spinal cord regeneration abilities of zebrafish and medaka could be a promising research field to elucidate new factors that determine spinal cord regeneration ability. | pubmed:40278963 | Zebrafish Intact biological replicate 3 | Zebrafish Control 3 | SAMD00799620 | sample name:Zebrafish Control 3|biological replicate:3|biomaterial provider:Center of Medical Innovation and Translational Research Osaka University|collection date:2023 04 21|dev stage:Adult|geo loc name:Japan|sex:not determined|strain:AB Zebrafish|tissue:Spinal cord | DNBSEQ G400 paired end sequencing of SAMD00799620 | DRX648349 | RNA seq of spinal cord in zebrafish at 0wpi control 3 | 1 | Total RNA was extracted using RNeasy Micro Kit Qiagen 74104 with DNase treatment RNase Free DNase Set Qiagen 79254. Libraries were constructed from the amplified total RNA. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | DNBSEQ | DNBSEQ-G400 | DRP012880 | DNBSEQ G400 paired end sequencing of SAMD00799620 | 13377538600.0 | 66887693.0 | DRR668247 | 0:100 1:100 | A:3725064764;C:2973653932;G:2980883214;T:3695767890;N:2168800 | 100 | 100 | 3725064764 | 2973653932 | 2980883214 | 3695767890 | 2168800 | DRX648349 | DRS458862 | DRA020617 | Osaka University | Osaka University | B | B | biological fallback assumption | bgi | bgi | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | Japan | 2025-05-12 | Adult | Adult | Spinal Cord | Nervous System | |||||||||||||||||||||||||||||
| 48 | 48 | DRR668246 | DRX648348 | DRS458861 | DRP012880 | PRJDB18466 | Comparison of spinal cord regeneration capacity in zebrafish and medaka | PRJDB18466 | Other | Unlike mammals zebrafish have the remarkable ability to regenerate many tissues including the spinal cord. Medaka another model fish species has a low regenerative ability in the spinal cord. Therefore comparisons with them advantageous to revealing regeneration specific mechanisms in the spinal cord. The comparison of the spinal cord regeneration abilities of zebrafish and medaka could be a promising research field to elucidate new factors that determine spinal cord regeneration ability. | pubmed:40278963 | Zebrafish Intact biological replicate 2 | Zebrafish Control 2 | SAMD00799619 | sample name:Zebrafish Control 2|biological replicate:2|biomaterial provider:Center of Medical Innovation and Translational Research Osaka University|collection date:2023 04 21|dev stage:Adult|geo loc name:Japan|sex:not determined|strain:AB Zebrafish|tissue:Spinal cord | DNBSEQ G400 paired end sequencing of SAMD00799619 | DRX648348 | RNA seq of spinal cord in zebrafish at 0wpi control 2 | 1 | Total RNA was extracted using RNeasy Micro Kit Qiagen 74104 with DNase treatment RNase Free DNase Set Qiagen 79254. Libraries were constructed from the amplified total RNA. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | DNBSEQ | DNBSEQ-G400 | DRP012880 | DNBSEQ G400 paired end sequencing of SAMD00799619 | 14971411400.0 | 74857057.0 | DRR668246 | 0:100 1:100 | A:4160326445;C:3329083037;G:3329123314;T:4150453700;N:2424904 | 100 | 100 | 4160326445 | 3329083037 | 3329123314 | 4150453700 | 2424904 | DRX648348 | DRS458861 | DRA020617 | Osaka University | Osaka University | B | B | biological fallback assumption | bgi | bgi | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | Japan | 2025-05-12 | Adult | Adult | Spinal Cord | Nervous System | |||||||||||||||||||||||||||||
| 49 | 49 | DRR668245 | DRX648347 | DRS458860 | DRP012880 | PRJDB18466 | Comparison of spinal cord regeneration capacity in zebrafish and medaka | PRJDB18466 | Other | Unlike mammals zebrafish have the remarkable ability to regenerate many tissues including the spinal cord. Medaka another model fish species has a low regenerative ability in the spinal cord. Therefore comparisons with them advantageous to revealing regeneration specific mechanisms in the spinal cord. The comparison of the spinal cord regeneration abilities of zebrafish and medaka could be a promising research field to elucidate new factors that determine spinal cord regeneration ability. | pubmed:40278963 | Zebrafish Intact biological replicate 1 | Zebrafish Control 1 | SAMD00799618 | sample name:Zebrafish Control 1|biological replicate:1|biomaterial provider:Center of Medical Innovation and Translational Research Osaka University|collection date:2024 05 04|dev stage:Adult|geo loc name:Japan|sex:not determined|strain:AB Zebrafish|tissue:Spinal cord | DNBSEQ G400 paired end sequencing of SAMD00799618 | DRX648347 | RNA seq of spinal cord in zebrafish at 0wpi control 1 | 1 | Total RNA was extracted using RNeasy Micro Kit Qiagen 74104 with DNase treatment RNase Free DNase Set Qiagen 79254. Libraries were constructed from the amplified total RNA. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | DNBSEQ | DNBSEQ-G400 | DRP012880 | DNBSEQ G400 paired end sequencing of SAMD00799618 | 13912523800.0 | 69562619.0 | DRR668245 | 0:100 1:100 | A:3888902049;C:3079617959;G:3075111814;T:3866655202;N:2236776 | 100 | 100 | 3888902049 | 3079617959 | 3075111814 | 3866655202 | 2236776 | DRX648347 | DRS458860 | DRA020617 | Osaka University | Osaka University | B | B | biological fallback assumption | bgi | bgi | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | Japan | 2025-05-12 | Adult | Adult | Spinal Cord | Nervous System | |||||||||||||||||||||||||||||
| 24927 | 24927 | SRR25557778 | SRX21286665 | SRS18536778 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant XI | GSM7688794 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant XI | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688794 | GSM7688794: Morphant XI; Danio rerio; RNA Seq | GSM7688794 r1 | GSM7688794 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-XI_S7_L001_R1_001.fastq.gz | fastq | 420092501.0 | 5668059.0 | GSM7688794 r1 | 0:74.12 | A:113006440;C:96725832;G:99320773;T:110915967;N:123489 | 74 | 113006440 | 96725832 | 99320773 | 110915967 | 123489 | SRX21286665 | SRS18536778 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94757 | 0.06229 | 0.72364 | 0.46676 | 74 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24928 | 24928 | SRR25557779 | SRX21286665 | SRS18536778 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant XI | GSM7688794 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant XI | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688794 | GSM7688794: Morphant XI; Danio rerio; RNA Seq | GSM7688794 r1 | GSM7688794 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-XI_S7_L002_R1_001.fastq.gz | fastq | 421869780.0 | 5690053.0 | GSM7688794 r2 | 0:74.14 | A:113530489;C:97144227;G:99697959;T:111388539;N:108566 | 74 | 113530489 | 97144227 | 99697959 | 111388539 | 108566 | SRX21286665 | SRS18536778 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94921 | 0.06226 | 0.72462 | 0.4738 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24929 | 24929 | SRR25557780 | SRX21286665 | SRS18536778 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant XI | GSM7688794 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant XI | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688794 | GSM7688794: Morphant XI; Danio rerio; RNA Seq | GSM7688794 r1 | GSM7688794 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-XI_S7_L003_R1_001.fastq.gz | fastq | 425064659.0 | 5734041.0 | GSM7688794 r3 | 0:74.13 | A:114342253;C:97873100;G:100532599;T:112196433;N:120274 | 74 | 114342253 | 97873100 | 100532599 | 112196433 | 120274 | SRX21286665 | SRS18536778 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94886 | 0.06112 | 0.72425 | 0.47055 | 74 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24930 | 24930 | SRR25557781 | SRX21286665 | SRS18536778 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant XI | GSM7688794 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant XI | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688794 | GSM7688794: Morphant XI; Danio rerio; RNA Seq | GSM7688794 r1 | GSM7688794 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-XI_S7_L004_R1_001.fastq.gz | fastq | 416990548.0 | 5624902.0 | GSM7688794 r4 | 0:74.13 | A:112153356;C:96009158;G:98613145;T:110097476;N:117413 | 74 | 112153356 | 96009158 | 98613145 | 110097476 | 117413 | SRX21286665 | SRS18536778 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94869 | 0.06229 | 0.72506 | 0.47222 | 74 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24931 | 24931 | SRR25557782 | SRX21286664 | SRS18536777 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant X | GSM7688793 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant X | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688793 | GSM7688793: Morphant X; Danio rerio; RNA Seq | GSM7688793 r1 | GSM7688793 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-X_S6_L001_R1_001.fastq.gz | fastq | 434485284.0 | 5881416.0 | GSM7688793 r1 | 0:73.87 | A:116640351;C:100176557;G:102659919;T:114799536;N:208921 | 73 | 116640351 | 100176557 | 102659919 | 114799536 | 208921 | SRX21286664 | SRS18536777 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94533 | 0.07176 | 0.72464 | 0.47632 | 74 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24932 | 24932 | SRR25557783 | SRX21286664 | SRS18536777 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant X | GSM7688793 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant X | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688793 | GSM7688793: Morphant X; Danio rerio; RNA Seq | GSM7688793 r1 | GSM7688793 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-X_S6_L002_R1_001.fastq.gz | fastq | 435203869.0 | 5886556.0 | GSM7688793 r2 | 0:73.93 | A:116869356;C:100363580;G:102830644;T:114973504;N:166785 | 73 | 116869356 | 100363580 | 102830644 | 114973504 | 166785 | SRX21286664 | SRS18536777 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94542 | 0.07203 | 0.72421 | 0.47733 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24933 | 24933 | SRR25557784 | SRX21286664 | SRS18536777 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant X | GSM7688793 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant X | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688793 | GSM7688793: Morphant X; Danio rerio; RNA Seq | GSM7688793 r1 | GSM7688793 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-X_S6_L003_R1_001.fastq.gz | fastq | 439897269.0 | 5951878.0 | GSM7688793 r3 | 0:73.91 | A:118101648;C:101426657;G:103990006;T:116184480;N:194478 | 73 | 118101648 | 101426657 | 103990006 | 116184480 | 194478 | SRX21286664 | SRS18536777 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94486 | 0.07224 | 0.72448 | 0.47915 | 74 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24934 | 24934 | SRR25557785 | SRX21286664 | SRS18536777 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant X | GSM7688793 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant X | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688793 | GSM7688793: Morphant X; Danio rerio; RNA Seq | GSM7688793 r1 | GSM7688793 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-X_S6_L004_R1_001.fastq.gz | fastq | 431385256.0 | 5836029.0 | GSM7688793 r4 | 0:73.92 | A:115804970;C:99459059;G:101962932;T:113975935;N:182360 | 73 | 115804970 | 99459059 | 101962932 | 113975935 | 182360 | SRX21286664 | SRS18536777 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94432 | 0.07229 | 0.7261 | 0.47463 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24935 | 24935 | SRR25557786 | SRX21286663 | SRS18536776 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant IX | GSM7688792 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant IX | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688792 | GSM7688792: Morphant IX; Danio rerio; RNA Seq | GSM7688792 r1 | GSM7688792 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-IX_S16_L001_R1_001.fastq.gz | fastq | 513309395.0 | 6929648.0 | GSM7688792 r1 | 0:74.07 | A:137428462;C:118688804;G:122019962;T:134991729;N:180438 | 74 | 137428462 | 118688804 | 122019962 | 134991729 | 180438 | SRX21286663 | SRS18536776 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94188 | 0.07029 | 0.73772 | 0.47692 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24936 | 24936 | SRR25557787 | SRX21286663 | SRS18536776 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant IX | GSM7688792 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant IX | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688792 | GSM7688792: Morphant IX; Danio rerio; RNA Seq | GSM7688792 r1 | GSM7688792 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-IX_S16_L002_R1_001.fastq.gz | fastq | 517356735.0 | 6982196.0 | GSM7688792 r2 | 0:74.10 | A:138524037;C:119650852;G:122965491;T:136056171;N:160184 | 74 | 138524037 | 119650852 | 122965491 | 136056171 | 160184 | SRX21286663 | SRS18536776 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94281 | 0.06967 | 0.73963 | 0.48142 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24937 | 24937 | SRR25557788 | SRX21286663 | SRS18536776 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant IX | GSM7688792 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant IX | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688792 | GSM7688792: Morphant IX; Danio rerio; RNA Seq | GSM7688792 r1 | GSM7688792 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-IX_S16_L003_R1_001.fastq.gz | fastq | 519422328.0 | 7010631.0 | GSM7688792 r3 | 0:74.09 | A:139040684;C:120128748;G:123529198;T:136551898;N:171800 | 74 | 139040684 | 120128748 | 123529198 | 136551898 | 171800 | SRX21286663 | SRS18536776 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94297 | 0.06942 | 0.73726 | 0.47499 | 74 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24938 | 24938 | SRR25557789 | SRX21286663 | SRS18536776 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant IX | GSM7688792 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant IX | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688792 | GSM7688792: Morphant IX; Danio rerio; RNA Seq | GSM7688792 r1 | GSM7688792 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-IX_S16_L004_R1_001.fastq.gz | fastq | 511640294.0 | 6905748.0 | GSM7688792 r4 | 0:74.09 | A:136914638;C:118302866;G:121704665;T:134543505;N:174620 | 74 | 136914638 | 118302866 | 121704665 | 134543505 | 174620 | SRX21286663 | SRS18536776 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94176 | 0.07029 | 0.73868 | 0.47987 | 74 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24939 | 24939 | SRR25557790 | SRX21286662 | SRS18536775 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant VIII | GSM7688791 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant VIII | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688791 | GSM7688791: Morphant VIII; Danio rerio; RNA Seq | GSM7688791 r1 | GSM7688791 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-VIII_S14_L001_R1_001.fastq.gz | fastq | 429446821.0 | 5803178.0 | GSM7688791 r1 | 0:74.00 | A:114793535;C:99506379;G:102226914;T:112748761;N:171232 | 74 | 114793535 | 99506379 | 102226914 | 112748761 | 171232 | SRX21286662 | SRS18536775 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94175 | 0.06669 | 0.73673 | 0.48179 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24940 | 24940 | SRR25557791 | SRX21286662 | SRS18536775 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant VIII | GSM7688791 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant VIII | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688791 | GSM7688791: Morphant VIII; Danio rerio; RNA Seq | GSM7688791 r1 | GSM7688791 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-VIII_S14_L002_R1_001.fastq.gz | fastq | 434629893.0 | 5870828.0 | GSM7688791 r2 | 0:74.03 | A:116216940;C:100703527;G:103463365;T:114092681;N:153380 | 74 | 116216940 | 100703527 | 103463365 | 114092681 | 153380 | SRX21286662 | SRS18536775 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94143 | 0.0676 | 0.73791 | 0.48091 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24941 | 24941 | SRR25557792 | SRX21286662 | SRS18536775 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant VIII | GSM7688791 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant VIII | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688791 | GSM7688791: Morphant VIII; Danio rerio; RNA Seq | GSM7688791 r1 | GSM7688791 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-VIII_S14_L003_R1_001.fastq.gz | fastq | 435879881.0 | 5888685.0 | GSM7688791 r3 | 0:74.02 | A:116548094;C:100971153;G:103794902;T:114400770;N:164962 | 74 | 116548094 | 100971153 | 103794902 | 114400770 | 164962 | SRX21286662 | SRS18536775 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94195 | 0.06686 | 0.73785 | 0.48044 | 73 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24942 | 24942 | SRR25557793 | SRX21286662 | SRS18536775 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant VIII | GSM7688791 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant VIII | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688791 | GSM7688791: Morphant VIII; Danio rerio; RNA Seq | GSM7688791 r1 | GSM7688791 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-VIII_S14_L004_R1_001.fastq.gz | fastq | 429478475.0 | 5801978.0 | GSM7688791 r4 | 0:74.02 | A:114799280;C:99474677;G:102302775;T:112737475;N:164268 | 74 | 114799280 | 99474677 | 102302775 | 112737475 | 164268 | SRX21286662 | SRS18536775 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94118 | 0.06706 | 0.73892 | 0.47732 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24943 | 24943 | SRR25557794 | SRX21286661 | SRS18536774 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant VII | GSM7688790 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant VII | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688790 | GSM7688790: Morphant VII; Danio rerio; RNA Seq | GSM7688790 r1 | GSM7688790 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-VII_S15_L001_R1_001.fastq.gz | fastq | 459545188.0 | 6215897.0 | GSM7688790 r1 | 0:73.93 | A:121926568;C:107379723;G:110263606;T:119766429;N:208862 | 73 | 121926568 | 107379723 | 110263606 | 119766429 | 208862 | SRX21286661 | SRS18536774 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94273 | 0.06072 | 0.74582 | 0.47499 | 73 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24944 | 24944 | SRR25557795 | SRX21286661 | SRS18536774 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant VII | GSM7688790 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant VII | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688790 | GSM7688790: Morphant VII; Danio rerio; RNA Seq | GSM7688790 r1 | GSM7688790 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-VII_S15_L002_R1_001.fastq.gz | fastq | 463143624.0 | 6261406.0 | GSM7688790 r2 | 0:73.97 | A:122917997;C:108229793;G:111099867;T:120713978;N:181989 | 73 | 122917997 | 108229793 | 111099867 | 120713978 | 181989 | SRX21286661 | SRS18536774 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94387 | 0.06093 | 0.74341 | 0.47351 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24945 | 24945 | SRR25557796 | SRX21286661 | SRS18536774 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant VII | GSM7688790 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant VII | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688790 | GSM7688790: Morphant VII; Danio rerio; RNA Seq | GSM7688790 r1 | GSM7688790 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-VII_S15_L003_R1_001.fastq.gz | fastq | 465959664.0 | 6300929.0 | GSM7688790 r3 | 0:73.95 | A:123689364;C:108847593;G:111847868;T:121377463;N:197376 | 73 | 123689364 | 108847593 | 111847868 | 121377463 | 197376 | SRX21286661 | SRS18536774 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94322 | 0.06219 | 0.74357 | 0.47977 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24946 | 24946 | SRR25557797 | SRX21286661 | SRS18536774 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Morphant VII | GSM7688790 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing | Morphant VII | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant | GSM7688790 | GSM7688790: Morphant VII; Danio rerio; RNA Seq | GSM7688790 r1 | GSM7688790 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Morphant-VII_S15_L004_R1_001.fastq.gz | fastq | 459075430.0 | 6207363.0 | GSM7688790 r4 | 0:73.96 | A:121797426;C:107221116;G:110209684;T:119657308;N:189896 | 73 | 121797426 | 107221116 | 110209684 | 119657308 | 189896 | SRX21286661 | SRS18536774 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94313 | 0.06211 | 0.74343 | 0.47801 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24947 | 24947 | SRR25557798 | SRX21286660 | SRS18536773 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control XI | GSM7688787 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control XI | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688787 | GSM7688787: Control XI; Danio rerio; RNA Seq | GSM7688787 r1 | GSM7688787 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-XI_S2_L001_R1_001.fastq.gz | fastq | 439719566.0 | 5947052.0 | GSM7688787 r1 | 0:73.94 | A:117482073;C:102083665;G:104685444;T:115272860;N:195524 | 73 | 117482073 | 102083665 | 104685444 | 115272860 | 195524 | SRX21286660 | SRS18536773 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94829 | 0.06278 | 0.72525 | 0.46494 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24948 | 24948 | SRR25557799 | SRX21286660 | SRS18536773 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control XI | GSM7688787 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control XI | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688787 | GSM7688787: Control XI; Danio rerio; RNA Seq | GSM7688787 r1 | GSM7688787 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-XI_S2_L002_R1_001.fastq.gz | fastq | 438533503.0 | 5927990.0 | GSM7688787 r2 | 0:73.98 | A:117199594;C:101810881;G:104402169;T:114946611;N:174248 | 73 | 117199594 | 101810881 | 104402169 | 114946611 | 174248 | SRX21286660 | SRS18536773 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94887 | 0.06387 | 0.72827 | 0.46616 | 74 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24949 | 24949 | SRR25557800 | SRX21286660 | SRS18536773 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control XI | GSM7688787 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control XI | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688787 | GSM7688787: Control XI; Danio rerio; RNA Seq | GSM7688787 r1 | GSM7688787 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-XI_S2_L003_R1_001.fastq.gz | fastq | 443995554.0 | 6003540.0 | GSM7688787 r3 | 0:73.96 | A:118663936;C:103031716;G:105723574;T:116387834;N:188494 | 73 | 118663936 | 103031716 | 105723574 | 116387834 | 188494 | SRX21286660 | SRS18536773 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94788 | 0.06232 | 0.72693 | 0.46653 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24950 | 24950 | SRR25557801 | SRX21286660 | SRS18536773 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control XI | GSM7688787 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control XI | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688787 | GSM7688787: Control XI; Danio rerio; RNA Seq | GSM7688787 r1 | GSM7688787 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-XI_S2_L004_R1_001.fastq.gz | fastq | 435088869.0 | 5882642.0 | GSM7688787 r4 | 0:73.96 | A:116261447;C:100986653;G:103615584;T:114042354;N:182831 | 73 | 116261447 | 100986653 | 103615584 | 114042354 | 182831 | SRX21286660 | SRS18536773 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94914 | 0.06241 | 0.72829 | 0.4546 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24951 | 24951 | SRR25557802 | SRX21286659 | SRS18536772 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control X | GSM7688785 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control X | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688785 | GSM7688785: Control X; Danio rerio; RNA Seq | GSM7688785 r1 | GSM7688785 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-X_S1_L001_R1_001.fastq.gz | fastq | 395130702.0 | 5338263.0 | GSM7688785 r1 | 0:74.02 | A:107005793;C:90183031;G:92316770;T:105476481;N:148627 | 74 | 107005793 | 90183031 | 92316770 | 105476481 | 148627 | SRX21286659 | SRS18536772 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94534 | 0.07625 | 0.73888 | 0.48135 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24952 | 24952 | SRR25557803 | SRX21286659 | SRS18536772 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control X | GSM7688785 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control X | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688785 | GSM7688785: Control X; Danio rerio; RNA Seq | GSM7688785 r1 | GSM7688785 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-X_S1_L002_R1_001.fastq.gz | fastq | 396764458.0 | 5358448.0 | GSM7688785 r2 | 0:74.04 | A:107513717;C:90540282;G:92658504;T:105917444;N:134511 | 74 | 107513717 | 90540282 | 92658504 | 105917444 | 134511 | SRX21286659 | SRS18536772 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94374 | 0.07709 | 0.73878 | 0.47615 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24953 | 24953 | SRR25557804 | SRX21286659 | SRS18536772 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control X | GSM7688785 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control X | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688785 | GSM7688785: Control X; Danio rerio; RNA Seq | GSM7688785 r1 | GSM7688785 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-X_S1_L003_R1_001.fastq.gz | fastq | 399623551.0 | 5397520.0 | GSM7688785 r3 | 0:74.04 | A:108230540;C:91192011;G:93388052;T:106665106;N:147842 | 74 | 108230540 | 91192011 | 93388052 | 106665106 | 147842 | SRX21286659 | SRS18536772 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94399 | 0.07657 | 0.73797 | 0.4794 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24954 | 24954 | SRR25557805 | SRX21286659 | SRS18536772 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control X | GSM7688785 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control X | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688785 | GSM7688785: Control X; Danio rerio; RNA Seq | GSM7688785 r1 | GSM7688785 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-X_S1_L004_R1_001.fastq.gz | fastq | 393298978.0 | 5312101.0 | GSM7688785 r4 | 0:74.04 | A:106518845;C:89734564;G:91901232;T:105004490;N:139847 | 74 | 106518845 | 89734564 | 91901232 | 105004490 | 139847 | SRX21286659 | SRS18536772 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94423 | 0.07599 | 0.73884 | 0.47905 | 71 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24955 | 24955 | SRR25557806 | SRX21286658 | SRS18536771 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control IX | GSM7688783 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control IX | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688783 | GSM7688783: Control IX; Danio rerio; RNA Seq | GSM7688783 r1 | GSM7688783 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-IX_S22_L001_R1_001.fastq.gz | fastq | 366045799.0 | 4944832.0 | GSM7688783 r1 | 0:74.03 | A:98000119;C:84654222;G:86951226;T:96295351;N:144881 | 74 | 98000119 | 84654222 | 86951226 | 96295351 | 144881 | SRX21286658 | SRS18536771 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94303 | 0.07499 | 0.73085 | 0.47881 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24956 | 24956 | SRR25557807 | SRX21286658 | SRS18536771 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control IX | GSM7688783 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control IX | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688783 | GSM7688783: Control IX; Danio rerio; RNA Seq | GSM7688783 r1 | GSM7688783 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-IX_S22_L002_R1_001.fastq.gz | fastq | 369429068.0 | 4988719.0 | GSM7688783 r2 | 0:74.05 | A:98907882;C:85446993;G:87729593;T:97216477;N:128123 | 74 | 98907882 | 85446993 | 87729593 | 97216477 | 128123 | SRX21286658 | SRS18536771 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94261 | 0.07335 | 0.72969 | 0.47867 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24957 | 24957 | SRR25557808 | SRX21286658 | SRS18536771 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control IX | GSM7688783 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control IX | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688783 | GSM7688783: Control IX; Danio rerio; RNA Seq | GSM7688783 r1 | GSM7688783 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-IX_S22_L003_R1_001.fastq.gz | fastq | 369967330.0 | 4996710.0 | GSM7688783 r3 | 0:74.04 | A:99035743;C:85549878;G:87926587;T:97310812;N:144310 | 74 | 99035743 | 85549878 | 87926587 | 97310812 | 144310 | SRX21286658 | SRS18536771 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94328 | 0.0743 | 0.73034 | 0.47133 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24958 | 24958 | SRR25557809 | SRX21286658 | SRS18536771 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control IX | GSM7688783 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control IX | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688783 | GSM7688783: Control IX; Danio rerio; RNA Seq | GSM7688783 r1 | GSM7688783 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-IX_S22_L004_R1_001.fastq.gz | fastq | 365499176.0 | 4936305.0 | GSM7688783 r4 | 0:74.04 | A:97825658;C:84517732;G:86863655;T:96157429;N:134702 | 74 | 97825658 | 84517732 | 86863655 | 96157429 | 134702 | SRX21286658 | SRS18536771 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94286 | 0.07288 | 0.72999 | 0.4783 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24959 | 24959 | SRR25557810 | SRX21286657 | SRS18536770 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control VIII | GSM7688782 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control VIII | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688782 | GSM7688782: Control VIII; Danio rerio; RNA Seq | GSM7688782 r1 | GSM7688782 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-VIII_S20_L001_R1_001.fastq.gz | fastq | 488585907.0 | 6585668.0 | GSM7688782 r1 | 0:74.19 | A:131727468;C:112349971;G:115189425;T:129203159;N:115884 | 74 | 131727468 | 112349971 | 115189425 | 129203159 | 115884 | SRX21286657 | SRS18536770 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.93794 | 0.07381 | 0.7315 | 0.47355 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24960 | 24960 | SRR25557811 | SRX21286657 | SRS18536770 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control VIII | GSM7688782 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control VIII | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688782 | GSM7688782: Control VIII; Danio rerio; RNA Seq | GSM7688782 r1 | GSM7688782 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-VIII_S20_L002_R1_001.fastq.gz | fastq | 493766544.0 | 6653820.0 | GSM7688782 r2 | 0:74.21 | A:133135166;C:113551418;G:116398455;T:130575771;N:105734 | 74 | 133135166 | 113551418 | 116398455 | 130575771 | 105734 | SRX21286657 | SRS18536770 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.93729 | 0.07312 | 0.7307 | 0.47966 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24961 | 24961 | SRR25557812 | SRX21286657 | SRS18536770 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control VIII | GSM7688782 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control VIII | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688782 | GSM7688782: Control VIII; Danio rerio; RNA Seq | GSM7688782 r1 | GSM7688782 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-VIII_S20_L003_R1_001.fastq.gz | fastq | 494935071.0 | 6670024.0 | GSM7688782 r3 | 0:74.20 | A:133406912;C:113769494;G:116771560;T:130871612;N:115493 | 74 | 133406912 | 113769494 | 116771560 | 130871612 | 115493 | SRX21286657 | SRS18536770 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.93847 | 0.07383 | 0.73194 | 0.47646 | 74 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24962 | 24962 | SRR25557813 | SRX21286657 | SRS18536770 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control VIII | GSM7688782 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control VIII | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688782 | GSM7688782: Control VIII; Danio rerio; RNA Seq | GSM7688782 r1 | GSM7688782 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-VIII_S20_L004_R1_001.fastq.gz | fastq | 487644286.0 | 6572100.0 | GSM7688782 r4 | 0:74.20 | A:131423055;C:112092623;G:115067911;T:128945959;N:114738 | 74 | 131423055 | 112092623 | 115067911 | 128945959 | 114738 | SRX21286657 | SRS18536770 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.93708 | 0.0732 | 0.73186 | 0.4781 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24963 | 24963 | SRR25557814 | SRX21286656 | SRS18536769 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control VII | GSM7688781 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control VII | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688781 | GSM7688781: Control VII; Danio rerio; RNA Seq | GSM7688781 r1 | GSM7688781 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-VII_S21_L001_R1_001.fastq.gz | fastq | 419048369.0 | 5664168.0 | GSM7688781 r1 | 0:73.98 | A:111569757;C:97553687;G:100228004;T:109523480;N:173441 | 73 | 111569757 | 97553687 | 100228004 | 109523480 | 173441 | SRX21286656 | SRS18536769 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94179 | 0.06596 | 0.74499 | 0.46809 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24964 | 24964 | SRR25557815 | SRX21286656 | SRS18536769 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control VII | GSM7688781 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control VII | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688781 | GSM7688781: Control VII; Danio rerio; RNA Seq | GSM7688781 r1 | GSM7688781 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-VII_S21_L002_R1_001.fastq.gz | fastq | 422419362.0 | 5707444.0 | GSM7688781 r2 | 0:74.01 | A:112476977;C:98366185;G:101046586;T:110369882;N:159732 | 74 | 112476977 | 98366185 | 101046586 | 110369882 | 159732 | SRX21286656 | SRS18536769 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94275 | 0.06539 | 0.74523 | 0.47247 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24965 | 24965 | SRR25557816 | SRX21286656 | SRS18536769 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control VII | GSM7688781 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control VII | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688781 | GSM7688781: Control VII; Danio rerio; RNA Seq | GSM7688781 r1 | GSM7688781 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-VII_S21_L003_R1_001.fastq.gz | fastq | 424260551.0 | 5733133.0 | GSM7688781 r3 | 0:74.00 | A:112957538;C:98789480;G:101496747;T:110850186;N:166600 | 74 | 112957538 | 98789480 | 101496747 | 110850186 | 166600 | SRX21286656 | SRS18536769 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94174 | 0.06482 | 0.74304 | 0.46935 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 24966 | 24966 | SRR25557817 | SRX21286656 | SRS18536769 | SRP453884 | PRJNA1003026 | Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] | GSE240238 | Transcriptome Analysis | Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… | parent bioproject:PRJNA1003022 | pubmed:38017520 | Control VII | GSM7688781 | source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing | Control VII | We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. | Spinal Cord | The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. | tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control | GSM7688781 | GSM7688781: Control VII; Danio rerio; RNA Seq | GSM7688781 r1 | GSM7688781 | 1 | Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP453884 | loader:fastq load.py | Control-VII_S21_L004_R1_001.fastq.gz | fastq | 417875320.0 | 5646817.0 | GSM7688781 r4 | 0:74.00 | A:111226895;C:97273168;G:100030641;T:109182520;N:162096 | 74 | 111226895 | 97273168 | 100030641 | 109182520 | 162096 | SRX21286656 | SRS18536769 | SRA1688461 | Lewis Lab, Biology, Syracuse University | Lewis Lab, Biology, Syracuse University | 1 | 0.94352 | 0.06524 | 0.74442 | 0.47095 | 74 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United States | 2023-08-07 | Multi-stage | Embryo | Spinal Cord | Nervous System | |||||||||||||||
| 40356 | 40356 | SRR3109810 | SRX1538264 | SRS1254843 | SRP068656 | PRJNA309293 | RNA sequencing of adult zebrafish spinal cord | GSE77025 | Transcriptome Analysis | The goal of this study is to determine gene expression changes in the adult zebrafish spinal cord at 2 weeks post complete transection. Overall design: 2 samples were analyzed in duplicates: sham injured spinal cord and transected spinal cord at 2 xxx post injury | pubmed:27811277 | transected spinal cord b | GSM2042684 | source name:spinal cord transected 2 xxx post injury|age:6 month|tissue:spinal cord|tratment:2 weeks post transection injury | transected spinal cord b | Quality QC using Fastx Trimming of adapters and short sequences using Fastx Mapping using Bowtie2 Assembly using Cufflinks Quantification using Cuffdiff Genome build: zebrafish Zv9 genome Supplementary files format and content: gene exp.diff file includes gene expression data of injured spinal cord tissue relative to sham injured control tissue | spinal cord transected 2 xxx post injury | Animals underwent complete cervical spinal cord transection and spinal cord tissue was collected 2 xxx post injury. Control animals were sham injured and spinal cord was collected at 2 wks post sham. | RNA was extracted with Trizol reagent followed by clean up and DNase I treatment with QIAGEN RNeasy mini kit in accordance with the prescribed protocol provided with the kit. Quality control was performed with Agilent Bioanalyser. TruSeq libraries were constructed according to manufacturer's instructions | Adult 6 mpf wild type zebrafish were used for this study | age:6 month|tissue:spinal cord|tratment:2 weeks post transection injury | GSM2042684 | GSM2042684: transected spinal cord b; Danio rerio; RNA Seq | GSM2042684 | 1 | RNA was extracted with Trizol reagent followed by clean up and DNase I treatment with QIAGEN RNeasy mini kit in accordance with the prescribed protocol provided with the kit. Quality control was performed with Agilent Bioanalyser. TruSeq libraries were constructed according to manufacturer's instructions | GEO Accession:GSM2042684 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP068656 | Sample_mm4b.bam | bam | 1171337622.0 | 23961004.0 | GSM2042684 r1 | 0:48.89 | A:316224903;C:272433131;G:255385026;T:327251225;N:43337 | 48 | 316224903 | 272433131 | 255385026 | 327251225 | 43337 | SRX1538264 | SRS1254843 | SRA336740 | GEO | Ken Poss Lab, Cell Biology, Duke University Medical Center | 1 | 0.95542 | 0.0725 | 0.68816 | 0.45919 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | bulk | unknown | unknown | United States | 2016-01-20 | Adult | Adult | Spinal Cord | Nervous System | |||||||||||||||||
| 40357 | 40357 | SRR3109809 | SRX1538263 | SRS1254842 | SRP068656 | PRJNA309293 | RNA sequencing of adult zebrafish spinal cord | GSE77025 | Transcriptome Analysis | The goal of this study is to determine gene expression changes in the adult zebrafish spinal cord at 2 weeks post complete transection. Overall design: 2 samples were analyzed in duplicates: sham injured spinal cord and transected spinal cord at 2 xxx post injury | pubmed:27811277 | transected spinal cord a | GSM2042683 | source name:spinal cord transected 2 xxx post injury|age:6 month|tissue:spinal cord|tratment:2 weeks post transection injury | transected spinal cord a | Quality QC using Fastx Trimming of adapters and short sequences using Fastx Mapping using Bowtie2 Assembly using Cufflinks Quantification using Cuffdiff Genome build: zebrafish Zv9 genome Supplementary files format and content: gene exp.diff file includes gene expression data of injured spinal cord tissue relative to sham injured control tissue | spinal cord transected 2 xxx post injury | Animals underwent complete cervical spinal cord transection and spinal cord tissue was collected 2 xxx post injury. Control animals were sham injured and spinal cord was collected at 2 wks post sham. | RNA was extracted with Trizol reagent followed by clean up and DNase I treatment with QIAGEN RNeasy mini kit in accordance with the prescribed protocol provided with the kit. Quality control was performed with Agilent Bioanalyser. TruSeq libraries were constructed according to manufacturer's instructions | Adult 6 mpf wild type zebrafish were used for this study | age:6 month|tissue:spinal cord|tratment:2 weeks post transection injury | GSM2042683 | GSM2042683: transected spinal cord a; Danio rerio; RNA Seq | GSM2042683 | 1 | RNA was extracted with Trizol reagent followed by clean up and DNase I treatment with QIAGEN RNeasy mini kit in accordance with the prescribed protocol provided with the kit. Quality control was performed with Agilent Bioanalyser. TruSeq libraries were constructed according to manufacturer's instructions | GEO Accession:GSM2042683 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP068656 | Sample_mm4a.bam | bam | 906559320.0 | 18557265.0 | GSM2042683 r1 | SRX1538263 | SRS1254842 | SRA336740 | GEO | Ken Poss Lab, Cell Biology, Duke University Medical Center | 1 | 0.9696 | 0.06993 | 0.68913 | 0.4662 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | bulk | unknown | unknown | United States | 2016-01-20 | Adult | Adult | Spinal Cord | Nervous System | |||||||||||||||||||||||||
| 40358 | 40358 | SRR3109808 | SRX1538262 | SRS1254844 | SRP068656 | PRJNA309293 | RNA sequencing of adult zebrafish spinal cord | GSE77025 | Transcriptome Analysis | The goal of this study is to determine gene expression changes in the adult zebrafish spinal cord at 2 weeks post complete transection. Overall design: 2 samples were analyzed in duplicates: sham injured spinal cord and transected spinal cord at 2 xxx post injury | pubmed:27811277 | sham spinal cord b | GSM2042682 | source name:spinal cord sham control 2 wks post sham|age:6 month|tissue:spinal cord|tratment:2 wks post sham injury | sham spinal cord b | Quality QC using Fastx Trimming of adapters and short sequences using Fastx Mapping using Bowtie2 Assembly using Cufflinks Quantification using Cuffdiff Genome build: zebrafish Zv9 genome Supplementary files format and content: gene exp.diff file includes gene expression data of injured spinal cord tissue relative to sham injured control tissue | spinal cord sham control 2 wks post sham | Animals underwent complete cervical spinal cord transection and spinal cord tissue was collected 2 xxx post injury. Control animals were sham injured and spinal cord was collected at 2 wks post sham. | RNA was extracted with Trizol reagent followed by clean up and DNase I treatment with QIAGEN RNeasy mini kit in accordance with the prescribed protocol provided with the kit. Quality control was performed with Agilent Bioanalyser. TruSeq libraries were constructed according to manufacturer's instructions | Adult 6 mpf wild type zebrafish were used for this study | age:6 month|tissue:spinal cord|tratment:2 wks post sham injury | GSM2042682 | GSM2042682: sham spinal cord b; Danio rerio; RNA Seq | GSM2042682 | 1 | RNA was extracted with Trizol reagent followed by clean up and DNase I treatment with QIAGEN RNeasy mini kit in accordance with the prescribed protocol provided with the kit. Quality control was performed with Agilent Bioanalyser. TruSeq libraries were constructed according to manufacturer's instructions | GEO Accession:GSM2042682 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP068656 | Sample_mm2b.bam | bam | 976598317.0 | 19979953.0 | GSM2042682 r1 | 0:48.88 | A:269123614;C:222873099;G:208746430;T:275819417;N:35757 | 48 | 269123614 | 222873099 | 208746430 | 275819417 | 35757 | SRX1538262 | SRS1254844 | SRA336740 | GEO | Ken Poss Lab, Cell Biology, Duke University Medical Center | 1 | 0.95785 | 0.09352 | 0.71433 | 0.48637 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | bulk | unknown | unknown | United States | 2016-01-20 | Adult | Adult | Spinal Cord | Nervous System | |||||||||||||||||
| 40359 | 40359 | SRR3109807 | SRX1538261 | SRS1254845 | SRP068656 | PRJNA309293 | RNA sequencing of adult zebrafish spinal cord | GSE77025 | Transcriptome Analysis | The goal of this study is to determine gene expression changes in the adult zebrafish spinal cord at 2 weeks post complete transection. Overall design: 2 samples were analyzed in duplicates: sham injured spinal cord and transected spinal cord at 2 xxx post injury | pubmed:27811277 | sham spinal cord a | GSM2042681 | source name:spinal cord sham control 2 wks post sham|age:6 month|tissue:spinal cord|tratment:2 wks post sham injury | sham spinal cord a | Quality QC using Fastx Trimming of adapters and short sequences using Fastx Mapping using Bowtie2 Assembly using Cufflinks Quantification using Cuffdiff Genome build: zebrafish Zv9 genome Supplementary files format and content: gene exp.diff file includes gene expression data of injured spinal cord tissue relative to sham injured control tissue | spinal cord sham control 2 wks post sham | Animals underwent complete cervical spinal cord transection and spinal cord tissue was collected 2 xxx post injury. Control animals were sham injured and spinal cord was collected at 2 wks post sham. | RNA was extracted with Trizol reagent followed by clean up and DNase I treatment with QIAGEN RNeasy mini kit in accordance with the prescribed protocol provided with the kit. Quality control was performed with Agilent Bioanalyser. TruSeq libraries were constructed according to manufacturer's instructions | Adult 6 mpf wild type zebrafish were used for this study | age:6 month|tissue:spinal cord|tratment:2 wks post sham injury | GSM2042681 | GSM2042681: sham spinal cord a; Danio rerio; RNA Seq | GSM2042681 | 1 | RNA was extracted with Trizol reagent followed by clean up and DNase I treatment with QIAGEN RNeasy mini kit in accordance with the prescribed protocol provided with the kit. Quality control was performed with Agilent Bioanalyser. TruSeq libraries were constructed according to manufacturer's instructions | GEO Accession:GSM2042681 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP068656 | Sample_mm2a.bam | bam | 1576837523.0 | 32234481.0 | GSM2042681 r1 | 0:48.92 | A:437851706;C:356136709;G:337965564;T:444822016;N:61528 | 48 | 437851706 | 356136709 | 337965564 | 444822016 | 61528 | SRX1538261 | SRS1254845 | SRA336740 | GEO | Ken Poss Lab, Cell Biology, Duke University Medical Center | 1 | 0.95904 | 0.09551 | 0.71486 | 0.48699 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | bulk | unknown | unknown | United States | 2016-01-20 | Adult | Adult | Spinal Cord | Nervous System | |||||||||||||||||
| 42545 | 42545 | SRR5805915 | SRX2985081 | SRS2337741 | SRP111129 | PRJNA393181 | Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro | GSE100821 | Transcriptome Analysis | Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population | pubmed:28959189 | OL5 | GSM2694027 | tissue:adult spinal cord|cell type:oligodendrocyte | OL5 | basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates | adult spinal cord | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | cell type:oligodendrocyte | GSM2694027 | GSM2694027: OL5; Danio rerio; RNA Seq | GSM2694027 | 1 | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | GEO Accession:GSM2694027 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111129 | L13381_Track-36588_R1.fastq.gz | fastq | 367232608.0 | 4832008.0 | GSM2694027 r1 | 0:76 | A:108020448;C:77176838;G:77161902;T:104867470;N:5950 | 76 | 108020448 | 77176838 | 77161902 | 104867470 | 5950 | SRX2985081 | SRS2337741 | SRA584085 | GEO | Reimer Lab, CRT Dresden, TU Dresden | 1 | 0.90504 | 0.10694 | 0.81897 | 0.34015 | 76 | B | usable mapping rate | illumina | hiseq_era | full_length | random_priming | nebnext | bulk | unknown | unknown | Germany | 2017-07-05 | Adult | Adult | Spinal Cord | Nervous System | |||||||||||||||||||
| 42546 | 42546 | SRR5805916 | SRX2985081 | SRS2337741 | SRP111129 | PRJNA393181 | Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro | GSE100821 | Transcriptome Analysis | Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population | pubmed:28959189 | OL5 | GSM2694027 | tissue:adult spinal cord|cell type:oligodendrocyte | OL5 | basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates | adult spinal cord | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | cell type:oligodendrocyte | GSM2694027 | GSM2694027: OL5; Danio rerio; RNA Seq | GSM2694027 | 1 | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | GEO Accession:GSM2694027 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111129 | L13381_Track-36601_R1.fastq.gz | fastq | 1112803020.0 | 14642145.0 | GSM2694027 r2 | 0:76 | A:327618064;C:233631080;G:233528495;T:318005605;N:19776 | 76 | 327618064 | 233631080 | 233528495 | 318005605 | 19776 | SRX2985081 | SRS2337741 | SRA584085 | GEO | Reimer Lab, CRT Dresden, TU Dresden | 1 | 0.90398 | 0.10742 | 0.81895 | 0.3387 | 76 | B | usable mapping rate | illumina | hiseq_era | full_length | random_priming | nebnext | bulk | unknown | unknown | Germany | 2017-07-05 | Adult | Adult | Spinal Cord | Nervous System | |||||||||||||||||||
| 42547 | 42547 | SRR5805917 | SRX2985081 | SRS2337741 | SRP111129 | PRJNA393181 | Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro | GSE100821 | Transcriptome Analysis | Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population | pubmed:28959189 | OL5 | GSM2694027 | tissue:adult spinal cord|cell type:oligodendrocyte | OL5 | basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates | adult spinal cord | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | cell type:oligodendrocyte | GSM2694027 | GSM2694027: OL5; Danio rerio; RNA Seq | GSM2694027 | 1 | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | GEO Accession:GSM2694027 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111129 | L13381_Track-36721_R1.fastq.gz | fastq | 1366015412.0 | 17973887.0 | GSM2694027 r3 | 0:76 | A:404748086;C:283771453;G:285083287;T:392327918;N:84668 | 76 | 404748086 | 283771453 | 285083287 | 392327918 | 84668 | SRX2985081 | SRS2337741 | SRA584085 | GEO | Reimer Lab, CRT Dresden, TU Dresden | 1 | 0.90185 | 0.11132 | 0.82154 | 0.34006 | 76 | B | usable mapping rate | illumina | hiseq_era | full_length | random_priming | nebnext | bulk | unknown | unknown | Germany | 2017-07-05 | Adult | Adult | Spinal Cord | Nervous System | |||||||||||||||||||
| 42548 | 42548 | SRR5805912 | SRX2985080 | SRS2337740 | SRP111129 | PRJNA393181 | Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro | GSE100821 | Transcriptome Analysis | Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population | pubmed:28959189 | OL4 | GSM2694026 | tissue:adult spinal cord|cell type:oligodendrocyte | OL4 | basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates | adult spinal cord | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | cell type:oligodendrocyte | GSM2694026 | GSM2694026: OL4; Danio rerio; RNA Seq | GSM2694026 | 1 | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | GEO Accession:GSM2694026 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111129 | L13380_Track-36587_R1.fastq.gz | fastq | 360675556.0 | 4745731.0 | GSM2694026 r1 | 0:76 | A:106025824;C:75705006;G:76148954;T:102789747;N:6025 | 76 | 106025824 | 75705006 | 76148954 | 102789747 | 6025 | SRX2985080 | SRS2337740 | SRA584085 | GEO | Reimer Lab, CRT Dresden, TU Dresden | 1 | 0.86855 | 0.08794 | 0.82112 | 0.32375 | 76 | B | usable mapping rate | illumina | hiseq_era | full_length | random_priming | nebnext | bulk | unknown | unknown | Germany | 2017-07-05 | Adult | Adult | Spinal Cord | Nervous System | |||||||||||||||||||
| 42549 | 42549 | SRR5805913 | SRX2985080 | SRS2337740 | SRP111129 | PRJNA393181 | Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro | GSE100821 | Transcriptome Analysis | Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population | pubmed:28959189 | OL4 | GSM2694026 | tissue:adult spinal cord|cell type:oligodendrocyte | OL4 | basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates | adult spinal cord | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | cell type:oligodendrocyte | GSM2694026 | GSM2694026: OL4; Danio rerio; RNA Seq | GSM2694026 | 1 | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | GEO Accession:GSM2694026 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111129 | L13380_Track-36600_R1.fastq.gz | fastq | 1098926332.0 | 14459557.0 | GSM2694026 r2 | 0:76 | A:323251709;C:230498299;G:231757231;T:313399836;N:19257 | 76 | 323251709 | 230498299 | 231757231 | 313399836 | 19257 | SRX2985080 | SRS2337740 | SRA584085 | GEO | Reimer Lab, CRT Dresden, TU Dresden | 1 | 0.90618 | 0.09414 | 0.82215 | 0.32432 | 76 | B | usable mapping rate | illumina | hiseq_era | full_length | random_priming | nebnext | bulk | unknown | unknown | Germany | 2017-07-05 | Adult | Adult | Spinal Cord | Nervous System | |||||||||||||||||||
| 42550 | 42550 | SRR5805914 | SRX2985080 | SRS2337740 | SRP111129 | PRJNA393181 | Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro | GSE100821 | Transcriptome Analysis | Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population | pubmed:28959189 | OL4 | GSM2694026 | tissue:adult spinal cord|cell type:oligodendrocyte | OL4 | basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates | adult spinal cord | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | cell type:oligodendrocyte | GSM2694026 | GSM2694026: OL4; Danio rerio; RNA Seq | GSM2694026 | 1 | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | GEO Accession:GSM2694026 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111129 | L13380_Track-36720_R1.fastq.gz | fastq | 1193782464.0 | 15707664.0 | GSM2694026 r3 | 0:76 | A:353125594;C:247908840;G:250316138;T:342359001;N:72891 | 76 | 353125594 | 247908840 | 250316138 | 342359001 | 72891 | SRX2985080 | SRS2337740 | SRA584085 | GEO | Reimer Lab, CRT Dresden, TU Dresden | 1 | 0.90544 | 0.09556 | 0.82233 | 0.32116 | 76 | B | usable mapping rate | illumina | hiseq_era | full_length | random_priming | nebnext | bulk | unknown | unknown | Germany | 2017-07-05 | Adult | Adult | Spinal Cord | Nervous System | |||||||||||||||||||
| 42551 | 42551 | SRR5805909 | SRX2985079 | SRS2337739 | SRP111129 | PRJNA393181 | Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro | GSE100821 | Transcriptome Analysis | Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population | pubmed:28959189 | OL3 | GSM2694025 | tissue:adult spinal cord|cell type:oligodendrocyte | OL3 | basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates | adult spinal cord | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | cell type:oligodendrocyte | GSM2694025 | GSM2694025: OL3; Danio rerio; RNA Seq | GSM2694025 | 1 | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | GEO Accession:GSM2694025 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111129 | L13379_Track-36586_R1.fastq.gz | fastq | 312102360.0 | 4106610.0 | GSM2694025 r1 | 0:76 | A:91621229;C:65883338;G:65770808;T:88821893;N:5092 | 76 | 91621229 | 65883338 | 65770808 | 88821893 | 5092 | SRX2985079 | SRS2337739 | SRA584085 | GEO | Reimer Lab, CRT Dresden, TU Dresden | 1 | 0.86402 | 0.09444 | 0.82181 | 0.33279 | 76 | B | usable mapping rate | illumina | hiseq_era | full_length | random_priming | nebnext | bulk | unknown | unknown | Germany | 2017-07-05 | Adult | Adult | Spinal Cord | Nervous System | |||||||||||||||||||
| 42552 | 42552 | SRR5805910 | SRX2985079 | SRS2337739 | SRP111129 | PRJNA393181 | Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro | GSE100821 | Transcriptome Analysis | Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population | pubmed:28959189 | OL3 | GSM2694025 | tissue:adult spinal cord|cell type:oligodendrocyte | OL3 | basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates | adult spinal cord | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | cell type:oligodendrocyte | GSM2694025 | GSM2694025: OL3; Danio rerio; RNA Seq | GSM2694025 | 1 | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | GEO Accession:GSM2694025 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111129 | L13379_Track-36599_R1.fastq.gz | fastq | 994629328.0 | 13087228.0 | GSM2694025 r2 | 0:76 | A:292173588;C:209769693;G:209444134;T:283224496;N:17417 | 76 | 292173588 | 209769693 | 209444134 | 283224496 | 17417 | SRX2985079 | SRS2337739 | SRA584085 | GEO | Reimer Lab, CRT Dresden, TU Dresden | 1 | 0.90872 | 0.10051 | 0.82233 | 0.32123 | 76 | B | usable mapping rate | illumina | hiseq_era | full_length | random_priming | nebnext | bulk | unknown | unknown | Germany | 2017-07-05 | Adult | Adult | Spinal Cord | Nervous System | |||||||||||||||||||
| 42553 | 42553 | SRR5805911 | SRX2985079 | SRS2337739 | SRP111129 | PRJNA393181 | Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro | GSE100821 | Transcriptome Analysis | Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population | pubmed:28959189 | OL3 | GSM2694025 | tissue:adult spinal cord|cell type:oligodendrocyte | OL3 | basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates | adult spinal cord | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | cell type:oligodendrocyte | GSM2694025 | GSM2694025: OL3; Danio rerio; RNA Seq | GSM2694025 | 1 | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | GEO Accession:GSM2694025 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111129 | L13379_Track-36719_R1.fastq.gz | fastq | 1183535688.0 | 15572838.0 | GSM2694025 r3 | 0:76 | A:349531521;C:247172348;G:248019907;T:338738175;N:73737 | 76 | 349531521 | 247172348 | 248019907 | 338738175 | 73737 | SRX2985079 | SRS2337739 | SRA584085 | GEO | Reimer Lab, CRT Dresden, TU Dresden | 1 | 0.90617 | 0.10315 | 0.82329 | 0.33103 | 76 | B | usable mapping rate | illumina | hiseq_era | full_length | random_priming | nebnext | bulk | unknown | unknown | Germany | 2017-07-05 | Adult | Adult | Spinal Cord | Nervous System | |||||||||||||||||||
| 42554 | 42554 | SRR5805906 | SRX2985078 | SRS2337738 | SRP111129 | PRJNA393181 | Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro | GSE100821 | Transcriptome Analysis | Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population | pubmed:28959189 | OL2 | GSM2694024 | tissue:adult spinal cord|cell type:oligodendrocyte | OL2 | basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates | adult spinal cord | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | cell type:oligodendrocyte | GSM2694024 | GSM2694024: OL2; Danio rerio; RNA Seq | GSM2694024 | 1 | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | GEO Accession:GSM2694024 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111129 | L13378_Track-36585_R1.fastq.gz | fastq | 405537748.0 | 5336023.0 | GSM2694024 r1 | 0:76 | A:118435711;C:85437254;G:85942337;T:115715820;N:6626 | 76 | 118435711 | 85437254 | 85942337 | 115715820 | 6626 | SRX2985078 | SRS2337738 | SRA584085 | GEO | Reimer Lab, CRT Dresden, TU Dresden | 1 | 0.8695 | 0.09795 | 0.82189 | 0.33413 | 76 | B | usable mapping rate | illumina | hiseq_era | full_length | random_priming | nebnext | bulk | unknown | unknown | Germany | 2017-07-05 | Adult | Adult | Spinal Cord | Nervous System | |||||||||||||||||||
| 42555 | 42555 | SRR5805907 | SRX2985078 | SRS2337738 | SRP111129 | PRJNA393181 | Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro | GSE100821 | Transcriptome Analysis | Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population | pubmed:28959189 | OL2 | GSM2694024 | tissue:adult spinal cord|cell type:oligodendrocyte | OL2 | basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates | adult spinal cord | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | cell type:oligodendrocyte | GSM2694024 | GSM2694024: OL2; Danio rerio; RNA Seq | GSM2694024 | 1 | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | GEO Accession:GSM2694024 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111129 | L13378_Track-36598_R1.fastq.gz | fastq | 1228952756.0 | 16170431.0 | GSM2694024 r2 | 0:76 | A:359305067;C:258652975;G:260090708;T:350882129;N:21877 | 76 | 359305067 | 258652975 | 260090708 | 350882129 | 21877 | SRX2985078 | SRS2337738 | SRA584085 | GEO | Reimer Lab, CRT Dresden, TU Dresden | 1 | 0.90938 | 0.10251 | 0.82031 | 0.32861 | 76 | B | usable mapping rate | illumina | hiseq_era | full_length | random_priming | nebnext | bulk | unknown | unknown | Germany | 2017-07-05 | Adult | Adult | Spinal Cord | Nervous System | |||||||||||||||||||
| 42556 | 42556 | SRR5805908 | SRX2985078 | SRS2337738 | SRP111129 | PRJNA393181 | Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro | GSE100821 | Transcriptome Analysis | Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population | pubmed:28959189 | OL2 | GSM2694024 | tissue:adult spinal cord|cell type:oligodendrocyte | OL2 | basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates | adult spinal cord | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | cell type:oligodendrocyte | GSM2694024 | GSM2694024: OL2; Danio rerio; RNA Seq | GSM2694024 | 1 | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | GEO Accession:GSM2694024 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111129 | L13378_Track-36718_R1.fastq.gz | fastq | 1468733440.0 | 19325440.0 | GSM2694024 r3 | 0:76 | A:431919690;C:306294778;G:309065028;T:421362107;N:91837 | 76 | 431919690 | 306294778 | 309065028 | 421362107 | 91837 | SRX2985078 | SRS2337738 | SRA584085 | GEO | Reimer Lab, CRT Dresden, TU Dresden | 1 | 0.90756 | 0.10615 | 0.81949 | 0.33644 | 76 | B | usable mapping rate | illumina | hiseq_era | full_length | random_priming | nebnext | bulk | unknown | unknown | Germany | 2017-07-05 | Adult | Adult | Spinal Cord | Nervous System | |||||||||||||||||||
| 42557 | 42557 | SRR5805903 | SRX2985077 | SRS2337737 | SRP111129 | PRJNA393181 | Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro | GSE100821 | Transcriptome Analysis | Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population | pubmed:28959189 | OL1 | GSM2694023 | tissue:adult spinal cord|cell type:oligodendrocyte | OL1 | basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates | adult spinal cord | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | cell type:oligodendrocyte | GSM2694023 | GSM2694023: OL1; Danio rerio; RNA Seq | GSM2694023 | 1 | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | GEO Accession:GSM2694023 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111129 | L13377_Track-36584_R1.fastq.gz | fastq | 466135360.0 | 6133360.0 | GSM2694023 r1 | 0:76 | A:135755208;C:99052881;G:99001624;T:132317853;N:7794 | 76 | 135755208 | 99052881 | 99001624 | 132317853 | 7794 | SRX2985077 | SRS2337737 | SRA584085 | GEO | Reimer Lab, CRT Dresden, TU Dresden | 1 | 0.87348 | 0.07763 | 0.81844 | 0.31419 | 76 | B | usable mapping rate | illumina | hiseq_era | full_length | random_priming | nebnext | bulk | unknown | unknown | Germany | 2017-07-05 | Adult | Adult | Spinal Cord | Nervous System | |||||||||||||||||||
| 42558 | 42558 | SRR5805904 | SRX2985077 | SRS2337737 | SRP111129 | PRJNA393181 | Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro | GSE100821 | Transcriptome Analysis | Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population | pubmed:28959189 | OL1 | GSM2694023 | tissue:adult spinal cord|cell type:oligodendrocyte | OL1 | basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates | adult spinal cord | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | cell type:oligodendrocyte | GSM2694023 | GSM2694023: OL1; Danio rerio; RNA Seq | GSM2694023 | 1 | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | GEO Accession:GSM2694023 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111129 | L13377_Track-36597_R1.fastq.gz | fastq | 1411330868.0 | 18570143.0 | GSM2694023 r2 | 0:76 | A:411208825;C:299646339;G:299445590;T:401005116;N:24998 | 76 | 411208825 | 299646339 | 299445590 | 401005116 | 24998 | SRX2985077 | SRS2337737 | SRA584085 | GEO | Reimer Lab, CRT Dresden, TU Dresden | 1 | 0.91442 | 0.08129 | 0.81868 | 0.31098 | 76 | B | usable mapping rate | illumina | hiseq_era | full_length | random_priming | nebnext | bulk | unknown | unknown | Germany | 2017-07-05 | Adult | Adult | Spinal Cord | Nervous System | |||||||||||||||||||
| 42559 | 42559 | SRR5805905 | SRX2985077 | SRS2337737 | SRP111129 | PRJNA393181 | Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro | GSE100821 | Transcriptome Analysis | Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population | pubmed:28959189 | OL1 | GSM2694023 | tissue:adult spinal cord|cell type:oligodendrocyte | OL1 | basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates | adult spinal cord | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | cell type:oligodendrocyte | GSM2694023 | GSM2694023: OL1; Danio rerio; RNA Seq | GSM2694023 | 1 | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | GEO Accession:GSM2694023 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111129 | L13377_Track-36717_R1.fastq.gz | fastq | 1694230988.0 | 22292513.0 | GSM2694023 r3 | 0:76 | A:496435234;C:356390144;G:357718951;T:483580476;N:106183 | 76 | 496435234 | 356390144 | 357718951 | 483580476 | 106183 | SRX2985077 | SRS2337737 | SRA584085 | GEO | Reimer Lab, CRT Dresden, TU Dresden | 1 | 0.91116 | 0.0827 | 0.81854 | 0.31198 | 76 | B | usable mapping rate | illumina | hiseq_era | full_length | random_priming | nebnext | bulk | unknown | unknown | Germany | 2017-07-05 | Adult | Adult | Spinal Cord | Nervous System | |||||||||||||||||||
| 42560 | 42560 | SRR5805900 | SRX2985076 | SRS2337736 | SRP111129 | PRJNA393181 | Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro | GSE100821 | Transcriptome Analysis | Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population | pubmed:28959189 | OPC5 | GSM2694022 | tissue:adult spinal cord|cell type:oligodendrocyte precursor cell | OPC5 | basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates | adult spinal cord | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | cell type:oligodendrocyte precursor cell | GSM2694022 | GSM2694022: OPC5; Danio rerio; RNA Seq | GSM2694022 | 1 | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | GEO Accession:GSM2694022 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111129 | L13376_Track-36583_R1.fastq.gz | fastq | 280153404.0 | 3686229.0 | GSM2694022 r1 | 0:76 | A:81451669;C:59566227;G:59669362;T:79461530;N:4616 | 76 | 81451669 | 59566227 | 59669362 | 79461530 | 4616 | SRX2985076 | SRS2337736 | SRA584085 | GEO | Reimer Lab, CRT Dresden, TU Dresden | 1 | 0.87692 | 0.11958 | 0.78683 | 0.37449 | 76 | B | usable mapping rate | illumina | hiseq_era | full_length | random_priming | nebnext | bulk | unknown | unknown | Germany | 2017-07-05 | Adult | Adult | Spinal Cord | Nervous System | |||||||||||||||||||
| 42561 | 42561 | SRR5805901 | SRX2985076 | SRS2337736 | SRP111129 | PRJNA393181 | Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro | GSE100821 | Transcriptome Analysis | Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population | pubmed:28959189 | OPC5 | GSM2694022 | tissue:adult spinal cord|cell type:oligodendrocyte precursor cell | OPC5 | basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates | adult spinal cord | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | cell type:oligodendrocyte precursor cell | GSM2694022 | GSM2694022: OPC5; Danio rerio; RNA Seq | GSM2694022 | 1 | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | GEO Accession:GSM2694022 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111129 | L13376_Track-36596_R1.fastq.gz | fastq | 905919164.0 | 11919989.0 | GSM2694022 r2 | 0:76 | A:263683260;C:192386277;G:192756447;T:257077269;N:15911 | 76 | 263683260 | 192386277 | 192756447 | 257077269 | 15911 | SRX2985076 | SRS2337736 | SRA584085 | GEO | Reimer Lab, CRT Dresden, TU Dresden | 1 | 0.91322 | 0.12482 | 0.78695 | 0.38581 | 76 | B | usable mapping rate | illumina | hiseq_era | full_length | random_priming | nebnext | bulk | unknown | unknown | Germany | 2017-07-05 | Adult | Adult | Spinal Cord | Nervous System | |||||||||||||||||||
| 42562 | 42562 | SRR5805902 | SRX2985076 | SRS2337736 | SRP111129 | PRJNA393181 | Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro | GSE100821 | Transcriptome Analysis | Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population | pubmed:28959189 | OPC5 | GSM2694022 | tissue:adult spinal cord|cell type:oligodendrocyte precursor cell | OPC5 | basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates | adult spinal cord | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | cell type:oligodendrocyte precursor cell | GSM2694022 | GSM2694022: OPC5; Danio rerio; RNA Seq | GSM2694022 | 1 | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | GEO Accession:GSM2694022 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111129 | L13376_Track-36716_R1.fastq.gz | fastq | 1102695932.0 | 14509157.0 | GSM2694022 r3 | 0:76 | A:322423795;C:232167818;G:233489197;T:314545918;N:69204 | 76 | 322423795 | 232167818 | 233489197 | 314545918 | 69204 | SRX2985076 | SRS2337736 | SRA584085 | GEO | Reimer Lab, CRT Dresden, TU Dresden | 1 | 0.91113 | 0.12832 | 0.78902 | 0.38324 | 76 | B | usable mapping rate | illumina | hiseq_era | full_length | random_priming | nebnext | bulk | unknown | unknown | Germany | 2017-07-05 | Adult | Adult | Spinal Cord | Nervous System | |||||||||||||||||||
| 42563 | 42563 | SRR5805897 | SRX2985075 | SRS2337735 | SRP111129 | PRJNA393181 | Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro | GSE100821 | Transcriptome Analysis | Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population | pubmed:28959189 | OPC4 | GSM2694021 | tissue:adult spinal cord|cell type:oligodendrocyte precursor cell | OPC4 | basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates | adult spinal cord | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | cell type:oligodendrocyte precursor cell | GSM2694021 | GSM2694021: OPC4; Danio rerio; RNA Seq | GSM2694021 | 1 | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | GEO Accession:GSM2694021 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111129 | L13375_Track-36582_R1.fastq.gz | fastq | 281755636.0 | 3707311.0 | GSM2694021 r1 | 0:76 | A:82997556;C:58935470;G:59188963;T:80628803;N:4844 | 76 | 82997556 | 58935470 | 59188963 | 80628803 | 4844 | SRX2985075 | SRS2337735 | SRA584085 | GEO | Reimer Lab, CRT Dresden, TU Dresden | 1 | 0.87083 | 0.12585 | 0.79042 | 0.35633 | 76 | B | usable mapping rate | illumina | hiseq_era | full_length | random_priming | nebnext | bulk | unknown | unknown | Germany | 2017-07-05 | Adult | Adult | Spinal Cord | Nervous System | |||||||||||||||||||
| 42564 | 42564 | SRR5805898 | SRX2985075 | SRS2337735 | SRP111129 | PRJNA393181 | Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro | GSE100821 | Transcriptome Analysis | Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population | pubmed:28959189 | OPC4 | GSM2694021 | tissue:adult spinal cord|cell type:oligodendrocyte precursor cell | OPC4 | basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates | adult spinal cord | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | cell type:oligodendrocyte precursor cell | GSM2694021 | GSM2694021: OPC4; Danio rerio; RNA Seq | GSM2694021 | 1 | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | GEO Accession:GSM2694021 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111129 | L13375_Track-36595_R1.fastq.gz | fastq | 856872336.0 | 11274636.0 | GSM2694021 r2 | 0:76 | A:252638777;C:179079271;G:179782360;T:245356644;N:15284 | 76 | 252638777 | 179079271 | 179782360 | 245356644 | 15284 | SRX2985075 | SRS2337735 | SRA584085 | GEO | Reimer Lab, CRT Dresden, TU Dresden | 1 | 0.91479 | 0.1324 | 0.78959 | 0.36277 | 76 | B | usable mapping rate | illumina | hiseq_era | full_length | random_priming | nebnext | bulk | unknown | unknown | Germany | 2017-07-05 | Adult | Adult | Spinal Cord | Nervous System | |||||||||||||||||||
| 42565 | 42565 | SRR5805899 | SRX2985075 | SRS2337735 | SRP111129 | PRJNA393181 | Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro | GSE100821 | Transcriptome Analysis | Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population | pubmed:28959189 | OPC4 | GSM2694021 | tissue:adult spinal cord|cell type:oligodendrocyte precursor cell | OPC4 | basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates | adult spinal cord | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | cell type:oligodendrocyte precursor cell | GSM2694021 | GSM2694021: OPC4; Danio rerio; RNA Seq | GSM2694021 | 1 | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | GEO Accession:GSM2694021 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111129 | L13375_Track-36715_R1.fastq.gz | fastq | 1067787080.0 | 14049830.0 | GSM2694021 r3 | 0:76 | A:316592408;C:220986701;G:222738880;T:307403458;N:65633 | 76 | 316592408 | 220986701 | 222738880 | 307403458 | 65633 | SRX2985075 | SRS2337735 | SRA584085 | GEO | Reimer Lab, CRT Dresden, TU Dresden | 1 | 0.91223 | 0.13673 | 0.78957 | 0.36042 | 76 | B | usable mapping rate | illumina | hiseq_era | full_length | random_priming | nebnext | bulk | unknown | unknown | Germany | 2017-07-05 | Adult | Adult | Spinal Cord | Nervous System | |||||||||||||||||||
| 42566 | 42566 | SRR5805894 | SRX2985074 | SRS2337734 | SRP111129 | PRJNA393181 | Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro | GSE100821 | Transcriptome Analysis | Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population | pubmed:28959189 | OPC3 | GSM2694020 | tissue:adult spinal cord|cell type:oligodendrocyte precursor cell | OPC3 | basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates | adult spinal cord | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | cell type:oligodendrocyte precursor cell | GSM2694020 | GSM2694020: OPC3; Danio rerio; RNA Seq | GSM2694020 | 1 | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | GEO Accession:GSM2694020 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111129 | L13374_Track-36581_R1.fastq.gz | fastq | 258394604.0 | 3399929.0 | GSM2694020 r1 | 0:76 | A:75988348;C:54232048;G:54304534;T:73865549;N:4125 | 76 | 75988348 | 54232048 | 54304534 | 73865549 | 4125 | SRX2985074 | SRS2337734 | SRA584085 | GEO | Reimer Lab, CRT Dresden, TU Dresden | 1 | 0.86675 | 0.10485 | 0.79166 | 0.35524 | 76 | B | usable mapping rate | illumina | hiseq_era | full_length | random_priming | nebnext | bulk | unknown | unknown | Germany | 2017-07-05 | Adult | Adult | Spinal Cord | Nervous System | |||||||||||||||||||
| 42567 | 42567 | SRR5805895 | SRX2985074 | SRS2337734 | SRP111129 | PRJNA393181 | Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro | GSE100821 | Transcriptome Analysis | Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population | pubmed:28959189 | OPC3 | GSM2694020 | tissue:adult spinal cord|cell type:oligodendrocyte precursor cell | OPC3 | basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates | adult spinal cord | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | cell type:oligodendrocyte precursor cell | GSM2694020 | GSM2694020: OPC3; Danio rerio; RNA Seq | GSM2694020 | 1 | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | GEO Accession:GSM2694020 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111129 | L13374_Track-36594_R1.fastq.gz | fastq | 802809356.0 | 10563281.0 | GSM2694020 r2 | 0:76 | A:236297052;C:168384708;G:168556277;T:229557436;N:13883 | 76 | 236297052 | 168384708 | 168556277 | 229557436 | 13883 | SRX2985074 | SRS2337734 | SRA584085 | GEO | Reimer Lab, CRT Dresden, TU Dresden | 1 | 0.90891 | 0.11028 | 0.79115 | 0.35162 | 76 | B | usable mapping rate | illumina | hiseq_era | full_length | random_priming | nebnext | bulk | unknown | unknown | Germany | 2017-07-05 | Adult | Adult | Spinal Cord | Nervous System | |||||||||||||||||||
| 42568 | 42568 | SRR5805896 | SRX2985074 | SRS2337734 | SRP111129 | PRJNA393181 | Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro | GSE100821 | Transcriptome Analysis | Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population | pubmed:28959189 | OPC3 | GSM2694020 | tissue:adult spinal cord|cell type:oligodendrocyte precursor cell | OPC3 | basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates | adult spinal cord | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | cell type:oligodendrocyte precursor cell | GSM2694020 | GSM2694020: OPC3; Danio rerio; RNA Seq | GSM2694020 | 1 | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | GEO Accession:GSM2694020 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111129 | L13374_Track-36714_R1.fastq.gz | fastq | 996263860.0 | 13108735.0 | GSM2694020 r3 | 0:76 | A:294853084;C:206867581;G:208047523;T:286432957;N:62715 | 76 | 294853084 | 206867581 | 208047523 | 286432957 | 62715 | SRX2985074 | SRS2337734 | SRA584085 | GEO | Reimer Lab, CRT Dresden, TU Dresden | 1 | 0.90671 | 0.1148 | 0.78993 | 0.36115 | 76 | B | usable mapping rate | illumina | hiseq_era | full_length | random_priming | nebnext | bulk | unknown | unknown | Germany | 2017-07-05 | Adult | Adult | Spinal Cord | Nervous System | |||||||||||||||||||
| 42569 | 42569 | SRR5805891 | SRX2985073 | SRS2337733 | SRP111129 | PRJNA393181 | Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro | GSE100821 | Transcriptome Analysis | Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population | pubmed:28959189 | OPC2 | GSM2694019 | tissue:adult spinal cord|cell type:oligodendrocyte precursor cell | OPC2 | basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates | adult spinal cord | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | cell type:oligodendrocyte precursor cell | GSM2694019 | GSM2694019: OPC2; Danio rerio; RNA Seq | GSM2694019 | 1 | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | GEO Accession:GSM2694019 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111129 | L13373_Track-36580_R1.fastq.gz | fastq | 290268624.0 | 3819324.0 | GSM2694019 r1 | 0:76 | A:83225179;C:62931491;G:62628688;T:81478215;N:5051 | 76 | 83225179 | 62931491 | 62628688 | 81478215 | 5051 | SRX2985073 | SRS2337733 | SRA584085 | GEO | Reimer Lab, CRT Dresden, TU Dresden | 1 | 0.84469 | 0.11786 | 0.78742 | 0.38555 | 76 | B | usable mapping rate | illumina | hiseq_era | full_length | random_priming | nebnext | bulk | unknown | unknown | Germany | 2017-07-05 | Adult | Adult | Spinal Cord | Nervous System | |||||||||||||||||||
| 42570 | 42570 | SRR5805892 | SRX2985073 | SRS2337733 | SRP111129 | PRJNA393181 | Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro | GSE100821 | Transcriptome Analysis | Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population | pubmed:28959189 | OPC2 | GSM2694019 | tissue:adult spinal cord|cell type:oligodendrocyte precursor cell | OPC2 | basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates | adult spinal cord | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | cell type:oligodendrocyte precursor cell | GSM2694019 | GSM2694019: OPC2; Danio rerio; RNA Seq | GSM2694019 | 1 | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | GEO Accession:GSM2694019 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111129 | L13373_Track-36593_R1.fastq.gz | fastq | 872053640.0 | 11474390.0 | GSM2694019 r2 | 0:76 | A:250248044;C:188809860;G:187959005;T:245021560;N:15171 | 76 | 250248044 | 188809860 | 187959005 | 245021560 | 15171 | SRX2985073 | SRS2337733 | SRA584085 | GEO | Reimer Lab, CRT Dresden, TU Dresden | 1 | 0.87823 | 0.12293 | 0.78699 | 0.38395 | 76 | B | usable mapping rate | illumina | hiseq_era | full_length | random_priming | nebnext | bulk | unknown | unknown | Germany | 2017-07-05 | Adult | Adult | Spinal Cord | Nervous System | |||||||||||||||||||
| 42571 | 42571 | SRR5805893 | SRX2985073 | SRS2337733 | SRP111129 | PRJNA393181 | Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro | GSE100821 | Transcriptome Analysis | Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population | pubmed:28959189 | OPC2 | GSM2694019 | tissue:adult spinal cord|cell type:oligodendrocyte precursor cell | OPC2 | basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates | adult spinal cord | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | cell type:oligodendrocyte precursor cell | GSM2694019 | GSM2694019: OPC2; Danio rerio; RNA Seq | GSM2694019 | 1 | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | GEO Accession:GSM2694019 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111129 | L13373_Track-36713_R1.fastq.gz | fastq | 1035504180.0 | 13625055.0 | GSM2694019 r3 | 0:76 | A:298790829;C:222016282;G:222262419;T:292369013;N:65637 | 76 | 298790829 | 222016282 | 222262419 | 292369013 | 65637 | SRX2985073 | SRS2337733 | SRA584085 | GEO | Reimer Lab, CRT Dresden, TU Dresden | 1 | 0.88262 | 0.12859 | 0.78707 | 0.36444 | 76 | B | usable mapping rate | illumina | hiseq_era | full_length | random_priming | nebnext | bulk | unknown | unknown | Germany | 2017-07-05 | Adult | Adult | Spinal Cord | Nervous System | |||||||||||||||||||
| 42572 | 42572 | SRR5805888 | SRX2985072 | SRS2337732 | SRP111129 | PRJNA393181 | Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro | GSE100821 | Transcriptome Analysis | Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population | pubmed:28959189 | OPC1 | GSM2694018 | tissue:adult spinal cord|cell type:oligodendrocyte precursor cell | OPC1 | basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates | adult spinal cord | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | cell type:oligodendrocyte precursor cell | GSM2694018 | GSM2694018: OPC1; Danio rerio; RNA Seq | GSM2694018 | 1 | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | GEO Accession:GSM2694018 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111129 | L13372_Track-36579_R1.fastq.gz | fastq | 275307568.0 | 3622468.0 | GSM2694018 r1 | 0:76 | A:80768745;C:57628302;G:57760609;T:79145252;N:4660 | 76 | 80768745 | 57628302 | 57760609 | 79145252 | 4660 | SRX2985072 | SRS2337732 | SRA584085 | GEO | Reimer Lab, CRT Dresden, TU Dresden | 1 | 0.87887 | 0.12197 | 0.79807 | 0.35871 | 76 | B | usable mapping rate | illumina | hiseq_era | full_length | random_priming | nebnext | bulk | unknown | unknown | Germany | 2017-07-05 | Adult | Adult | Spinal Cord | Nervous System | |||||||||||||||||||
| 42573 | 42573 | SRR5805889 | SRX2985072 | SRS2337732 | SRP111129 | PRJNA393181 | Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro | GSE100821 | Transcriptome Analysis | Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population | pubmed:28959189 | OPC1 | GSM2694018 | tissue:adult spinal cord|cell type:oligodendrocyte precursor cell | OPC1 | basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates | adult spinal cord | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | cell type:oligodendrocyte precursor cell | GSM2694018 | GSM2694018: OPC1; Danio rerio; RNA Seq | GSM2694018 | 1 | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | GEO Accession:GSM2694018 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111129 | L13372_Track-36592_R1.fastq.gz | fastq | 844153204.0 | 11107279.0 | GSM2694018 r2 | 0:76 | A:247798416;C:176560506;G:176978398;T:242800972;N:14912 | 76 | 247798416 | 176560506 | 176978398 | 242800972 | 14912 | SRX2985072 | SRS2337732 | SRA584085 | GEO | Reimer Lab, CRT Dresden, TU Dresden | 1 | 0.912 | 0.12665 | 0.79742 | 0.36358 | 76 | B | usable mapping rate | illumina | hiseq_era | full_length | random_priming | nebnext | bulk | unknown | unknown | Germany | 2017-07-05 | Adult | Adult | Spinal Cord | Nervous System | |||||||||||||||||||
| 42574 | 42574 | SRR5805890 | SRX2985072 | SRS2337732 | SRP111129 | PRJNA393181 | Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro | GSE100821 | Transcriptome Analysis | Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population | pubmed:28959189 | OPC1 | GSM2694018 | tissue:adult spinal cord|cell type:oligodendrocyte precursor cell | OPC1 | basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates | adult spinal cord | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | cell type:oligodendrocyte precursor cell | GSM2694018 | GSM2694018: OPC1; Danio rerio; RNA Seq | GSM2694018 | 1 | Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R… | GEO Accession:GSM2694018 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP111129 | L13372_Track-36712_R1.fastq.gz | fastq | 990996528.0 | 13039428.0 | GSM2694018 r3 | 0:76 | A:292539296;C:205334965;G:206678725;T:286381798;N:61744 | 76 | 292539296 | 205334965 | 206678725 | 286381798 | 61744 | SRX2985072 | SRS2337732 | SRA584085 | GEO | Reimer Lab, CRT Dresden, TU Dresden | 1 | 0.90825 | 0.1314 | 0.80004 | 0.3635 | 76 | B | usable mapping rate | illumina | hiseq_era | full_length | random_priming | nebnext | bulk | unknown | unknown | Germany | 2017-07-05 | Adult | Adult | Spinal Cord | Nervous System | |||||||||||||||||||
| 60587 | 60587 | SRR12424278 | SRX8920145 | SRS7176693 | SRP276929 | PRJNA656271 | Single cell RNA seq analysis of pMN neural progenitors from zebrafish | GSE155988 | Transcriptome Analysis | The goal of this study was to identify distinct cell populations that arise from ventral spinal cord pMN progenitors. To do so we sorted fluorescently marked pMN cells obtained from Tgolig2:EGFP zebrafish embryos at 24 36 hpf and 48 hpf and performed 10X Chromium single cell RNA seq. Overall design: Three samples obtained from wild type zebrafish embryos at three developmental timepoints were analyzed. | pubmed:32680935 | scRNAseq olig2 eGFP 48hpf | GSM4718658 | tissue:spinal cord cells|developmental stage:48 hpf ZFIN ID: ZDB ALT 041129 8 | scRNAseq olig2 eGFP 48hpf | Raw sequencing reads were demultiplexed mapped to the zebrafish reference genome and summarized into gene expression matrices using CellRanger version 3.0.1 Count matrices were further filtered in Seurat 3.1.0 https://satijalab.org/seurat/ to remove cell barcodes with fewer than 250 detectable genes more than 5% of UMIs derived from mitochondrial genes or more than 50 000 UMIs to exclude putative doublets Standard Seurat normalization and PCA was run using the 1 291 most variable genes Applied Harmony https://doi.org/10.1038/s41592 019 0619 0 alignment theta = 2 to correct for inter sample variation chose 20 Harmony dimensions and applied Seurat UMAP reduction Genome build: GRCz11 Supplementary files format and content: gzipped csv file of matrix of normalized gene expression by cell for merged 3 scRNAseq samples Supplementary files format and content: gzipped csv file of metadata for cells | spinal cord cells | No treatment was applied to the samples. | 24 36 and 48 hpf Tgolig2:EGFP euthanized embryos were collected in 1.7 ml microcentrifuge tubes and deyolked in 100 μl of pre chilled Ca free Ringers solution 116 mM NaCl 2.6 mM KCl 5 mM HEPES pH 7.0 on ice. Embryos were pipetted intermittently with a p200 micropipettor for 15 minutes and left for 5 min. 500 μl of protease solution 10 mg/ml BI protease 125 U/ml DNase 2.5 mM EDTA 1X PBS was added to microcentrifuge tubes on ice for 15 min and embryos were homogenized every 3 min with a p100 micropipettor for 15 min. 200 μl of STOP solution 30% FBS 0.8 mM CaCl2 1X PBS was then mixed into the tubes. Samples were then spun down at 400g for 5 min at 4°C and supernatant was removed. On ice 1 ml of chilled suspension media 1% FBS 0.8 mM CaCl2 50 U/ml Penicillin 0.05 mg/ml Streptomycin was added to samples and then spun down again at 400g for 5 min at 4°C. Supernatant was removed and 400 μl of chilled suspension media was added and solution was filtered through a 35 μm strainer into a collection tube. Cells were FAC sorted to distinguish EGFP+ cells using a MoFlo XDP100 cell sorter at the CU SOM Cancer Center Flow Cytometry Shared Resource and collected in 1.7 ml FBS coated microcentrifuge tubes in 200 μl of 1X PBS. The Chromium Box from 10X Genomics was used to capture cells using Chromium Single Cell three prime Reagent Kit part no. PN 1000075. Libraries were sequenced on the Illumina NovaSEQ6000 Instrument. | Embryos were raised at 28.5°C in E3 media 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 at pH 7.4 with sodium bicarbonate sorted for good health and staged accordingly to developmental morphological features and hpf | developmental stage:48 hpf ZFIN ID: ZDB ALT 041129 8 | GSM4718658 | GSM4718658: scRNAseq olig2 eGFP 48hpf; Danio rerio; RNA Seq | GSM4718658 | 1 | 24 36 and 48 hpf Tgolig2:EGFP euthanized embryos were collected in 1.7 ml microcentrifuge tubes and deyolked in 100 μl of pre chilled Ca free Ringers solution 116 mM NaCl 2.6 mM KCl 5 mM HEPES pH 7.0 on ice. Embryos were pipetted intermittently with a p200 micropipettor for 15 minutes and left for 5 min. 500 μl of protease solution 10 mg/ml BI protease 125 U/ml DNase 2.5 mM EDTA 1X PBS was added to microcentrifuge tubes on ice for 15 min and embryos were homogenized every 3 min with a p100 micropipettor for 15 min. 200 μl of STOP solution 30% FBS 0.8 mM CaCl2 1X PBS was then mixed into the tubes. Samples were then spun down at 400g for 5 min at 4°C and supernatant was removed. On ice 1 ml of chilled suspension media 1% FBS 0.8 mM CaCl2 50 U/ml Penicillin 0.05 mg/ml Streptomycin was added to samples and then spun down again at 400g for 5 min at 4°C. Supernatant was removed and 400 μl of chilled suspension media was added and solution was filtered through a 35 μm strainer into a collection tube. Cells were FAC sorted to distinguish EGFP+ cells using a MoFlo XDP100 cell sorter at the CU SOM Cancer Center Flow Cytometry Shared Resource and collected in 1.7 ml FBS coated microcentrifuge tubes in 200 μl of 1X PBS. The Chromium Box from 10X Genomics was used to capture cells using Chromium Single Cell three prime Reagent Kit part no. PN 1000075. Libraries were sequenced on the Illumina NovaSEQ6000 Instrument. | GEO Accession:GSM4718658 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP276929 | olig2_egfp_48hpf_1_S41_L001_R1_001.fastq.gz olig2_egfp_48hpf_1_S41_L001_R2_001.fastq.gz | fastq fastq | 18778651430.0 | 62180965.0 | GSM4718658 r1 | 0:151 1:151 | A:6542554044;C:3515052559;G:3489753648;T:5231107020;N:184159 | 151 | 151 | 6542554044 | 3515052559 | 3489753648 | 5231107020 | 184159 | SRX8920145 | SRS7176693 | SRA1111061 | GEO | University of Colorado School of Medicine | 2 | 0.0 | 0.90055 | 0.0 | 0.21162 | 1.0 | 0.77776 | 0.53718 | 151 | 151 | T | B | mate1 technical by mapping diff | illumina | novaseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2020-08-10 | Hatching | Embryo | Spinal Cord | Nervous System | |||||||||||
| 60588 | 60588 | SRR12424279 | SRX8920145 | SRS7176693 | SRP276929 | PRJNA656271 | Single cell RNA seq analysis of pMN neural progenitors from zebrafish | GSE155988 | Transcriptome Analysis | The goal of this study was to identify distinct cell populations that arise from ventral spinal cord pMN progenitors. To do so we sorted fluorescently marked pMN cells obtained from Tgolig2:EGFP zebrafish embryos at 24 36 hpf and 48 hpf and performed 10X Chromium single cell RNA seq. Overall design: Three samples obtained from wild type zebrafish embryos at three developmental timepoints were analyzed. | pubmed:32680935 | scRNAseq olig2 eGFP 48hpf | GSM4718658 | tissue:spinal cord cells|developmental stage:48 hpf ZFIN ID: ZDB ALT 041129 8 | scRNAseq olig2 eGFP 48hpf | Raw sequencing reads were demultiplexed mapped to the zebrafish reference genome and summarized into gene expression matrices using CellRanger version 3.0.1 Count matrices were further filtered in Seurat 3.1.0 https://satijalab.org/seurat/ to remove cell barcodes with fewer than 250 detectable genes more than 5% of UMIs derived from mitochondrial genes or more than 50 000 UMIs to exclude putative doublets Standard Seurat normalization and PCA was run using the 1 291 most variable genes Applied Harmony https://doi.org/10.1038/s41592 019 0619 0 alignment theta = 2 to correct for inter sample variation chose 20 Harmony dimensions and applied Seurat UMAP reduction Genome build: GRCz11 Supplementary files format and content: gzipped csv file of matrix of normalized gene expression by cell for merged 3 scRNAseq samples Supplementary files format and content: gzipped csv file of metadata for cells | spinal cord cells | No treatment was applied to the samples. | 24 36 and 48 hpf Tgolig2:EGFP euthanized embryos were collected in 1.7 ml microcentrifuge tubes and deyolked in 100 μl of pre chilled Ca free Ringers solution 116 mM NaCl 2.6 mM KCl 5 mM HEPES pH 7.0 on ice. Embryos were pipetted intermittently with a p200 micropipettor for 15 minutes and left for 5 min. 500 μl of protease solution 10 mg/ml BI protease 125 U/ml DNase 2.5 mM EDTA 1X PBS was added to microcentrifuge tubes on ice for 15 min and embryos were homogenized every 3 min with a p100 micropipettor for 15 min. 200 μl of STOP solution 30% FBS 0.8 mM CaCl2 1X PBS was then mixed into the tubes. Samples were then spun down at 400g for 5 min at 4°C and supernatant was removed. On ice 1 ml of chilled suspension media 1% FBS 0.8 mM CaCl2 50 U/ml Penicillin 0.05 mg/ml Streptomycin was added to samples and then spun down again at 400g for 5 min at 4°C. Supernatant was removed and 400 μl of chilled suspension media was added and solution was filtered through a 35 μm strainer into a collection tube. Cells were FAC sorted to distinguish EGFP+ cells using a MoFlo XDP100 cell sorter at the CU SOM Cancer Center Flow Cytometry Shared Resource and collected in 1.7 ml FBS coated microcentrifuge tubes in 200 μl of 1X PBS. The Chromium Box from 10X Genomics was used to capture cells using Chromium Single Cell three prime Reagent Kit part no. PN 1000075. Libraries were sequenced on the Illumina NovaSEQ6000 Instrument. | Embryos were raised at 28.5°C in E3 media 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 at pH 7.4 with sodium bicarbonate sorted for good health and staged accordingly to developmental morphological features and hpf | developmental stage:48 hpf ZFIN ID: ZDB ALT 041129 8 | GSM4718658 | GSM4718658: scRNAseq olig2 eGFP 48hpf; Danio rerio; RNA Seq | GSM4718658 | 1 | 24 36 and 48 hpf Tgolig2:EGFP euthanized embryos were collected in 1.7 ml microcentrifuge tubes and deyolked in 100 μl of pre chilled Ca free Ringers solution 116 mM NaCl 2.6 mM KCl 5 mM HEPES pH 7.0 on ice. Embryos were pipetted intermittently with a p200 micropipettor for 15 minutes and left for 5 min. 500 μl of protease solution 10 mg/ml BI protease 125 U/ml DNase 2.5 mM EDTA 1X PBS was added to microcentrifuge tubes on ice for 15 min and embryos were homogenized every 3 min with a p100 micropipettor for 15 min. 200 μl of STOP solution 30% FBS 0.8 mM CaCl2 1X PBS was then mixed into the tubes. Samples were then spun down at 400g for 5 min at 4°C and supernatant was removed. On ice 1 ml of chilled suspension media 1% FBS 0.8 mM CaCl2 50 U/ml Penicillin 0.05 mg/ml Streptomycin was added to samples and then spun down again at 400g for 5 min at 4°C. Supernatant was removed and 400 μl of chilled suspension media was added and solution was filtered through a 35 μm strainer into a collection tube. Cells were FAC sorted to distinguish EGFP+ cells using a MoFlo XDP100 cell sorter at the CU SOM Cancer Center Flow Cytometry Shared Resource and collected in 1.7 ml FBS coated microcentrifuge tubes in 200 μl of 1X PBS. The Chromium Box from 10X Genomics was used to capture cells using Chromium Single Cell three prime Reagent Kit part no. PN 1000075. Libraries were sequenced on the Illumina NovaSEQ6000 Instrument. | GEO Accession:GSM4718658 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP276929 | olig2_egfp_48hpf_2_S42_L001_R1_001.fastq.gz olig2_egfp_48hpf_2_S42_L001_R2_001.fastq.gz | fastq fastq | 22242782898.0 | 73651599.0 | GSM4718658 r2 | 0:151 1:151 | A:7753674261;C:4160150132;G:4127581173;T:6201157562;N:219770 | 151 | 151 | 7753674261 | 4160150132 | 4127581173 | 6201157562 | 219770 | SRX8920145 | SRS7176693 | SRA1111061 | GEO | University of Colorado School of Medicine | 2 | 0.0 | 0.90097 | 0.0 | 0.2127 | 1.0 | 0.77966 | 0.54192 | 151 | 151 | T | B | mate1 technical by mapping diff | illumina | novaseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2020-08-10 | Hatching | Embryo | Spinal Cord | Nervous System | |||||||||||
| 60589 | 60589 | SRR12424280 | SRX8920145 | SRS7176693 | SRP276929 | PRJNA656271 | Single cell RNA seq analysis of pMN neural progenitors from zebrafish | GSE155988 | Transcriptome Analysis | The goal of this study was to identify distinct cell populations that arise from ventral spinal cord pMN progenitors. To do so we sorted fluorescently marked pMN cells obtained from Tgolig2:EGFP zebrafish embryos at 24 36 hpf and 48 hpf and performed 10X Chromium single cell RNA seq. Overall design: Three samples obtained from wild type zebrafish embryos at three developmental timepoints were analyzed. | pubmed:32680935 | scRNAseq olig2 eGFP 48hpf | GSM4718658 | tissue:spinal cord cells|developmental stage:48 hpf ZFIN ID: ZDB ALT 041129 8 | scRNAseq olig2 eGFP 48hpf | Raw sequencing reads were demultiplexed mapped to the zebrafish reference genome and summarized into gene expression matrices using CellRanger version 3.0.1 Count matrices were further filtered in Seurat 3.1.0 https://satijalab.org/seurat/ to remove cell barcodes with fewer than 250 detectable genes more than 5% of UMIs derived from mitochondrial genes or more than 50 000 UMIs to exclude putative doublets Standard Seurat normalization and PCA was run using the 1 291 most variable genes Applied Harmony https://doi.org/10.1038/s41592 019 0619 0 alignment theta = 2 to correct for inter sample variation chose 20 Harmony dimensions and applied Seurat UMAP reduction Genome build: GRCz11 Supplementary files format and content: gzipped csv file of matrix of normalized gene expression by cell for merged 3 scRNAseq samples Supplementary files format and content: gzipped csv file of metadata for cells | spinal cord cells | No treatment was applied to the samples. | 24 36 and 48 hpf Tgolig2:EGFP euthanized embryos were collected in 1.7 ml microcentrifuge tubes and deyolked in 100 μl of pre chilled Ca free Ringers solution 116 mM NaCl 2.6 mM KCl 5 mM HEPES pH 7.0 on ice. Embryos were pipetted intermittently with a p200 micropipettor for 15 minutes and left for 5 min. 500 μl of protease solution 10 mg/ml BI protease 125 U/ml DNase 2.5 mM EDTA 1X PBS was added to microcentrifuge tubes on ice for 15 min and embryos were homogenized every 3 min with a p100 micropipettor for 15 min. 200 μl of STOP solution 30% FBS 0.8 mM CaCl2 1X PBS was then mixed into the tubes. Samples were then spun down at 400g for 5 min at 4°C and supernatant was removed. On ice 1 ml of chilled suspension media 1% FBS 0.8 mM CaCl2 50 U/ml Penicillin 0.05 mg/ml Streptomycin was added to samples and then spun down again at 400g for 5 min at 4°C. Supernatant was removed and 400 μl of chilled suspension media was added and solution was filtered through a 35 μm strainer into a collection tube. Cells were FAC sorted to distinguish EGFP+ cells using a MoFlo XDP100 cell sorter at the CU SOM Cancer Center Flow Cytometry Shared Resource and collected in 1.7 ml FBS coated microcentrifuge tubes in 200 μl of 1X PBS. The Chromium Box from 10X Genomics was used to capture cells using Chromium Single Cell three prime Reagent Kit part no. PN 1000075. Libraries were sequenced on the Illumina NovaSEQ6000 Instrument. | Embryos were raised at 28.5°C in E3 media 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 at pH 7.4 with sodium bicarbonate sorted for good health and staged accordingly to developmental morphological features and hpf | developmental stage:48 hpf ZFIN ID: ZDB ALT 041129 8 | GSM4718658 | GSM4718658: scRNAseq olig2 eGFP 48hpf; Danio rerio; RNA Seq | GSM4718658 | 1 | 24 36 and 48 hpf Tgolig2:EGFP euthanized embryos were collected in 1.7 ml microcentrifuge tubes and deyolked in 100 μl of pre chilled Ca free Ringers solution 116 mM NaCl 2.6 mM KCl 5 mM HEPES pH 7.0 on ice. Embryos were pipetted intermittently with a p200 micropipettor for 15 minutes and left for 5 min. 500 μl of protease solution 10 mg/ml BI protease 125 U/ml DNase 2.5 mM EDTA 1X PBS was added to microcentrifuge tubes on ice for 15 min and embryos were homogenized every 3 min with a p100 micropipettor for 15 min. 200 μl of STOP solution 30% FBS 0.8 mM CaCl2 1X PBS was then mixed into the tubes. Samples were then spun down at 400g for 5 min at 4°C and supernatant was removed. On ice 1 ml of chilled suspension media 1% FBS 0.8 mM CaCl2 50 U/ml Penicillin 0.05 mg/ml Streptomycin was added to samples and then spun down again at 400g for 5 min at 4°C. Supernatant was removed and 400 μl of chilled suspension media was added and solution was filtered through a 35 μm strainer into a collection tube. Cells were FAC sorted to distinguish EGFP+ cells using a MoFlo XDP100 cell sorter at the CU SOM Cancer Center Flow Cytometry Shared Resource and collected in 1.7 ml FBS coated microcentrifuge tubes in 200 μl of 1X PBS. The Chromium Box from 10X Genomics was used to capture cells using Chromium Single Cell three prime Reagent Kit part no. PN 1000075. Libraries were sequenced on the Illumina NovaSEQ6000 Instrument. | GEO Accession:GSM4718658 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP276929 | olig2_egfp_48hpf_3_S43_L001_R2_001.fastq.gz olig2_egfp_48hpf_3_S43_L001_R1_001.fastq.gz | fastq fastq | 25591190986.0 | 84739043.0 | GSM4718658 r3 | 0:151 1:151 | A:8917343424;C:4797392797;G:4757647263;T:7118554564;N:252938 | 151 | 151 | 8917343424 | 4797392797 | 4757647263 | 7118554564 | 252938 | SRX8920145 | SRS7176693 | SRA1111061 | GEO | University of Colorado School of Medicine | 2 | 0.0 | 0.90089 | 0.0 | 0.2095 | 1.0 | 0.78078 | 0.53755 | 151 | 151 | T | B | mate1 technical by mapping diff | illumina | novaseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2020-08-10 | Hatching | Embryo | Spinal Cord | Nervous System | |||||||||||
| 60590 | 60590 | SRR12424281 | SRX8920145 | SRS7176693 | SRP276929 | PRJNA656271 | Single cell RNA seq analysis of pMN neural progenitors from zebrafish | GSE155988 | Transcriptome Analysis | The goal of this study was to identify distinct cell populations that arise from ventral spinal cord pMN progenitors. To do so we sorted fluorescently marked pMN cells obtained from Tgolig2:EGFP zebrafish embryos at 24 36 hpf and 48 hpf and performed 10X Chromium single cell RNA seq. Overall design: Three samples obtained from wild type zebrafish embryos at three developmental timepoints were analyzed. | pubmed:32680935 | scRNAseq olig2 eGFP 48hpf | GSM4718658 | tissue:spinal cord cells|developmental stage:48 hpf ZFIN ID: ZDB ALT 041129 8 | scRNAseq olig2 eGFP 48hpf | Raw sequencing reads were demultiplexed mapped to the zebrafish reference genome and summarized into gene expression matrices using CellRanger version 3.0.1 Count matrices were further filtered in Seurat 3.1.0 https://satijalab.org/seurat/ to remove cell barcodes with fewer than 250 detectable genes more than 5% of UMIs derived from mitochondrial genes or more than 50 000 UMIs to exclude putative doublets Standard Seurat normalization and PCA was run using the 1 291 most variable genes Applied Harmony https://doi.org/10.1038/s41592 019 0619 0 alignment theta = 2 to correct for inter sample variation chose 20 Harmony dimensions and applied Seurat UMAP reduction Genome build: GRCz11 Supplementary files format and content: gzipped csv file of matrix of normalized gene expression by cell for merged 3 scRNAseq samples Supplementary files format and content: gzipped csv file of metadata for cells | spinal cord cells | No treatment was applied to the samples. | 24 36 and 48 hpf Tgolig2:EGFP euthanized embryos were collected in 1.7 ml microcentrifuge tubes and deyolked in 100 μl of pre chilled Ca free Ringers solution 116 mM NaCl 2.6 mM KCl 5 mM HEPES pH 7.0 on ice. Embryos were pipetted intermittently with a p200 micropipettor for 15 minutes and left for 5 min. 500 μl of protease solution 10 mg/ml BI protease 125 U/ml DNase 2.5 mM EDTA 1X PBS was added to microcentrifuge tubes on ice for 15 min and embryos were homogenized every 3 min with a p100 micropipettor for 15 min. 200 μl of STOP solution 30% FBS 0.8 mM CaCl2 1X PBS was then mixed into the tubes. Samples were then spun down at 400g for 5 min at 4°C and supernatant was removed. On ice 1 ml of chilled suspension media 1% FBS 0.8 mM CaCl2 50 U/ml Penicillin 0.05 mg/ml Streptomycin was added to samples and then spun down again at 400g for 5 min at 4°C. Supernatant was removed and 400 μl of chilled suspension media was added and solution was filtered through a 35 μm strainer into a collection tube. Cells were FAC sorted to distinguish EGFP+ cells using a MoFlo XDP100 cell sorter at the CU SOM Cancer Center Flow Cytometry Shared Resource and collected in 1.7 ml FBS coated microcentrifuge tubes in 200 μl of 1X PBS. The Chromium Box from 10X Genomics was used to capture cells using Chromium Single Cell three prime Reagent Kit part no. PN 1000075. Libraries were sequenced on the Illumina NovaSEQ6000 Instrument. | Embryos were raised at 28.5°C in E3 media 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 at pH 7.4 with sodium bicarbonate sorted for good health and staged accordingly to developmental morphological features and hpf | developmental stage:48 hpf ZFIN ID: ZDB ALT 041129 8 | GSM4718658 | GSM4718658: scRNAseq olig2 eGFP 48hpf; Danio rerio; RNA Seq | GSM4718658 | 1 | 24 36 and 48 hpf Tgolig2:EGFP euthanized embryos were collected in 1.7 ml microcentrifuge tubes and deyolked in 100 μl of pre chilled Ca free Ringers solution 116 mM NaCl 2.6 mM KCl 5 mM HEPES pH 7.0 on ice. Embryos were pipetted intermittently with a p200 micropipettor for 15 minutes and left for 5 min. 500 μl of protease solution 10 mg/ml BI protease 125 U/ml DNase 2.5 mM EDTA 1X PBS was added to microcentrifuge tubes on ice for 15 min and embryos were homogenized every 3 min with a p100 micropipettor for 15 min. 200 μl of STOP solution 30% FBS 0.8 mM CaCl2 1X PBS was then mixed into the tubes. Samples were then spun down at 400g for 5 min at 4°C and supernatant was removed. On ice 1 ml of chilled suspension media 1% FBS 0.8 mM CaCl2 50 U/ml Penicillin 0.05 mg/ml Streptomycin was added to samples and then spun down again at 400g for 5 min at 4°C. Supernatant was removed and 400 μl of chilled suspension media was added and solution was filtered through a 35 μm strainer into a collection tube. Cells were FAC sorted to distinguish EGFP+ cells using a MoFlo XDP100 cell sorter at the CU SOM Cancer Center Flow Cytometry Shared Resource and collected in 1.7 ml FBS coated microcentrifuge tubes in 200 μl of 1X PBS. The Chromium Box from 10X Genomics was used to capture cells using Chromium Single Cell three prime Reagent Kit part no. PN 1000075. Libraries were sequenced on the Illumina NovaSEQ6000 Instrument. | GEO Accession:GSM4718658 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP276929 | olig2_egfp_48hpf_4_S44_L001_R1_001.fastq.gz olig2_egfp_48hpf_4_S44_L001_R2_001.fastq.gz | fastq fastq | 25546281170.0 | 84590335.0 | GSM4718658 r4 | 0:151 1:151 | A:8905009196;C:4774524700;G:4734395060;T:7132103501;N:248713 | 151 | 151 | 8905009196 | 4774524700 | 4734395060 | 7132103501 | 248713 | SRX8920145 | SRS7176693 | SRA1111061 | GEO | University of Colorado School of Medicine | 2 | 0.0 | 0.90169 | 0.0 | 0.21158 | 1.0 | 0.77697 | 0.54006 | 151 | 151 | T | B | mate1 technical by mapping diff | illumina | novaseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2020-08-10 | Hatching | Embryo | Spinal Cord | Nervous System | |||||||||||
| 60591 | 60591 | SRR12424274 | SRX8920144 | SRS7176692 | SRP276929 | PRJNA656271 | Single cell RNA seq analysis of pMN neural progenitors from zebrafish | GSE155988 | Transcriptome Analysis | The goal of this study was to identify distinct cell populations that arise from ventral spinal cord pMN progenitors. To do so we sorted fluorescently marked pMN cells obtained from Tgolig2:EGFP zebrafish embryos at 24 36 hpf and 48 hpf and performed 10X Chromium single cell RNA seq. Overall design: Three samples obtained from wild type zebrafish embryos at three developmental timepoints were analyzed. | pubmed:32680935 | scRNAseq olig2 eGFP 36hpf | GSM4718657 | tissue:spinal cord cells|developmental stage:36 hpf ZFIN ID: ZDB ALT 041129 8 | scRNAseq olig2 eGFP 36hpf | Raw sequencing reads were demultiplexed mapped to the zebrafish reference genome and summarized into gene expression matrices using CellRanger version 3.0.1 Count matrices were further filtered in Seurat 3.1.0 https://satijalab.org/seurat/ to remove cell barcodes with fewer than 250 detectable genes more than 5% of UMIs derived from mitochondrial genes or more than 50 000 UMIs to exclude putative doublets Standard Seurat normalization and PCA was run using the 1 291 most variable genes Applied Harmony https://doi.org/10.1038/s41592 019 0619 0 alignment theta = 2 to correct for inter sample variation chose 20 Harmony dimensions and applied Seurat UMAP reduction Genome build: GRCz11 Supplementary files format and content: gzipped csv file of matrix of normalized gene expression by cell for merged 3 scRNAseq samples Supplementary files format and content: gzipped csv file of metadata for cells | spinal cord cells | No treatment was applied to the samples. | 24 36 and 48 hpf Tgolig2:EGFP euthanized embryos were collected in 1.7 ml microcentrifuge tubes and deyolked in 100 μl of pre chilled Ca free Ringers solution 116 mM NaCl 2.6 mM KCl 5 mM HEPES pH 7.0 on ice. Embryos were pipetted intermittently with a p200 micropipettor for 15 minutes and left for 5 min. 500 μl of protease solution 10 mg/ml BI protease 125 U/ml DNase 2.5 mM EDTA 1X PBS was added to microcentrifuge tubes on ice for 15 min and embryos were homogenized every 3 min with a p100 micropipettor for 15 min. 200 μl of STOP solution 30% FBS 0.8 mM CaCl2 1X PBS was then mixed into the tubes. Samples were then spun down at 400g for 5 min at 4°C and supernatant was removed. On ice 1 ml of chilled suspension media 1% FBS 0.8 mM CaCl2 50 U/ml Penicillin 0.05 mg/ml Streptomycin was added to samples and then spun down again at 400g for 5 min at 4°C. Supernatant was removed and 400 μl of chilled suspension media was added and solution was filtered through a 35 μm strainer into a collection tube. Cells were FAC sorted to distinguish EGFP+ cells using a MoFlo XDP100 cell sorter at the CU SOM Cancer Center Flow Cytometry Shared Resource and collected in 1.7 ml FBS coated microcentrifuge tubes in 200 μl of 1X PBS. The Chromium Box from 10X Genomics was used to capture cells using Chromium Single Cell three prime Reagent Kit part no. PN 1000075. Libraries were sequenced on the Illumina NovaSEQ6000 Instrument. | Embryos were raised at 28.5°C in E3 media 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 at pH 7.4 with sodium bicarbonate sorted for good health and staged accordingly to developmental morphological features and hpf | developmental stage:36 hpf ZFIN ID: ZDB ALT 041129 8 | GSM4718657 | GSM4718657: scRNAseq olig2 eGFP 36hpf; Danio rerio; RNA Seq | GSM4718657 | 1 | 24 36 and 48 hpf Tgolig2:EGFP euthanized embryos were collected in 1.7 ml microcentrifuge tubes and deyolked in 100 μl of pre chilled Ca free Ringers solution 116 mM NaCl 2.6 mM KCl 5 mM HEPES pH 7.0 on ice. Embryos were pipetted intermittently with a p200 micropipettor for 15 minutes and left for 5 min. 500 μl of protease solution 10 mg/ml BI protease 125 U/ml DNase 2.5 mM EDTA 1X PBS was added to microcentrifuge tubes on ice for 15 min and embryos were homogenized every 3 min with a p100 micropipettor for 15 min. 200 μl of STOP solution 30% FBS 0.8 mM CaCl2 1X PBS was then mixed into the tubes. Samples were then spun down at 400g for 5 min at 4°C and supernatant was removed. On ice 1 ml of chilled suspension media 1% FBS 0.8 mM CaCl2 50 U/ml Penicillin 0.05 mg/ml Streptomycin was added to samples and then spun down again at 400g for 5 min at 4°C. Supernatant was removed and 400 μl of chilled suspension media was added and solution was filtered through a 35 μm strainer into a collection tube. Cells were FAC sorted to distinguish EGFP+ cells using a MoFlo XDP100 cell sorter at the CU SOM Cancer Center Flow Cytometry Shared Resource and collected in 1.7 ml FBS coated microcentrifuge tubes in 200 μl of 1X PBS. The Chromium Box from 10X Genomics was used to capture cells using Chromium Single Cell three prime Reagent Kit part no. PN 1000075. Libraries were sequenced on the Illumina NovaSEQ6000 Instrument. | GEO Accession:GSM4718657 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP276929 | Olig2_eGFP_36hfp_1_S69_L001_R1_001.fastq.gz Olig2_eGFP_36hfp_1_S69_L001_R2_001.fastq.gz | fastq fastq | 13366864582.0 | 44261141.0 | GSM4718657 r1 | 0:151 1:151 | A:3721647646;C:2385939960;G:3494552257;T:3764514262;N:210457 | 151 | 151 | 3721647646 | 2385939960 | 3494552257 | 3764514262 | 210457 | SRX8920144 | SRS7176692 | SRA1111061 | GEO | University of Colorado School of Medicine | 2 | 0.0 | 0.85449 | 0.0 | 0.08264 | 1.0 | 0.84086 | 0.50156 | 151 | 151 | T | B | mate1 technical by mapping diff | illumina | novaseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2020-08-10 | Pharyngula | Embryo | Spinal Cord | Nervous System | |||||||||||
| 60592 | 60592 | SRR12424275 | SRX8920144 | SRS7176692 | SRP276929 | PRJNA656271 | Single cell RNA seq analysis of pMN neural progenitors from zebrafish | GSE155988 | Transcriptome Analysis | The goal of this study was to identify distinct cell populations that arise from ventral spinal cord pMN progenitors. To do so we sorted fluorescently marked pMN cells obtained from Tgolig2:EGFP zebrafish embryos at 24 36 hpf and 48 hpf and performed 10X Chromium single cell RNA seq. Overall design: Three samples obtained from wild type zebrafish embryos at three developmental timepoints were analyzed. | pubmed:32680935 | scRNAseq olig2 eGFP 36hpf | GSM4718657 | tissue:spinal cord cells|developmental stage:36 hpf ZFIN ID: ZDB ALT 041129 8 | scRNAseq olig2 eGFP 36hpf | Raw sequencing reads were demultiplexed mapped to the zebrafish reference genome and summarized into gene expression matrices using CellRanger version 3.0.1 Count matrices were further filtered in Seurat 3.1.0 https://satijalab.org/seurat/ to remove cell barcodes with fewer than 250 detectable genes more than 5% of UMIs derived from mitochondrial genes or more than 50 000 UMIs to exclude putative doublets Standard Seurat normalization and PCA was run using the 1 291 most variable genes Applied Harmony https://doi.org/10.1038/s41592 019 0619 0 alignment theta = 2 to correct for inter sample variation chose 20 Harmony dimensions and applied Seurat UMAP reduction Genome build: GRCz11 Supplementary files format and content: gzipped csv file of matrix of normalized gene expression by cell for merged 3 scRNAseq samples Supplementary files format and content: gzipped csv file of metadata for cells | spinal cord cells | No treatment was applied to the samples. | 24 36 and 48 hpf Tgolig2:EGFP euthanized embryos were collected in 1.7 ml microcentrifuge tubes and deyolked in 100 μl of pre chilled Ca free Ringers solution 116 mM NaCl 2.6 mM KCl 5 mM HEPES pH 7.0 on ice. Embryos were pipetted intermittently with a p200 micropipettor for 15 minutes and left for 5 min. 500 μl of protease solution 10 mg/ml BI protease 125 U/ml DNase 2.5 mM EDTA 1X PBS was added to microcentrifuge tubes on ice for 15 min and embryos were homogenized every 3 min with a p100 micropipettor for 15 min. 200 μl of STOP solution 30% FBS 0.8 mM CaCl2 1X PBS was then mixed into the tubes. Samples were then spun down at 400g for 5 min at 4°C and supernatant was removed. On ice 1 ml of chilled suspension media 1% FBS 0.8 mM CaCl2 50 U/ml Penicillin 0.05 mg/ml Streptomycin was added to samples and then spun down again at 400g for 5 min at 4°C. Supernatant was removed and 400 μl of chilled suspension media was added and solution was filtered through a 35 μm strainer into a collection tube. Cells were FAC sorted to distinguish EGFP+ cells using a MoFlo XDP100 cell sorter at the CU SOM Cancer Center Flow Cytometry Shared Resource and collected in 1.7 ml FBS coated microcentrifuge tubes in 200 μl of 1X PBS. The Chromium Box from 10X Genomics was used to capture cells using Chromium Single Cell three prime Reagent Kit part no. PN 1000075. Libraries were sequenced on the Illumina NovaSEQ6000 Instrument. | Embryos were raised at 28.5°C in E3 media 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 at pH 7.4 with sodium bicarbonate sorted for good health and staged accordingly to developmental morphological features and hpf | developmental stage:36 hpf ZFIN ID: ZDB ALT 041129 8 | GSM4718657 | GSM4718657: scRNAseq olig2 eGFP 36hpf; Danio rerio; RNA Seq | GSM4718657 | 1 | 24 36 and 48 hpf Tgolig2:EGFP euthanized embryos were collected in 1.7 ml microcentrifuge tubes and deyolked in 100 μl of pre chilled Ca free Ringers solution 116 mM NaCl 2.6 mM KCl 5 mM HEPES pH 7.0 on ice. Embryos were pipetted intermittently with a p200 micropipettor for 15 minutes and left for 5 min. 500 μl of protease solution 10 mg/ml BI protease 125 U/ml DNase 2.5 mM EDTA 1X PBS was added to microcentrifuge tubes on ice for 15 min and embryos were homogenized every 3 min with a p100 micropipettor for 15 min. 200 μl of STOP solution 30% FBS 0.8 mM CaCl2 1X PBS was then mixed into the tubes. Samples were then spun down at 400g for 5 min at 4°C and supernatant was removed. On ice 1 ml of chilled suspension media 1% FBS 0.8 mM CaCl2 50 U/ml Penicillin 0.05 mg/ml Streptomycin was added to samples and then spun down again at 400g for 5 min at 4°C. Supernatant was removed and 400 μl of chilled suspension media was added and solution was filtered through a 35 μm strainer into a collection tube. Cells were FAC sorted to distinguish EGFP+ cells using a MoFlo XDP100 cell sorter at the CU SOM Cancer Center Flow Cytometry Shared Resource and collected in 1.7 ml FBS coated microcentrifuge tubes in 200 μl of 1X PBS. The Chromium Box from 10X Genomics was used to capture cells using Chromium Single Cell three prime Reagent Kit part no. PN 1000075. Libraries were sequenced on the Illumina NovaSEQ6000 Instrument. | GEO Accession:GSM4718657 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP276929 | Olig2_eGFP_36hfp_2_S70_L001_R1_001.fastq.gz Olig2_eGFP_36hfp_2_S70_L001_R2_001.fastq.gz | fastq fastq | 10606211914.0 | 35119907.0 | GSM4718657 r2 | 0:151 1:151 | A:2974656607;C:1869869441;G:2750621038;T:3010898673;N:166155 | 151 | 151 | 2974656607 | 1869869441 | 2750621038 | 3010898673 | 166155 | SRX8920144 | SRS7176692 | SRA1111061 | GEO | University of Colorado School of Medicine | 2 | 0.0 | 0.84822 | 0.0 | 0.08456 | 1.0 | 0.83719 | 0.51503 | 151 | 151 | T | B | mate1 technical by mapping diff | illumina | novaseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2020-08-10 | Pharyngula | Embryo | Spinal Cord | Nervous System | |||||||||||
| 60593 | 60593 | SRR12424276 | SRX8920144 | SRS7176692 | SRP276929 | PRJNA656271 | Single cell RNA seq analysis of pMN neural progenitors from zebrafish | GSE155988 | Transcriptome Analysis | The goal of this study was to identify distinct cell populations that arise from ventral spinal cord pMN progenitors. To do so we sorted fluorescently marked pMN cells obtained from Tgolig2:EGFP zebrafish embryos at 24 36 hpf and 48 hpf and performed 10X Chromium single cell RNA seq. Overall design: Three samples obtained from wild type zebrafish embryos at three developmental timepoints were analyzed. | pubmed:32680935 | scRNAseq olig2 eGFP 36hpf | GSM4718657 | tissue:spinal cord cells|developmental stage:36 hpf ZFIN ID: ZDB ALT 041129 8 | scRNAseq olig2 eGFP 36hpf | Raw sequencing reads were demultiplexed mapped to the zebrafish reference genome and summarized into gene expression matrices using CellRanger version 3.0.1 Count matrices were further filtered in Seurat 3.1.0 https://satijalab.org/seurat/ to remove cell barcodes with fewer than 250 detectable genes more than 5% of UMIs derived from mitochondrial genes or more than 50 000 UMIs to exclude putative doublets Standard Seurat normalization and PCA was run using the 1 291 most variable genes Applied Harmony https://doi.org/10.1038/s41592 019 0619 0 alignment theta = 2 to correct for inter sample variation chose 20 Harmony dimensions and applied Seurat UMAP reduction Genome build: GRCz11 Supplementary files format and content: gzipped csv file of matrix of normalized gene expression by cell for merged 3 scRNAseq samples Supplementary files format and content: gzipped csv file of metadata for cells | spinal cord cells | No treatment was applied to the samples. | 24 36 and 48 hpf Tgolig2:EGFP euthanized embryos were collected in 1.7 ml microcentrifuge tubes and deyolked in 100 μl of pre chilled Ca free Ringers solution 116 mM NaCl 2.6 mM KCl 5 mM HEPES pH 7.0 on ice. Embryos were pipetted intermittently with a p200 micropipettor for 15 minutes and left for 5 min. 500 μl of protease solution 10 mg/ml BI protease 125 U/ml DNase 2.5 mM EDTA 1X PBS was added to microcentrifuge tubes on ice for 15 min and embryos were homogenized every 3 min with a p100 micropipettor for 15 min. 200 μl of STOP solution 30% FBS 0.8 mM CaCl2 1X PBS was then mixed into the tubes. Samples were then spun down at 400g for 5 min at 4°C and supernatant was removed. On ice 1 ml of chilled suspension media 1% FBS 0.8 mM CaCl2 50 U/ml Penicillin 0.05 mg/ml Streptomycin was added to samples and then spun down again at 400g for 5 min at 4°C. Supernatant was removed and 400 μl of chilled suspension media was added and solution was filtered through a 35 μm strainer into a collection tube. Cells were FAC sorted to distinguish EGFP+ cells using a MoFlo XDP100 cell sorter at the CU SOM Cancer Center Flow Cytometry Shared Resource and collected in 1.7 ml FBS coated microcentrifuge tubes in 200 μl of 1X PBS. The Chromium Box from 10X Genomics was used to capture cells using Chromium Single Cell three prime Reagent Kit part no. PN 1000075. Libraries were sequenced on the Illumina NovaSEQ6000 Instrument. | Embryos were raised at 28.5°C in E3 media 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 at pH 7.4 with sodium bicarbonate sorted for good health and staged accordingly to developmental morphological features and hpf | developmental stage:36 hpf ZFIN ID: ZDB ALT 041129 8 | GSM4718657 | GSM4718657: scRNAseq olig2 eGFP 36hpf; Danio rerio; RNA Seq | GSM4718657 | 1 | 24 36 and 48 hpf Tgolig2:EGFP euthanized embryos were collected in 1.7 ml microcentrifuge tubes and deyolked in 100 μl of pre chilled Ca free Ringers solution 116 mM NaCl 2.6 mM KCl 5 mM HEPES pH 7.0 on ice. Embryos were pipetted intermittently with a p200 micropipettor for 15 minutes and left for 5 min. 500 μl of protease solution 10 mg/ml BI protease 125 U/ml DNase 2.5 mM EDTA 1X PBS was added to microcentrifuge tubes on ice for 15 min and embryos were homogenized every 3 min with a p100 micropipettor for 15 min. 200 μl of STOP solution 30% FBS 0.8 mM CaCl2 1X PBS was then mixed into the tubes. Samples were then spun down at 400g for 5 min at 4°C and supernatant was removed. On ice 1 ml of chilled suspension media 1% FBS 0.8 mM CaCl2 50 U/ml Penicillin 0.05 mg/ml Streptomycin was added to samples and then spun down again at 400g for 5 min at 4°C. Supernatant was removed and 400 μl of chilled suspension media was added and solution was filtered through a 35 μm strainer into a collection tube. Cells were FAC sorted to distinguish EGFP+ cells using a MoFlo XDP100 cell sorter at the CU SOM Cancer Center Flow Cytometry Shared Resource and collected in 1.7 ml FBS coated microcentrifuge tubes in 200 μl of 1X PBS. The Chromium Box from 10X Genomics was used to capture cells using Chromium Single Cell three prime Reagent Kit part no. PN 1000075. Libraries were sequenced on the Illumina NovaSEQ6000 Instrument. | GEO Accession:GSM4718657 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP276929 | Olig2_eGFP_36hfp_3_S71_L001_R1_001.fastq.gz Olig2_eGFP_36hfp_3_S71_L001_R2_001.fastq.gz | fastq fastq | 15614508642.0 | 51703671.0 | GSM4718657 r3 | 0:151 1:151 | A:4330312984;C:2826855730;G:4093245712;T:4363847925;N:246291 | 151 | 151 | 4330312984 | 2826855730 | 4093245712 | 4363847925 | 246291 | SRX8920144 | SRS7176692 | SRA1111061 | GEO | University of Colorado School of Medicine | 2 | 0.0 | 0.8543 | 0.0 | 0.08219 | 1.0 | 0.83727 | 0.51892 | 151 | 151 | T | B | mate1 technical by mapping diff | illumina | novaseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2020-08-10 | Pharyngula | Embryo | Spinal Cord | Nervous System | |||||||||||
| 60594 | 60594 | SRR12424277 | SRX8920144 | SRS7176692 | SRP276929 | PRJNA656271 | Single cell RNA seq analysis of pMN neural progenitors from zebrafish | GSE155988 | Transcriptome Analysis | The goal of this study was to identify distinct cell populations that arise from ventral spinal cord pMN progenitors. To do so we sorted fluorescently marked pMN cells obtained from Tgolig2:EGFP zebrafish embryos at 24 36 hpf and 48 hpf and performed 10X Chromium single cell RNA seq. Overall design: Three samples obtained from wild type zebrafish embryos at three developmental timepoints were analyzed. | pubmed:32680935 | scRNAseq olig2 eGFP 36hpf | GSM4718657 | tissue:spinal cord cells|developmental stage:36 hpf ZFIN ID: ZDB ALT 041129 8 | scRNAseq olig2 eGFP 36hpf | Raw sequencing reads were demultiplexed mapped to the zebrafish reference genome and summarized into gene expression matrices using CellRanger version 3.0.1 Count matrices were further filtered in Seurat 3.1.0 https://satijalab.org/seurat/ to remove cell barcodes with fewer than 250 detectable genes more than 5% of UMIs derived from mitochondrial genes or more than 50 000 UMIs to exclude putative doublets Standard Seurat normalization and PCA was run using the 1 291 most variable genes Applied Harmony https://doi.org/10.1038/s41592 019 0619 0 alignment theta = 2 to correct for inter sample variation chose 20 Harmony dimensions and applied Seurat UMAP reduction Genome build: GRCz11 Supplementary files format and content: gzipped csv file of matrix of normalized gene expression by cell for merged 3 scRNAseq samples Supplementary files format and content: gzipped csv file of metadata for cells | spinal cord cells | No treatment was applied to the samples. | 24 36 and 48 hpf Tgolig2:EGFP euthanized embryos were collected in 1.7 ml microcentrifuge tubes and deyolked in 100 μl of pre chilled Ca free Ringers solution 116 mM NaCl 2.6 mM KCl 5 mM HEPES pH 7.0 on ice. Embryos were pipetted intermittently with a p200 micropipettor for 15 minutes and left for 5 min. 500 μl of protease solution 10 mg/ml BI protease 125 U/ml DNase 2.5 mM EDTA 1X PBS was added to microcentrifuge tubes on ice for 15 min and embryos were homogenized every 3 min with a p100 micropipettor for 15 min. 200 μl of STOP solution 30% FBS 0.8 mM CaCl2 1X PBS was then mixed into the tubes. Samples were then spun down at 400g for 5 min at 4°C and supernatant was removed. On ice 1 ml of chilled suspension media 1% FBS 0.8 mM CaCl2 50 U/ml Penicillin 0.05 mg/ml Streptomycin was added to samples and then spun down again at 400g for 5 min at 4°C. Supernatant was removed and 400 μl of chilled suspension media was added and solution was filtered through a 35 μm strainer into a collection tube. Cells were FAC sorted to distinguish EGFP+ cells using a MoFlo XDP100 cell sorter at the CU SOM Cancer Center Flow Cytometry Shared Resource and collected in 1.7 ml FBS coated microcentrifuge tubes in 200 μl of 1X PBS. The Chromium Box from 10X Genomics was used to capture cells using Chromium Single Cell three prime Reagent Kit part no. PN 1000075. Libraries were sequenced on the Illumina NovaSEQ6000 Instrument. | Embryos were raised at 28.5°C in E3 media 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 at pH 7.4 with sodium bicarbonate sorted for good health and staged accordingly to developmental morphological features and hpf | developmental stage:36 hpf ZFIN ID: ZDB ALT 041129 8 | GSM4718657 | GSM4718657: scRNAseq olig2 eGFP 36hpf; Danio rerio; RNA Seq | GSM4718657 | 1 | 24 36 and 48 hpf Tgolig2:EGFP euthanized embryos were collected in 1.7 ml microcentrifuge tubes and deyolked in 100 μl of pre chilled Ca free Ringers solution 116 mM NaCl 2.6 mM KCl 5 mM HEPES pH 7.0 on ice. Embryos were pipetted intermittently with a p200 micropipettor for 15 minutes and left for 5 min. 500 μl of protease solution 10 mg/ml BI protease 125 U/ml DNase 2.5 mM EDTA 1X PBS was added to microcentrifuge tubes on ice for 15 min and embryos were homogenized every 3 min with a p100 micropipettor for 15 min. 200 μl of STOP solution 30% FBS 0.8 mM CaCl2 1X PBS was then mixed into the tubes. Samples were then spun down at 400g for 5 min at 4°C and supernatant was removed. On ice 1 ml of chilled suspension media 1% FBS 0.8 mM CaCl2 50 U/ml Penicillin 0.05 mg/ml Streptomycin was added to samples and then spun down again at 400g for 5 min at 4°C. Supernatant was removed and 400 μl of chilled suspension media was added and solution was filtered through a 35 μm strainer into a collection tube. Cells were FAC sorted to distinguish EGFP+ cells using a MoFlo XDP100 cell sorter at the CU SOM Cancer Center Flow Cytometry Shared Resource and collected in 1.7 ml FBS coated microcentrifuge tubes in 200 μl of 1X PBS. The Chromium Box from 10X Genomics was used to capture cells using Chromium Single Cell three prime Reagent Kit part no. PN 1000075. Libraries were sequenced on the Illumina NovaSEQ6000 Instrument. | GEO Accession:GSM4718657 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP276929 | Olig2_eGFP_36hfp_4_S72_L001_R1_001.fastq.gz Olig2_eGFP_36hfp_4_S72_L001_R2_001.fastq.gz | fastq fastq | 10707787198.0 | 35456249.0 | GSM4718657 r4 | 0:151 1:151 | A:2981466900;C:1909696186;G:2797297473;T:3019156550;N:170089 | 151 | 151 | 2981466900 | 1909696186 | 2797297473 | 3019156550 | 170089 | SRX8920144 | SRS7176692 | SRA1111061 | GEO | University of Colorado School of Medicine | 2 | 0.0 | 0.85466 | 0.0 | 0.08381 | 1.0 | 0.83562 | 0.51035 | 151 | 151 | T | B | mate1 technical by mapping diff | illumina | novaseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2020-08-10 | Pharyngula | Embryo | Spinal Cord | Nervous System | |||||||||||
| 60595 | 60595 | SRR12424270 | SRX8920143 | SRS7176691 | SRP276929 | PRJNA656271 | Single cell RNA seq analysis of pMN neural progenitors from zebrafish | GSE155988 | Transcriptome Analysis | The goal of this study was to identify distinct cell populations that arise from ventral spinal cord pMN progenitors. To do so we sorted fluorescently marked pMN cells obtained from Tgolig2:EGFP zebrafish embryos at 24 36 hpf and 48 hpf and performed 10X Chromium single cell RNA seq. Overall design: Three samples obtained from wild type zebrafish embryos at three developmental timepoints were analyzed. | pubmed:32680935 | scRNAseq olig2 eGFP 24hpf | GSM4718656 | tissue:spinal cord cells|developmental stage:24 hpf ZFIN ID: ZDB ALT 041129 8 | scRNAseq olig2 eGFP 24hpf | Raw sequencing reads were demultiplexed mapped to the zebrafish reference genome and summarized into gene expression matrices using CellRanger version 3.0.1 Count matrices were further filtered in Seurat 3.1.0 https://satijalab.org/seurat/ to remove cell barcodes with fewer than 250 detectable genes more than 5% of UMIs derived from mitochondrial genes or more than 50 000 UMIs to exclude putative doublets Standard Seurat normalization and PCA was run using the 1 291 most variable genes Applied Harmony https://doi.org/10.1038/s41592 019 0619 0 alignment theta = 2 to correct for inter sample variation chose 20 Harmony dimensions and applied Seurat UMAP reduction Genome build: GRCz11 Supplementary files format and content: gzipped csv file of matrix of normalized gene expression by cell for merged 3 scRNAseq samples Supplementary files format and content: gzipped csv file of metadata for cells | spinal cord cells | No treatment was applied to the samples. | 24 36 and 48 hpf Tgolig2:EGFP euthanized embryos were collected in 1.7 ml microcentrifuge tubes and deyolked in 100 μl of pre chilled Ca free Ringers solution 116 mM NaCl 2.6 mM KCl 5 mM HEPES pH 7.0 on ice. Embryos were pipetted intermittently with a p200 micropipettor for 15 minutes and left for 5 min. 500 μl of protease solution 10 mg/ml BI protease 125 U/ml DNase 2.5 mM EDTA 1X PBS was added to microcentrifuge tubes on ice for 15 min and embryos were homogenized every 3 min with a p100 micropipettor for 15 min. 200 μl of STOP solution 30% FBS 0.8 mM CaCl2 1X PBS was then mixed into the tubes. Samples were then spun down at 400g for 5 min at 4°C and supernatant was removed. On ice 1 ml of chilled suspension media 1% FBS 0.8 mM CaCl2 50 U/ml Penicillin 0.05 mg/ml Streptomycin was added to samples and then spun down again at 400g for 5 min at 4°C. Supernatant was removed and 400 μl of chilled suspension media was added and solution was filtered through a 35 μm strainer into a collection tube. Cells were FAC sorted to distinguish EGFP+ cells using a MoFlo XDP100 cell sorter at the CU SOM Cancer Center Flow Cytometry Shared Resource and collected in 1.7 ml FBS coated microcentrifuge tubes in 200 μl of 1X PBS. The Chromium Box from 10X Genomics was used to capture cells using Chromium Single Cell three prime Reagent Kit part no. PN 1000075. Libraries were sequenced on the Illumina NovaSEQ6000 Instrument. | Embryos were raised at 28.5°C in E3 media 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 at pH 7.4 with sodium bicarbonate sorted for good health and staged accordingly to developmental morphological features and hpf | developmental stage:24 hpf ZFIN ID: ZDB ALT 041129 8 | GSM4718656 | GSM4718656: scRNAseq olig2 eGFP 24hpf; Danio rerio; RNA Seq | GSM4718656 | 1 | 24 36 and 48 hpf Tgolig2:EGFP euthanized embryos were collected in 1.7 ml microcentrifuge tubes and deyolked in 100 μl of pre chilled Ca free Ringers solution 116 mM NaCl 2.6 mM KCl 5 mM HEPES pH 7.0 on ice. Embryos were pipetted intermittently with a p200 micropipettor for 15 minutes and left for 5 min. 500 μl of protease solution 10 mg/ml BI protease 125 U/ml DNase 2.5 mM EDTA 1X PBS was added to microcentrifuge tubes on ice for 15 min and embryos were homogenized every 3 min with a p100 micropipettor for 15 min. 200 μl of STOP solution 30% FBS 0.8 mM CaCl2 1X PBS was then mixed into the tubes. Samples were then spun down at 400g for 5 min at 4°C and supernatant was removed. On ice 1 ml of chilled suspension media 1% FBS 0.8 mM CaCl2 50 U/ml Penicillin 0.05 mg/ml Streptomycin was added to samples and then spun down again at 400g for 5 min at 4°C. Supernatant was removed and 400 μl of chilled suspension media was added and solution was filtered through a 35 μm strainer into a collection tube. Cells were FAC sorted to distinguish EGFP+ cells using a MoFlo XDP100 cell sorter at the CU SOM Cancer Center Flow Cytometry Shared Resource and collected in 1.7 ml FBS coated microcentrifuge tubes in 200 μl of 1X PBS. The Chromium Box from 10X Genomics was used to capture cells using Chromium Single Cell three prime Reagent Kit part no. PN 1000075. Libraries were sequenced on the Illumina NovaSEQ6000 Instrument. | GEO Accession:GSM4718656 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP276929 | Olig2_eGFP_24hfp_1_S10_L001_R1_001.fastq.gz Olig2_eGFP_24hfp_1_S10_L001_R2_001.fastq.gz | fastq fastq | 21279021170.0 | 70460335.0 | GSM4718656 r1 | 0:151 1:151 | A:5842145219;C:3712477572;G:5933108587;T:5790922441;N:367351 | 151 | 151 | 5842145219 | 3712477572 | 5933108587 | 5790922441 | 367351 | SRX8920143 | SRS7176691 | SRA1111061 | GEO | University of Colorado School of Medicine | 2 | 0.0 | 0.83071 | 0.0 | 0.06828 | 1.0 | 0.8406 | 0.5078 | 151 | 151 | T | B | mate1 technical by mapping diff | illumina | novaseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2020-08-10 | Pharyngula | Embryo | Spinal Cord | Nervous System | |||||||||||
| 60596 | 60596 | SRR12424271 | SRX8920143 | SRS7176691 | SRP276929 | PRJNA656271 | Single cell RNA seq analysis of pMN neural progenitors from zebrafish | GSE155988 | Transcriptome Analysis | The goal of this study was to identify distinct cell populations that arise from ventral spinal cord pMN progenitors. To do so we sorted fluorescently marked pMN cells obtained from Tgolig2:EGFP zebrafish embryos at 24 36 hpf and 48 hpf and performed 10X Chromium single cell RNA seq. Overall design: Three samples obtained from wild type zebrafish embryos at three developmental timepoints were analyzed. | pubmed:32680935 | scRNAseq olig2 eGFP 24hpf | GSM4718656 | tissue:spinal cord cells|developmental stage:24 hpf ZFIN ID: ZDB ALT 041129 8 | scRNAseq olig2 eGFP 24hpf | Raw sequencing reads were demultiplexed mapped to the zebrafish reference genome and summarized into gene expression matrices using CellRanger version 3.0.1 Count matrices were further filtered in Seurat 3.1.0 https://satijalab.org/seurat/ to remove cell barcodes with fewer than 250 detectable genes more than 5% of UMIs derived from mitochondrial genes or more than 50 000 UMIs to exclude putative doublets Standard Seurat normalization and PCA was run using the 1 291 most variable genes Applied Harmony https://doi.org/10.1038/s41592 019 0619 0 alignment theta = 2 to correct for inter sample variation chose 20 Harmony dimensions and applied Seurat UMAP reduction Genome build: GRCz11 Supplementary files format and content: gzipped csv file of matrix of normalized gene expression by cell for merged 3 scRNAseq samples Supplementary files format and content: gzipped csv file of metadata for cells | spinal cord cells | No treatment was applied to the samples. | 24 36 and 48 hpf Tgolig2:EGFP euthanized embryos were collected in 1.7 ml microcentrifuge tubes and deyolked in 100 μl of pre chilled Ca free Ringers solution 116 mM NaCl 2.6 mM KCl 5 mM HEPES pH 7.0 on ice. Embryos were pipetted intermittently with a p200 micropipettor for 15 minutes and left for 5 min. 500 μl of protease solution 10 mg/ml BI protease 125 U/ml DNase 2.5 mM EDTA 1X PBS was added to microcentrifuge tubes on ice for 15 min and embryos were homogenized every 3 min with a p100 micropipettor for 15 min. 200 μl of STOP solution 30% FBS 0.8 mM CaCl2 1X PBS was then mixed into the tubes. Samples were then spun down at 400g for 5 min at 4°C and supernatant was removed. On ice 1 ml of chilled suspension media 1% FBS 0.8 mM CaCl2 50 U/ml Penicillin 0.05 mg/ml Streptomycin was added to samples and then spun down again at 400g for 5 min at 4°C. Supernatant was removed and 400 μl of chilled suspension media was added and solution was filtered through a 35 μm strainer into a collection tube. Cells were FAC sorted to distinguish EGFP+ cells using a MoFlo XDP100 cell sorter at the CU SOM Cancer Center Flow Cytometry Shared Resource and collected in 1.7 ml FBS coated microcentrifuge tubes in 200 μl of 1X PBS. The Chromium Box from 10X Genomics was used to capture cells using Chromium Single Cell three prime Reagent Kit part no. PN 1000075. Libraries were sequenced on the Illumina NovaSEQ6000 Instrument. | Embryos were raised at 28.5°C in E3 media 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 at pH 7.4 with sodium bicarbonate sorted for good health and staged accordingly to developmental morphological features and hpf | developmental stage:24 hpf ZFIN ID: ZDB ALT 041129 8 | GSM4718656 | GSM4718656: scRNAseq olig2 eGFP 24hpf; Danio rerio; RNA Seq | GSM4718656 | 1 | 24 36 and 48 hpf Tgolig2:EGFP euthanized embryos were collected in 1.7 ml microcentrifuge tubes and deyolked in 100 μl of pre chilled Ca free Ringers solution 116 mM NaCl 2.6 mM KCl 5 mM HEPES pH 7.0 on ice. Embryos were pipetted intermittently with a p200 micropipettor for 15 minutes and left for 5 min. 500 μl of protease solution 10 mg/ml BI protease 125 U/ml DNase 2.5 mM EDTA 1X PBS was added to microcentrifuge tubes on ice for 15 min and embryos were homogenized every 3 min with a p100 micropipettor for 15 min. 200 μl of STOP solution 30% FBS 0.8 mM CaCl2 1X PBS was then mixed into the tubes. Samples were then spun down at 400g for 5 min at 4°C and supernatant was removed. On ice 1 ml of chilled suspension media 1% FBS 0.8 mM CaCl2 50 U/ml Penicillin 0.05 mg/ml Streptomycin was added to samples and then spun down again at 400g for 5 min at 4°C. Supernatant was removed and 400 μl of chilled suspension media was added and solution was filtered through a 35 μm strainer into a collection tube. Cells were FAC sorted to distinguish EGFP+ cells using a MoFlo XDP100 cell sorter at the CU SOM Cancer Center Flow Cytometry Shared Resource and collected in 1.7 ml FBS coated microcentrifuge tubes in 200 μl of 1X PBS. The Chromium Box from 10X Genomics was used to capture cells using Chromium Single Cell three prime Reagent Kit part no. PN 1000075. Libraries were sequenced on the Illumina NovaSEQ6000 Instrument. | GEO Accession:GSM4718656 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP276929 | Olig2_eGFP_24hfp_2_S20_L001_R1_001.fastq.gz Olig2_eGFP_24hfp_2_S20_L001_R2_001.fastq.gz | fastq fastq | 22414094210.0 | 74218855.0 | GSM4718656 r2 | 0:151 1:151 | A:6145677154;C:3904876630;G:6254105391;T:6109049174;N:385861 | 151 | 151 | 6145677154 | 3904876630 | 6254105391 | 6109049174 | 385861 | SRX8920143 | SRS7176691 | SRA1111061 | GEO | University of Colorado School of Medicine | 2 | 0.0 | 0.83148 | 0.0 | 0.06914 | 1.0 | 0.84033 | 0.49666 | 151 | 151 | T | B | mate1 technical by mapping diff | illumina | novaseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2020-08-10 | Pharyngula | Embryo | Spinal Cord | Nervous System | |||||||||||
| 60597 | 60597 | SRR12424272 | SRX8920143 | SRS7176691 | SRP276929 | PRJNA656271 | Single cell RNA seq analysis of pMN neural progenitors from zebrafish | GSE155988 | Transcriptome Analysis | The goal of this study was to identify distinct cell populations that arise from ventral spinal cord pMN progenitors. To do so we sorted fluorescently marked pMN cells obtained from Tgolig2:EGFP zebrafish embryos at 24 36 hpf and 48 hpf and performed 10X Chromium single cell RNA seq. Overall design: Three samples obtained from wild type zebrafish embryos at three developmental timepoints were analyzed. | pubmed:32680935 | scRNAseq olig2 eGFP 24hpf | GSM4718656 | tissue:spinal cord cells|developmental stage:24 hpf ZFIN ID: ZDB ALT 041129 8 | scRNAseq olig2 eGFP 24hpf | Raw sequencing reads were demultiplexed mapped to the zebrafish reference genome and summarized into gene expression matrices using CellRanger version 3.0.1 Count matrices were further filtered in Seurat 3.1.0 https://satijalab.org/seurat/ to remove cell barcodes with fewer than 250 detectable genes more than 5% of UMIs derived from mitochondrial genes or more than 50 000 UMIs to exclude putative doublets Standard Seurat normalization and PCA was run using the 1 291 most variable genes Applied Harmony https://doi.org/10.1038/s41592 019 0619 0 alignment theta = 2 to correct for inter sample variation chose 20 Harmony dimensions and applied Seurat UMAP reduction Genome build: GRCz11 Supplementary files format and content: gzipped csv file of matrix of normalized gene expression by cell for merged 3 scRNAseq samples Supplementary files format and content: gzipped csv file of metadata for cells | spinal cord cells | No treatment was applied to the samples. | 24 36 and 48 hpf Tgolig2:EGFP euthanized embryos were collected in 1.7 ml microcentrifuge tubes and deyolked in 100 μl of pre chilled Ca free Ringers solution 116 mM NaCl 2.6 mM KCl 5 mM HEPES pH 7.0 on ice. Embryos were pipetted intermittently with a p200 micropipettor for 15 minutes and left for 5 min. 500 μl of protease solution 10 mg/ml BI protease 125 U/ml DNase 2.5 mM EDTA 1X PBS was added to microcentrifuge tubes on ice for 15 min and embryos were homogenized every 3 min with a p100 micropipettor for 15 min. 200 μl of STOP solution 30% FBS 0.8 mM CaCl2 1X PBS was then mixed into the tubes. Samples were then spun down at 400g for 5 min at 4°C and supernatant was removed. On ice 1 ml of chilled suspension media 1% FBS 0.8 mM CaCl2 50 U/ml Penicillin 0.05 mg/ml Streptomycin was added to samples and then spun down again at 400g for 5 min at 4°C. Supernatant was removed and 400 μl of chilled suspension media was added and solution was filtered through a 35 μm strainer into a collection tube. Cells were FAC sorted to distinguish EGFP+ cells using a MoFlo XDP100 cell sorter at the CU SOM Cancer Center Flow Cytometry Shared Resource and collected in 1.7 ml FBS coated microcentrifuge tubes in 200 μl of 1X PBS. The Chromium Box from 10X Genomics was used to capture cells using Chromium Single Cell three prime Reagent Kit part no. PN 1000075. Libraries were sequenced on the Illumina NovaSEQ6000 Instrument. | Embryos were raised at 28.5°C in E3 media 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 at pH 7.4 with sodium bicarbonate sorted for good health and staged accordingly to developmental morphological features and hpf | developmental stage:24 hpf ZFIN ID: ZDB ALT 041129 8 | GSM4718656 | GSM4718656: scRNAseq olig2 eGFP 24hpf; Danio rerio; RNA Seq | GSM4718656 | 1 | 24 36 and 48 hpf Tgolig2:EGFP euthanized embryos were collected in 1.7 ml microcentrifuge tubes and deyolked in 100 μl of pre chilled Ca free Ringers solution 116 mM NaCl 2.6 mM KCl 5 mM HEPES pH 7.0 on ice. Embryos were pipetted intermittently with a p200 micropipettor for 15 minutes and left for 5 min. 500 μl of protease solution 10 mg/ml BI protease 125 U/ml DNase 2.5 mM EDTA 1X PBS was added to microcentrifuge tubes on ice for 15 min and embryos were homogenized every 3 min with a p100 micropipettor for 15 min. 200 μl of STOP solution 30% FBS 0.8 mM CaCl2 1X PBS was then mixed into the tubes. Samples were then spun down at 400g for 5 min at 4°C and supernatant was removed. On ice 1 ml of chilled suspension media 1% FBS 0.8 mM CaCl2 50 U/ml Penicillin 0.05 mg/ml Streptomycin was added to samples and then spun down again at 400g for 5 min at 4°C. Supernatant was removed and 400 μl of chilled suspension media was added and solution was filtered through a 35 μm strainer into a collection tube. Cells were FAC sorted to distinguish EGFP+ cells using a MoFlo XDP100 cell sorter at the CU SOM Cancer Center Flow Cytometry Shared Resource and collected in 1.7 ml FBS coated microcentrifuge tubes in 200 μl of 1X PBS. The Chromium Box from 10X Genomics was used to capture cells using Chromium Single Cell three prime Reagent Kit part no. PN 1000075. Libraries were sequenced on the Illumina NovaSEQ6000 Instrument. | GEO Accession:GSM4718656 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP276929 | Olig2_eGFP_24hfp_3_S30_L001_R1_001.fastq.gz Olig2_eGFP_24hfp_3_S30_L001_R2_001.fastq.gz | fastq fastq | 16406166006.0 | 54325053.0 | GSM4718656 r3 | 0:151 1:151 | A:4513103872;C:2865727260;G:4569430659;T:4457621166;N:283049 | 151 | 151 | 4513103872 | 2865727260 | 4569430659 | 4457621166 | 283049 | SRX8920143 | SRS7176691 | SRA1111061 | GEO | University of Colorado School of Medicine | 2 | 0.0 | 0.82928 | 0.0 | 0.06878 | 1.0 | 0.83989 | 0.4916 | 151 | 151 | T | B | mate1 technical by mapping diff | illumina | novaseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2020-08-10 | Pharyngula | Embryo | Spinal Cord | Nervous System | |||||||||||
| 60598 | 60598 | SRR12424273 | SRX8920143 | SRS7176691 | SRP276929 | PRJNA656271 | Single cell RNA seq analysis of pMN neural progenitors from zebrafish | GSE155988 | Transcriptome Analysis | The goal of this study was to identify distinct cell populations that arise from ventral spinal cord pMN progenitors. To do so we sorted fluorescently marked pMN cells obtained from Tgolig2:EGFP zebrafish embryos at 24 36 hpf and 48 hpf and performed 10X Chromium single cell RNA seq. Overall design: Three samples obtained from wild type zebrafish embryos at three developmental timepoints were analyzed. | pubmed:32680935 | scRNAseq olig2 eGFP 24hpf | GSM4718656 | tissue:spinal cord cells|developmental stage:24 hpf ZFIN ID: ZDB ALT 041129 8 | scRNAseq olig2 eGFP 24hpf | Raw sequencing reads were demultiplexed mapped to the zebrafish reference genome and summarized into gene expression matrices using CellRanger version 3.0.1 Count matrices were further filtered in Seurat 3.1.0 https://satijalab.org/seurat/ to remove cell barcodes with fewer than 250 detectable genes more than 5% of UMIs derived from mitochondrial genes or more than 50 000 UMIs to exclude putative doublets Standard Seurat normalization and PCA was run using the 1 291 most variable genes Applied Harmony https://doi.org/10.1038/s41592 019 0619 0 alignment theta = 2 to correct for inter sample variation chose 20 Harmony dimensions and applied Seurat UMAP reduction Genome build: GRCz11 Supplementary files format and content: gzipped csv file of matrix of normalized gene expression by cell for merged 3 scRNAseq samples Supplementary files format and content: gzipped csv file of metadata for cells | spinal cord cells | No treatment was applied to the samples. | 24 36 and 48 hpf Tgolig2:EGFP euthanized embryos were collected in 1.7 ml microcentrifuge tubes and deyolked in 100 μl of pre chilled Ca free Ringers solution 116 mM NaCl 2.6 mM KCl 5 mM HEPES pH 7.0 on ice. Embryos were pipetted intermittently with a p200 micropipettor for 15 minutes and left for 5 min. 500 μl of protease solution 10 mg/ml BI protease 125 U/ml DNase 2.5 mM EDTA 1X PBS was added to microcentrifuge tubes on ice for 15 min and embryos were homogenized every 3 min with a p100 micropipettor for 15 min. 200 μl of STOP solution 30% FBS 0.8 mM CaCl2 1X PBS was then mixed into the tubes. Samples were then spun down at 400g for 5 min at 4°C and supernatant was removed. On ice 1 ml of chilled suspension media 1% FBS 0.8 mM CaCl2 50 U/ml Penicillin 0.05 mg/ml Streptomycin was added to samples and then spun down again at 400g for 5 min at 4°C. Supernatant was removed and 400 μl of chilled suspension media was added and solution was filtered through a 35 μm strainer into a collection tube. Cells were FAC sorted to distinguish EGFP+ cells using a MoFlo XDP100 cell sorter at the CU SOM Cancer Center Flow Cytometry Shared Resource and collected in 1.7 ml FBS coated microcentrifuge tubes in 200 μl of 1X PBS. The Chromium Box from 10X Genomics was used to capture cells using Chromium Single Cell three prime Reagent Kit part no. PN 1000075. Libraries were sequenced on the Illumina NovaSEQ6000 Instrument. | Embryos were raised at 28.5°C in E3 media 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 at pH 7.4 with sodium bicarbonate sorted for good health and staged accordingly to developmental morphological features and hpf | developmental stage:24 hpf ZFIN ID: ZDB ALT 041129 8 | GSM4718656 | GSM4718656: scRNAseq olig2 eGFP 24hpf; Danio rerio; RNA Seq | GSM4718656 | 1 | 24 36 and 48 hpf Tgolig2:EGFP euthanized embryos were collected in 1.7 ml microcentrifuge tubes and deyolked in 100 μl of pre chilled Ca free Ringers solution 116 mM NaCl 2.6 mM KCl 5 mM HEPES pH 7.0 on ice. Embryos were pipetted intermittently with a p200 micropipettor for 15 minutes and left for 5 min. 500 μl of protease solution 10 mg/ml BI protease 125 U/ml DNase 2.5 mM EDTA 1X PBS was added to microcentrifuge tubes on ice for 15 min and embryos were homogenized every 3 min with a p100 micropipettor for 15 min. 200 μl of STOP solution 30% FBS 0.8 mM CaCl2 1X PBS was then mixed into the tubes. Samples were then spun down at 400g for 5 min at 4°C and supernatant was removed. On ice 1 ml of chilled suspension media 1% FBS 0.8 mM CaCl2 50 U/ml Penicillin 0.05 mg/ml Streptomycin was added to samples and then spun down again at 400g for 5 min at 4°C. Supernatant was removed and 400 μl of chilled suspension media was added and solution was filtered through a 35 μm strainer into a collection tube. Cells were FAC sorted to distinguish EGFP+ cells using a MoFlo XDP100 cell sorter at the CU SOM Cancer Center Flow Cytometry Shared Resource and collected in 1.7 ml FBS coated microcentrifuge tubes in 200 μl of 1X PBS. The Chromium Box from 10X Genomics was used to capture cells using Chromium Single Cell three prime Reagent Kit part no. PN 1000075. Libraries were sequenced on the Illumina NovaSEQ6000 Instrument. | GEO Accession:GSM4718656 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP276929 | Olig2_eGFP_24hfp_4_S40_L001_R1_001.fastq.gz Olig2_eGFP_24hfp_4_S40_L001_R2_001.fastq.gz | fastq fastq | 17382967792.0 | 57559496.0 | GSM4718656 r4 | 0:151 1:151 | A:4767137063;C:3044788720;G:4846983492;T:4723757048;N:301469 | 151 | 151 | 4767137063 | 3044788720 | 4846983492 | 4723757048 | 301469 | SRX8920143 | SRS7176691 | SRA1111061 | GEO | University of Colorado School of Medicine | 2 | 0.0 | 0.83084 | 0.0 | 0.06779 | 1.0 | 0.83948 | 0.49689 | 151 | 151 | T | B | mate1 technical by mapping diff | illumina | novaseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | United States | 2020-08-10 | Pharyngula | Embryo | Spinal Cord | Nervous System | |||||||||||
| 61886 | 61886 | SRR13074872 | SRX9521915 | SRS7729122 | SRP292929 | PRJNA678983 | Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell] | GSE161642 | Transcriptome Analysis | Spinal cord injury SCI results in loss of neurons oligodendrocytes and myelin sheaths all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres which leaves axons denuded impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals zebrafish can functionally regenerate the spinal cord. Yet little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here we report that in adult zebrafish SCI results in axonal oligodendrocyte and myelin sheath loss. We find that OPCs the oligodendorocyte progenitor cells survive the injury enter a reactive state proliferate and differentiate into oligodendrocytes. Concomitantly the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly global reduction of axonal tracts and partial re myelination relative to pre injury levels persist at later stages of regeneration yet suffices for functional recovery. Taken together these findings imply that in the zebrafish spinal cord OPCs replace lost oligodendrocytes and thus re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls. | parent bioproject:PRJNA679077 | pubmed:33158923 | SDPL.1X 01 D12 | GSM4911711 | source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl | SDPL.1X 01 D12 | Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters: gunzip A sam t 14 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 N 0 n 1 s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters: a EnsemblGene 87.GRCz10.TR.gtf s 0 Q 1 T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID Chromosome Gene Start Gene End Gene Length then all sample counts; comments start with '#' | OPC | Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction as previously described Becker et al. 1997 . Sham lesioned fish were treated equally except that the spinal cord was left intact. | Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks’ Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r… | age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl | GSM4911711 | GSM4911711: SDPL.1X 01 D12; Danio rerio; RNA Seq | GSM4911711 | 1 | Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r… | GEO Accession:GSM4911711 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP292929 | L31855_Track-65510_R1.fastq.gz | fastq | 34606372.0 | 455347.0 | GSM4911711 r1 | 0:76 1:0 | A:9797047;C:7514433;G:7529128;T:9765391;N:373 | 76 | 0 | 9797047 | 7514433 | 7529128 | 9765391 | 373 | SRX9521915 | SRS7729122 | SRA1160306 | GEO | Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden | 1 | 0.88569 | 0.07951 | 0.91212 | 0.42432 | 76 | B | usable mapping rate | illumina | nextseq | full_length | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | Germany | 2020-11-17 | Adult | Adult | Spinal Cord | Nervous System | ||||||||||||||||
| 61887 | 61887 | SRR13074871 | SRX9521914 | SRS7729121 | SRP292929 | PRJNA678983 | Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell] | GSE161642 | Transcriptome Analysis | Spinal cord injury SCI results in loss of neurons oligodendrocytes and myelin sheaths all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres which leaves axons denuded impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals zebrafish can functionally regenerate the spinal cord. Yet little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here we report that in adult zebrafish SCI results in axonal oligodendrocyte and myelin sheath loss. We find that OPCs the oligodendorocyte progenitor cells survive the injury enter a reactive state proliferate and differentiate into oligodendrocytes. Concomitantly the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly global reduction of axonal tracts and partial re myelination relative to pre injury levels persist at later stages of regeneration yet suffices for functional recovery. Taken together these findings imply that in the zebrafish spinal cord OPCs replace lost oligodendrocytes and thus re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls. | parent bioproject:PRJNA679077 | pubmed:33158923 | SDPL.1X 01 G10 | GSM4911710 | source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl | SDPL.1X 01 G10 | Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters: gunzip A sam t 14 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 N 0 n 1 s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters: a EnsemblGene 87.GRCz10.TR.gtf s 0 Q 1 T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID Chromosome Gene Start Gene End Gene Length then all sample counts; comments start with '#' | OPC | Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction as previously described Becker et al. 1997 . Sham lesioned fish were treated equally except that the spinal cord was left intact. | Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks’ Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r… | age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl | GSM4911710 | GSM4911710: SDPL.1X 01 G10; Danio rerio; RNA Seq | GSM4911710 | 1 | Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r… | GEO Accession:GSM4911710 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP292929 | L31846_Track-65507_R1.fastq.gz | fastq | 40850608.0 | 537508.0 | GSM4911710 r1 | 0:76 1:0 | A:11503051;C:8892746;G:8924384;T:11530029;N:398 | 76 | 0 | 11503051 | 8892746 | 8924384 | 11530029 | 398 | SRX9521914 | SRS7729121 | SRA1160306 | GEO | Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden | 1 | 0.87161 | 0.06824 | 0.94123 | 0.43306 | 76 | B | usable mapping rate | illumina | nextseq | full_length | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | Germany | 2020-11-17 | Adult | Adult | Spinal Cord | Nervous System | ||||||||||||||||
| 61888 | 61888 | SRR13074870 | SRX9521913 | SRS7729120 | SRP292929 | PRJNA678983 | Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell] | GSE161642 | Transcriptome Analysis | Spinal cord injury SCI results in loss of neurons oligodendrocytes and myelin sheaths all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres which leaves axons denuded impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals zebrafish can functionally regenerate the spinal cord. Yet little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here we report that in adult zebrafish SCI results in axonal oligodendrocyte and myelin sheath loss. We find that OPCs the oligodendorocyte progenitor cells survive the injury enter a reactive state proliferate and differentiate into oligodendrocytes. Concomitantly the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly global reduction of axonal tracts and partial re myelination relative to pre injury levels persist at later stages of regeneration yet suffices for functional recovery. Taken together these findings imply that in the zebrafish spinal cord OPCs replace lost oligodendrocytes and thus re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls. | parent bioproject:PRJNA679077 | pubmed:33158923 | SDPL.1X 01 E11 | GSM4911709 | source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl | SDPL.1X 01 E11 | Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters: gunzip A sam t 14 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 N 0 n 1 s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters: a EnsemblGene 87.GRCz10.TR.gtf s 0 Q 1 T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID Chromosome Gene Start Gene End Gene Length then all sample counts; comments start with '#' | OPC | Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction as previously described Becker et al. 1997 . Sham lesioned fish were treated equally except that the spinal cord was left intact. | Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks’ Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r… | age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl | GSM4911709 | GSM4911709: SDPL.1X 01 E11; Danio rerio; RNA Seq | GSM4911709 | 1 | Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r… | GEO Accession:GSM4911709 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP292929 | L31850_Track-65519_R1.fastq.gz | fastq | 50048660.0 | 658535.0 | GSM4911709 r1 | 0:76 1:0 | A:13622067;C:11406781;G:11303440;T:13715844;N:528 | 76 | 0 | 13622067 | 11406781 | 11303440 | 13715844 | 528 | SRX9521913 | SRS7729120 | SRA1160306 | GEO | Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden | 1 | 0.86014 | 0.09565 | 0.96252 | 0.45301 | 76 | B | usable mapping rate | illumina | nextseq | full_length | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | Germany | 2020-11-17 | Adult | Adult | Spinal Cord | Nervous System | ||||||||||||||||
| 61889 | 61889 | SRR13074869 | SRX9521912 | SRS7729119 | SRP292929 | PRJNA678983 | Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell] | GSE161642 | Transcriptome Analysis | Spinal cord injury SCI results in loss of neurons oligodendrocytes and myelin sheaths all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres which leaves axons denuded impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals zebrafish can functionally regenerate the spinal cord. Yet little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here we report that in adult zebrafish SCI results in axonal oligodendrocyte and myelin sheath loss. We find that OPCs the oligodendorocyte progenitor cells survive the injury enter a reactive state proliferate and differentiate into oligodendrocytes. Concomitantly the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly global reduction of axonal tracts and partial re myelination relative to pre injury levels persist at later stages of regeneration yet suffices for functional recovery. Taken together these findings imply that in the zebrafish spinal cord OPCs replace lost oligodendrocytes and thus re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls. | parent bioproject:PRJNA679077 | pubmed:33158923 | SDPL.1X 01 H10 | GSM4911708 | source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl | SDPL.1X 01 H10 | Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters: gunzip A sam t 14 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 N 0 n 1 s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters: a EnsemblGene 87.GRCz10.TR.gtf s 0 Q 1 T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID Chromosome Gene Start Gene End Gene Length then all sample counts; comments start with '#' | OPC | Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction as previously described Becker et al. 1997 . Sham lesioned fish were treated equally except that the spinal cord was left intact. | Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks’ Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r… | age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl | GSM4911708 | GSM4911708: SDPL.1X 01 H10; Danio rerio; RNA Seq | GSM4911708 | 1 | Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r… | GEO Accession:GSM4911708 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP292929 | L31847_Track-65513_R1.fastq.gz | fastq | 54199552.0 | 713152.0 | GSM4911708 r1 | 0:76 1:0 | A:14613140;C:12664231;G:12481214;T:14440413;N:554 | 76 | 0 | 14613140 | 12664231 | 12481214 | 14440413 | 554 | SRX9521912 | SRS7729119 | SRA1160306 | GEO | Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden | 1 | 0.83847 | 0.0463 | 0.95465 | 0.4661 | 76 | B | usable mapping rate | illumina | nextseq | full_length | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | Germany | 2020-11-17 | Adult | Adult | Spinal Cord | Nervous System | ||||||||||||||||
| 61890 | 61890 | SRR13074868 | SRX9521911 | SRS7729118 | SRP292929 | PRJNA678983 | Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell] | GSE161642 | Transcriptome Analysis | Spinal cord injury SCI results in loss of neurons oligodendrocytes and myelin sheaths all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres which leaves axons denuded impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals zebrafish can functionally regenerate the spinal cord. Yet little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here we report that in adult zebrafish SCI results in axonal oligodendrocyte and myelin sheath loss. We find that OPCs the oligodendorocyte progenitor cells survive the injury enter a reactive state proliferate and differentiate into oligodendrocytes. Concomitantly the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly global reduction of axonal tracts and partial re myelination relative to pre injury levels persist at later stages of regeneration yet suffices for functional recovery. Taken together these findings imply that in the zebrafish spinal cord OPCs replace lost oligodendrocytes and thus re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls. | parent bioproject:PRJNA679077 | pubmed:33158923 | SDPL.1X 01 C11 | GSM4911707 | source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl | SDPL.1X 01 C11 | Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters: gunzip A sam t 14 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 N 0 n 1 s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters: a EnsemblGene 87.GRCz10.TR.gtf s 0 Q 1 T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID Chromosome Gene Start Gene End Gene Length then all sample counts; comments start with '#' | OPC | Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction as previously described Becker et al. 1997 . Sham lesioned fish were treated equally except that the spinal cord was left intact. | Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks’ Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r… | age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl | GSM4911707 | GSM4911707: SDPL.1X 01 C11; Danio rerio; RNA Seq | GSM4911707 | 1 | Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r… | GEO Accession:GSM4911707 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP292929 | L31848_Track-65516_R1.fastq.gz | fastq | 50085216.0 | 659016.0 | GSM4911707 r1 | 0:76 1:0 | A:13748335;C:11332042;G:11277617;T:13726702;N:520 | 76 | 0 | 13748335 | 11332042 | 11277617 | 13726702 | 520 | SRX9521911 | SRS7729118 | SRA1160306 | GEO | Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden | 1 | 0.85163 | 0.06643 | 0.94866 | 0.41876 | 76 | B | usable mapping rate | illumina | nextseq | full_length | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | Germany | 2020-11-17 | Adult | Adult | Spinal Cord | Nervous System | ||||||||||||||||
| 61891 | 61891 | SRR13074867 | SRX9521910 | SRS7729116 | SRP292929 | PRJNA678983 | Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell] | GSE161642 | Transcriptome Analysis | Spinal cord injury SCI results in loss of neurons oligodendrocytes and myelin sheaths all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres which leaves axons denuded impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals zebrafish can functionally regenerate the spinal cord. Yet little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here we report that in adult zebrafish SCI results in axonal oligodendrocyte and myelin sheath loss. We find that OPCs the oligodendorocyte progenitor cells survive the injury enter a reactive state proliferate and differentiate into oligodendrocytes. Concomitantly the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly global reduction of axonal tracts and partial re myelination relative to pre injury levels persist at later stages of regeneration yet suffices for functional recovery. Taken together these findings imply that in the zebrafish spinal cord OPCs replace lost oligodendrocytes and thus re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls. | parent bioproject:PRJNA679077 | pubmed:33158923 | SDPL.1X 01 F10 | GSM4911706 | source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl | SDPL.1X 01 F10 | Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters: gunzip A sam t 14 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 N 0 n 1 s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters: a EnsemblGene 87.GRCz10.TR.gtf s 0 Q 1 T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID Chromosome Gene Start Gene End Gene Length then all sample counts; comments start with '#' | OPC | Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction as previously described Becker et al. 1997 . Sham lesioned fish were treated equally except that the spinal cord was left intact. | Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks’ Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r… | age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl | GSM4911706 | GSM4911706: SDPL.1X 01 F10; Danio rerio; RNA Seq | GSM4911706 | 1 | Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r… | GEO Accession:GSM4911706 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP292929 | L31845_Track-65521_R1.fastq.gz | fastq | 62281620.0 | 819495.0 | GSM4911706 r1 | 0:76 1:0 | A:17609719;C:13581841;G:13554360;T:17535048;N:652 | 76 | 0 | 17609719 | 13581841 | 13554360 | 17535048 | 652 | SRX9521910 | SRS7729116 | SRA1160306 | GEO | Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden | 1 | 0.888 | 0.07076 | 0.94373 | 0.40445 | 76 | B | usable mapping rate | illumina | nextseq | full_length | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | Germany | 2020-11-17 | Adult | Adult | Spinal Cord | Nervous System | ||||||||||||||||
| 61892 | 61892 | SRR13074866 | SRX9521909 | SRS7729117 | SRP292929 | PRJNA678983 | Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell] | GSE161642 | Transcriptome Analysis | Spinal cord injury SCI results in loss of neurons oligodendrocytes and myelin sheaths all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres which leaves axons denuded impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals zebrafish can functionally regenerate the spinal cord. Yet little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here we report that in adult zebrafish SCI results in axonal oligodendrocyte and myelin sheath loss. We find that OPCs the oligodendorocyte progenitor cells survive the injury enter a reactive state proliferate and differentiate into oligodendrocytes. Concomitantly the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly global reduction of axonal tracts and partial re myelination relative to pre injury levels persist at later stages of regeneration yet suffices for functional recovery. Taken together these findings imply that in the zebrafish spinal cord OPCs replace lost oligodendrocytes and thus re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls. | parent bioproject:PRJNA679077 | pubmed:33158923 | SDPL.1X 01 D10 | GSM4911705 | source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl | SDPL.1X 01 D10 | Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters: gunzip A sam t 14 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 N 0 n 1 s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters: a EnsemblGene 87.GRCz10.TR.gtf s 0 Q 1 T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID Chromosome Gene Start Gene End Gene Length then all sample counts; comments start with '#' | OPC | Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction as previously described Becker et al. 1997 . Sham lesioned fish were treated equally except that the spinal cord was left intact. | Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks’ Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r… | age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl | GSM4911705 | GSM4911705: SDPL.1X 01 D10; Danio rerio; RNA Seq | GSM4911705 | 1 | Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r… | GEO Accession:GSM4911705 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP292929 | L31843_Track-65494_R1.fastq.gz | fastq | 50016664.0 | 658114.0 | GSM4911705 r1 | 0:76 1:0 | A:13556216;C:11587501;G:11405855;T:13466527;N:565 | 76 | 0 | 13556216 | 11587501 | 11405855 | 13466527 | 565 | SRX9521909 | SRS7729117 | SRA1160306 | GEO | Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden | 1 | 0.86173 | 0.07254 | 0.9585 | 0.4398 | 76 | B | usable mapping rate | illumina | nextseq | full_length | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | Germany | 2020-11-17 | Adult | Adult | Spinal Cord | Nervous System | ||||||||||||||||
| 61893 | 61893 | SRR13074865 | SRX9521908 | SRS7729115 | SRP292929 | PRJNA678983 | Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell] | GSE161642 | Transcriptome Analysis | Spinal cord injury SCI results in loss of neurons oligodendrocytes and myelin sheaths all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres which leaves axons denuded impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals zebrafish can functionally regenerate the spinal cord. Yet little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here we report that in adult zebrafish SCI results in axonal oligodendrocyte and myelin sheath loss. We find that OPCs the oligodendorocyte progenitor cells survive the injury enter a reactive state proliferate and differentiate into oligodendrocytes. Concomitantly the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly global reduction of axonal tracts and partial re myelination relative to pre injury levels persist at later stages of regeneration yet suffices for functional recovery. Taken together these findings imply that in the zebrafish spinal cord OPCs replace lost oligodendrocytes and thus re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls. | parent bioproject:PRJNA679077 | pubmed:33158923 | SDPL.1X 01 H09 | GSM4911704 | source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl | SDPL.1X 01 H09 | Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters: gunzip A sam t 14 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 N 0 n 1 s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters: a EnsemblGene 87.GRCz10.TR.gtf s 0 Q 1 T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID Chromosome Gene Start Gene End Gene Length then all sample counts; comments start with '#' | OPC | Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction as previously described Becker et al. 1997 . Sham lesioned fish were treated equally except that the spinal cord was left intact. | Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks’ Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r… | age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:7 dpl | GSM4911704 | GSM4911704: SDPL.1X 01 H09; Danio rerio; RNA Seq | GSM4911704 | 1 | Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r… | GEO Accession:GSM4911704 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP292929 | L31841_Track-65517_R1.fastq.gz | fastq | 57497800.0 | 756550.0 | GSM4911704 r1 | 0:76 1:0 | A:15234361;C:13740258;G:13485376;T:15037204;N:601 | 76 | 0 | 15234361 | 13740258 | 13485376 | 15037204 | 601 | SRX9521908 | SRS7729115 | SRA1160306 | GEO | Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden | 1 | 0.80337 | 0.07149 | 0.96197 | 0.46562 | 76 | B | usable mapping rate | illumina | nextseq | full_length | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | Germany | 2020-11-17 | Adult | Adult | Spinal Cord | Nervous System |
Advanced export
JSON shape: default, array, newline-delimited
CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;