metadata: run_metadata: 26 rows where experiment.library_selection = "cDNA", experiment.library_source = "TRANSCRIPTOMIC" and technology = "iclip"

26 rows where experiment.library_selection = "cDNA", experiment.library_source = "TRANSCRIPTOMIC" and technology = "iclip"

descending

Link	rowid ▼	run.accession	experiment.accession	sample.accession	study.accession	bioproject	study.title	study.alias	study.type	study.abstract	study.PMIDs	sample.title	sample.alias	sample.attributes	GEOsample.title	GEOsample.dataprocessing	GEOsample.source	GEOsample.treatmentprotocol	GEOsample.extractprotocol	GEOsample.growthprotocol	GEOsample.characteristics	GEOsample.accession	experiment.title	experiment.alias	experiment.design_description	experiment.library_construction_protocol	experiment.attributes	experiment.library_strategy	experiment.library_source	experiment.library_selection	experiment.library_layout	experiment.platform	experiment.instrument_model	experiment.study_ref	run.filename	run.semantic_name	run.total_bases	run.total_spots	run.alias	run.read_lengths	run.base_counts	run.r1_length	run.r2_length	run.Acount	run.Ccount	run.Gcount	run.Tcount	run.Ncount	run.experiment	run.pool_member	submission.accession	submission.srasource	submission.bioprojectsource	seqdetective.n_mates	seqdetective.mapping_rate.mate1	seqdetective.mapping_rate.mate2	seqdetective.nofeature_rate.mate1	seqdetective.nofeature_rate.mate2	seqdetective.sparsity.mate1	seqdetective.sparsity.mate2	seqdetective.pos_strand_rate.mate1	seqdetective.pos_strand_rate.mate2	seqdetective.readlen.mate1	seqdetective.readlen.mate2	seqdetective.judgement.mate1	seqdetective.judgement.mate2	seqdetective.judgement.reason	platform_family	instrument_generation	read_bias	selection_class	prep_kit	sc_or_bulk	tech_class	technology	submission.bioprojectsource.country	earliest_date	devstage_curation	devstage_curation_coarse	tissue_curation	tissue_curation_coarse
41262	41262	SRR4026154	SRX2018187	SRS1614128	SRP081553	PRJNA338793	Characterization of genetic loss of function of Fus in zebrafish	GSE85554	Transcriptome Analysis	The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates.	pubmed:27898262	FUS KO 6	GSM2277123	source name:adult female brain\|tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:FUS KO	FUS KO 6	RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an…	adult female brain	The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips.	tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:FUS KO	GSM2277123	GSM2277123: FUS KO 6; Danio rerio; RNA Seq	GSM2277123	1	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	GEO Accession:GSM2277123	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP081553	Sample_imb_ketting_2014_13_FUS_KO_6_R1.fastq.gz Sample_imb_ketting_2014_13_FUS_KO_6_R2.fastq.gz	fastq fastq	7975498532.0	39482666.0	GSM2277123 r1	0:101 1:101	A:2277361634;C:1708878425;G:1702517993;T:2283731854;N:3008626	101	101	2277361634	1708878425	1702517993	2283731854	3008626	SRX2018187	SRS1614128	SRA451974	GEO	Rene Ketting, Institute of Molecular Biology	2	0.92046	0.9235	0.18223	0.18163	0.68866	0.68927	0.48519	0.47059	101	101	B	B	biological fallback assumption	illumina	hiseq_era	3prime	poly_a	trueseq	bulk	clip	iclip	Germany	2016-08-12	Adult	Adult	Brain	Nervous System
41263	41263	SRR4026155	SRX2018187	SRS1614128	SRP081553	PRJNA338793	Characterization of genetic loss of function of Fus in zebrafish	GSE85554	Transcriptome Analysis	The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates.	pubmed:27898262	FUS KO 6	GSM2277123	source name:adult female brain\|tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:FUS KO	FUS KO 6	RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an…	adult female brain	The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips.	tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:FUS KO	GSM2277123	GSM2277123: FUS KO 6; Danio rerio; RNA Seq	GSM2277123	1	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	GEO Accession:GSM2277123	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP081553	FUS_KO_6_R1.fastq.gz FUS_KO_6_R2.fastq.gz	fastq fastq	7173346028.0	35511614.0	GSM2277123 r2	0:101 1:101	A:1991537753;C:1595400788;G:1586024536;T:1997441866;N:2941085	101	101	1991537753	1595400788	1586024536	1997441866	2941085	SRX2018187	SRS1614128	SRA451974	GEO	Rene Ketting, Institute of Molecular Biology	2	0.93379	0.93701	0.16593	0.1657	0.68517	0.68558	0.49349	0.49229	101	101	B	B	biological fallback assumption	illumina	hiseq_era	3prime	poly_a	trueseq	bulk	clip	iclip	Germany	2016-08-12	Adult	Adult	Brain	Nervous System
41264	41264	SRR4026152	SRX2018186	SRS1614129	SRP081553	PRJNA338793	Characterization of genetic loss of function of Fus in zebrafish	GSE85554	Transcriptome Analysis	The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates.	pubmed:27898262	FUS KO 5	GSM2277122	source name:adult female brain\|tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:FUS KO	FUS KO 5	RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an…	adult female brain	The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips.	tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:FUS KO	GSM2277122	GSM2277122: FUS KO 5; Danio rerio; RNA Seq	GSM2277122	1	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	GEO Accession:GSM2277122	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP081553	Sample_imb_ketting_2014_13_FUS_KO_5_R1.fastq.gz Sample_imb_ketting_2014_13_FUS_KO_5_R2.fastq.gz	fastq fastq	7478598328.0	37022764.0	GSM2277122 r1	0:101 1:101	A:2133855925;C:1603288158;G:1598612742;T:2140065375;N:2776128	101	101	2133855925	1603288158	1598612742	2140065375	2776128	SRX2018186	SRS1614129	SRA451974	GEO	Rene Ketting, Institute of Molecular Biology	2	0.9197	0.92307	0.17221	0.17171	0.68578	0.68586	0.49581	0.50519	101	101	B	B	biological fallback assumption	illumina	hiseq_era	3prime	poly_a	trueseq	bulk	clip	iclip	Germany	2016-08-12	Adult	Adult	Brain	Nervous System
41265	41265	SRR4026153	SRX2018186	SRS1614129	SRP081553	PRJNA338793	Characterization of genetic loss of function of Fus in zebrafish	GSE85554	Transcriptome Analysis	The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates.	pubmed:27898262	FUS KO 5	GSM2277122	source name:adult female brain\|tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:FUS KO	FUS KO 5	RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an…	adult female brain	The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips.	tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:FUS KO	GSM2277122	GSM2277122: FUS KO 5; Danio rerio; RNA Seq	GSM2277122	1	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	GEO Accession:GSM2277122	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP081553	FUS_KO_5_R1.fastq.gz FUS_KO_5_R2.fastq.gz	fastq fastq	6719087822.0	33262811.0	GSM2277122 r2	0:101 1:101	A:1785013612;C:1574089873;G:1572290158;T:1784978560;N:2715619	101	101	1785013612	1574089873	1572290158	1784978560	2715619	SRX2018186	SRS1614129	SRA451974	GEO	Rene Ketting, Institute of Molecular Biology	2	0.94652	0.94901	0.12756	0.12603	0.67834	0.6789	0.50281	0.50397	101	101	B	B	biological fallback assumption	illumina	hiseq_era	3prime	poly_a	trueseq	bulk	clip	iclip	Germany	2016-08-12	Adult	Adult	Brain	Nervous System
41266	41266	SRR4026151	SRX2018185	SRS1614126	SRP081553	PRJNA338793	Characterization of genetic loss of function of Fus in zebrafish	GSE85554	Transcriptome Analysis	The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates.	pubmed:27898262	FUS KO 3	GSM2277121	source name:adult female brain\|tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:FUS KO	FUS KO 3	RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an…	adult female brain	The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips.	tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:FUS KO	GSM2277121	GSM2277121: FUS KO 3; Danio rerio; RNA Seq	GSM2277121	1	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	GEO Accession:GSM2277121	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP081553	Sample_imb_ketting_2014_13_FUS_KO_3_R1.fastq.gz Sample_imb_ketting_2014_13_FUS_KO_3_R2.fastq.gz	fastq fastq	7443582840.0	36849420.0	GSM2277121 r1	0:101 1:101	A:2135476546;C:1584607182;G:1583492766;T:2137210756;N:2795590	101	101	2135476546	1584607182	1583492766	2137210756	2795590	SRX2018185	SRS1614126	SRA451974	GEO	Rene Ketting, Institute of Molecular Biology	2	0.91865	0.92202	0.16917	0.16765	0.69402	0.69424	0.49158	0.505	101	101	B	B	biological fallback assumption	illumina	hiseq_era	3prime	poly_a	trueseq	bulk	clip	iclip	Germany	2016-08-12	Adult	Adult	Brain	Nervous System
41267	41267	SRR4026149	SRX2018184	SRS1614127	SRP081553	PRJNA338793	Characterization of genetic loss of function of Fus in zebrafish	GSE85554	Transcriptome Analysis	The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates.	pubmed:27898262	FUS KO 2	GSM2277120	source name:adult female brain\|tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:FUS KO	FUS KO 2	RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an…	adult female brain	The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips.	tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:FUS KO	GSM2277120	GSM2277120: FUS KO 2; Danio rerio; RNA Seq	GSM2277120	1	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	GEO Accession:GSM2277120	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP081553	Sample_imb_ketting_2014_13_FUS_KO_2_R1.fastq.gz Sample_imb_ketting_2014_13_FUS_KO_2_R2.fastq.gz	fastq fastq	7538568694.0	37319647.0	GSM2277120 r1	0:101 1:101	A:2147431018;C:1618323797;G:1622221747;T:2147775519;N:2816613	101	101	2147431018	1618323797	1622221747	2147775519	2816613	SRX2018184	SRS1614127	SRA451974	GEO	Rene Ketting, Institute of Molecular Biology	2	0.92241	0.92545	0.17277	0.17289	0.6882	0.68878	0.50153	0.49587	101	101	B	B	biological fallback assumption	illumina	hiseq_era	3prime	poly_a	trueseq	bulk	clip	iclip	Germany	2016-08-12	Adult	Adult	Brain	Nervous System
41268	41268	SRR4026150	SRX2018184	SRS1614127	SRP081553	PRJNA338793	Characterization of genetic loss of function of Fus in zebrafish	GSE85554	Transcriptome Analysis	The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates.	pubmed:27898262	FUS KO 2	GSM2277120	source name:adult female brain\|tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:FUS KO	FUS KO 2	RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an…	adult female brain	The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips.	tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:FUS KO	GSM2277120	GSM2277120: FUS KO 2; Danio rerio; RNA Seq	GSM2277120	1	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	GEO Accession:GSM2277120	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP081553	FUS_KO_2_R1.fastq.gz FUS_KO_2_R2.fastq.gz	fastq fastq	6447010386.0	31915893.0	GSM2277120 r2	0:101 1:101	A:1836751010;C:1386222757;G:1379853653;T:1841581040;N:2601926	101	101	1836751010	1386222757	1379853653	1841581040	2601926	SRX2018184	SRS1614127	SRA451974	GEO	Rene Ketting, Institute of Molecular Biology	2	0.92533	0.92991	0.17619	0.17625	0.69031	0.69081	0.49983	0.50191	101	101	B	B	biological fallback assumption	illumina	hiseq_era	3prime	poly_a	trueseq	bulk	clip	iclip	Germany	2016-08-12	Adult	Adult	Brain	Nervous System
41269	41269	SRR4026148	SRX2018183	SRS1614125	SRP081553	PRJNA338793	Characterization of genetic loss of function of Fus in zebrafish	GSE85554	Transcriptome Analysis	The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates.	pubmed:27898262	FUS KO 1	GSM2277119	source name:adult female brain\|tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:FUS KO	FUS KO 1	RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an…	adult female brain	The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips.	tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:FUS KO	GSM2277119	GSM2277119: FUS KO 1; Danio rerio; RNA Seq	GSM2277119	1	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	GEO Accession:GSM2277119	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP081553	FUS_KO_1_R1.fastq.gz FUS_KO_1_R2.fastq.gz	fastq fastq	7395102840.0	36609420.0	GSM2277119 r1	0:101 1:101	A:2103771703;C:1595017984;G:1583980946;T:2109307704;N:3024503	101	101	2103771703	1595017984	1583980946	2109307704	3024503	SRX2018183	SRS1614125	SRA451974	GEO	Rene Ketting, Institute of Molecular Biology	2	0.9246	0.92781	0.17577	0.17518	0.69116	0.69232	0.50228	0.49896	101	101	B	B	biological fallback assumption	illumina	hiseq_era	3prime	poly_a	trueseq	bulk	clip	iclip	Germany	2016-08-12	Adult	Adult	Brain	Nervous System
41270	41270	SRR4026146	SRX2018182	SRS1614123	SRP081553	PRJNA338793	Characterization of genetic loss of function of Fus in zebrafish	GSE85554	Transcriptome Analysis	The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates.	pubmed:27898262	WT 6	GSM2277118	source name:adult female brain\|tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:wild type	WT 6	RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an…	adult female brain	The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips.	tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:wild type	GSM2277118	GSM2277118: WT 6; Danio rerio; RNA Seq	GSM2277118	1	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	GEO Accession:GSM2277118	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP081553	Sample_imb_ketting_2014_13_WT_6_R1.fastq.gz Sample_imb_ketting_2014_13_WT_6_R2.fastq.gz	fastq fastq	8334635544.0	41260572.0	GSM2277118 r1	0:101 1:101	A:2382306534;C:1783081151;G:1778919442;T:2387251408;N:3077009	101	101	2382306534	1783081151	1778919442	2387251408	3077009	SRX2018182	SRS1614123	SRA451974	GEO	Rene Ketting, Institute of Molecular Biology	2	0.91647	0.9192	0.1793	0.17873	0.69215	0.69262	0.50463	0.50038	101	101	B	B	biological fallback assumption	illumina	hiseq_era	3prime	poly_a	trueseq	bulk	clip	iclip	Germany	2016-08-12	Adult	Adult	Brain	Nervous System
41271	41271	SRR4026147	SRX2018182	SRS1614123	SRP081553	PRJNA338793	Characterization of genetic loss of function of Fus in zebrafish	GSE85554	Transcriptome Analysis	The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates.	pubmed:27898262	WT 6	GSM2277118	source name:adult female brain\|tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:wild type	WT 6	RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an…	adult female brain	The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips.	tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:wild type	GSM2277118	GSM2277118: WT 6; Danio rerio; RNA Seq	GSM2277118	1	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	GEO Accession:GSM2277118	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP081553	WT_6_R1.fastq.gz WT_6_R2.fastq.gz	fastq fastq	7239861396.0	35840898.0	GSM2277118 r2	0:101 1:101	A:1993396411;C:1626521001;G:1620190105;T:1996794482;N:2959397	101	101	1993396411	1626521001	1620190105	1996794482	2959397	SRX2018182	SRS1614123	SRA451974	GEO	Rene Ketting, Institute of Molecular Biology	2	0.93444	0.93758	0.15305	0.15223	0.68781	0.6885	0.5083	0.50745	101	101	B	B	biological fallback assumption	illumina	hiseq_era	3prime	poly_a	trueseq	bulk	clip	iclip	Germany	2016-08-12	Adult	Adult	Brain	Nervous System
41272	41272	SRR4026144	SRX2018181	SRS1614122	SRP081553	PRJNA338793	Characterization of genetic loss of function of Fus in zebrafish	GSE85554	Transcriptome Analysis	The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates.	pubmed:27898262	WT 4	GSM2277117	source name:adult female brain\|tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:wild type	WT 4	RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an…	adult female brain	The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips.	tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:wild type	GSM2277117	GSM2277117: WT 4; Danio rerio; RNA Seq	GSM2277117	1	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	GEO Accession:GSM2277117	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP081553	Sample_imb_ketting_2014_13_WT_4_R1.fastq.gz Sample_imb_ketting_2014_13_WT_4_R2.fastq.gz	fastq fastq	7425010556.0	36757478.0	GSM2277117 r1	0:101 1:101	A:2145596358;C:1565455511;G:1562345442;T:2148814299;N:2798946	101	101	2145596358	1565455511	1562345442	2148814299	2798946	SRX2018181	SRS1614122	SRA451974	GEO	Rene Ketting, Institute of Molecular Biology	2	0.91897	0.92157	0.17645	0.17633	0.6981	0.69948	0.51038	0.50544	101	101	B	B	biological fallback assumption	illumina	hiseq_era	3prime	poly_a	trueseq	bulk	clip	iclip	Germany	2016-08-12	Adult	Adult	Brain	Nervous System
41273	41273	SRR4026145	SRX2018181	SRS1614122	SRP081553	PRJNA338793	Characterization of genetic loss of function of Fus in zebrafish	GSE85554	Transcriptome Analysis	The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates.	pubmed:27898262	WT 4	GSM2277117	source name:adult female brain\|tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:wild type	WT 4	RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an…	adult female brain	The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips.	tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:wild type	GSM2277117	GSM2277117: WT 4; Danio rerio; RNA Seq	GSM2277117	1	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	GEO Accession:GSM2277117	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP081553	WT_4_R1.fastq.gz WT_4_R2.fastq.gz	fastq fastq	6322186910.0	31297955.0	GSM2277117 r2	0:101 1:101	A:1808695425;C:1352265448;G:1346884156;T:1811742728;N:2599153	101	101	1808695425	1352265448	1346884156	1811742728	2599153	SRX2018181	SRS1614122	SRA451974	GEO	Rene Ketting, Institute of Molecular Biology	2	0.927	0.92959	0.17323	0.17284	0.69562	0.69601	0.50522	0.50634	101	101	B	B	biological fallback assumption	illumina	hiseq_era	3prime	poly_a	trueseq	bulk	clip	iclip	Germany	2016-08-12	Adult	Adult	Brain	Nervous System
41274	41274	SRR4026142	SRX2018180	SRS1614124	SRP081553	PRJNA338793	Characterization of genetic loss of function of Fus in zebrafish	GSE85554	Transcriptome Analysis	The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates.	pubmed:27898262	WT 3	GSM2277116	source name:adult female brain\|tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:wild type	WT 3	RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an…	adult female brain	The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips.	tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:wild type	GSM2277116	GSM2277116: WT 3; Danio rerio; RNA Seq	GSM2277116	1	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	GEO Accession:GSM2277116	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP081553	Sample_imb_ketting_2014_13_WT_3_R1.fastq.gz Sample_imb_ketting_2014_13_WT_3_R2.fastq.gz	fastq fastq	7556697588.0	37409394.0	GSM2277116 r1	0:101 1:101	A:2168554402;C:1607788560;G:1605790339;T:2171752391;N:2811896	101	101	2168554402	1607788560	1605790339	2171752391	2811896	SRX2018180	SRS1614124	SRA451974	GEO	Rene Ketting, Institute of Molecular Biology	2	0.91892	0.92233	0.17858	0.17763	0.69589	0.69674	0.50649	0.50869	101	101	B	B	biological fallback assumption	illumina	hiseq_era	3prime	poly_a	trueseq	bulk	clip	iclip	Germany	2016-08-12	Adult	Adult	Brain	Nervous System
41275	41275	SRR4026143	SRX2018180	SRS1614124	SRP081553	PRJNA338793	Characterization of genetic loss of function of Fus in zebrafish	GSE85554	Transcriptome Analysis	The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates.	pubmed:27898262	WT 3	GSM2277116	source name:adult female brain\|tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:wild type	WT 3	RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an…	adult female brain	The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips.	tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:wild type	GSM2277116	GSM2277116: WT 3; Danio rerio; RNA Seq	GSM2277116	1	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	GEO Accession:GSM2277116	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP081553	WT_3_R1.fastq.gz WT_3_R2.fastq.gz	fastq fastq	7898912858.0	39103529.0	GSM2277116 r2	0:101 1:101	A:2243356257;C:1706636846;G:1702064968;T:2243634692;N:3220095	101	101	2243356257	1706636846	1702064968	2243634692	3220095	SRX2018180	SRS1614124	SRA451974	GEO	Rene Ketting, Institute of Molecular Biology	2	0.92701	0.93109	0.17113	0.17214	0.69591	0.69716	0.50649	0.51272	101	101	B	B	biological fallback assumption	illumina	hiseq_era	3prime	poly_a	trueseq	bulk	clip	iclip	Germany	2016-08-12	Adult	Adult	Brain	Nervous System
41276	41276	SRR4026140	SRX2018179	SRS1614121	SRP081553	PRJNA338793	Characterization of genetic loss of function of Fus in zebrafish	GSE85554	Transcriptome Analysis	The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates.	pubmed:27898262	WT 1	GSM2277115	source name:adult female brain\|tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:wild type	WT 1	RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an…	adult female brain	The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips.	tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:wild type	GSM2277115	GSM2277115: WT 1; Danio rerio; RNA Seq	GSM2277115	1	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	GEO Accession:GSM2277115	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP081553	Sample_imb_ketting_2014_13_WT_1_R1.fastq.gz Sample_imb_ketting_2014_13_WT_1_R2.fastq.gz	fastq fastq	7999392910.0	39600955.0	GSM2277115 r1	0:101 1:101	A:2287512350;C:1711532349;G:1705616114;T:2291731604;N:3000493	101	101	2287512350	1711532349	1705616114	2291731604	3000493	SRX2018179	SRS1614121	SRA451974	GEO	Rene Ketting, Institute of Molecular Biology	2	0.92291	0.92474	0.16701	0.16646	0.698	0.69814	0.51025	0.51024	101	101	B	B	biological fallback assumption	illumina	hiseq_era	3prime	poly_a	trueseq	bulk	clip	iclip	Germany	2016-08-12	Adult	Adult	Brain	Nervous System
41277	41277	SRR4026141	SRX2018179	SRS1614121	SRP081553	PRJNA338793	Characterization of genetic loss of function of Fus in zebrafish	GSE85554	Transcriptome Analysis	The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates.	pubmed:27898262	WT 1	GSM2277115	source name:adult female brain\|tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:wild type	WT 1	RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups an…	adult female brain	The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips.	tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:wild type	GSM2277115	GSM2277115: WT 1; Danio rerio; RNA Seq	GSM2277115	1	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	GEO Accession:GSM2277115	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP081553	WT_1_R1.fastq.gz WT_1_R2.fastq.gz	fastq fastq	6187101026.0	30629213.0	GSM2277115 r2	0:101 1:101	A:1757769151;C:1333826875;G:1336928364;T:1756068161;N:2508475	101	101	1757769151	1333826875	1336928364	1756068161	2508475	SRX2018179	SRS1614121	SRA451974	GEO	Rene Ketting, Institute of Molecular Biology	2	0.9294	0.9334	0.16402	0.16355	0.69682	0.69741	0.49912	0.50428	101	101	B	B	biological fallback assumption	illumina	hiseq_era	3prime	poly_a	trueseq	bulk	clip	iclip	Germany	2016-08-12	Adult	Adult	Brain	Nervous System
49577	49577	SRR7947926	SRX4781875	SRS3862067	SRP163087	PRJNA494251	Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis	GSE120724	Other	We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.	pubmed:32423473	elavl1a morphant 6h rna seq rep2	GSM3409399	source name:elavl1a morphant 6h rna seq rep2\|strain:AB\|tissue:zebrafish embryos\|genotype/variation:elavl1a morphants zebrafish embryos cells\|age:6hpf	elavl1a morphant 6h rna seq rep2	trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM.	elavl1a morphant 6h rna seq rep2	For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol.	Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions.	strain:AB\|tissue:zebrafish embryos\|genotype/variation:elavl1a morphants zebrafish embryos cells\|age:6hpf	GSM3409399	GSM3409399: elavl1a morphant 6h rna seq rep2; Danio rerio; RNA Seq	GSM3409399	1	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.	GEO Accession:GSM3409399	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	HiSeq X Ten	SRP163087	elavl1a_morphant_6h_rna-seq_rep2.R1.fastq.gz elavl1a_morphant_6h_rna-seq_rep2.R2.fastq.gz	fastq fastq	19875464400.0	66251548.0	GSM3409399 r1	0:150 1:150	A:5352630990;C:4584661408;G:4726300804;T:5209787586;N:2083612	150	150	5352630990	4584661408	4726300804	5209787586	2083612	SRX4781875	SRS3862067	SRA787572	GEO	Life Science, Tsinghua University	2	0.94901	0.95039	0.09074	0.08943	0.75866	0.76418	0.55609	0.56574	150	150	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	unknown	bulk	clip	iclip	China	2018-10-01	Gastrula	Embryo	Embryo Imprecise	All anatomical structures
49578	49578	SRR7947925	SRX4781874	SRS3862066	SRP163087	PRJNA494251	Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis	GSE120724	Other	We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.	pubmed:32423473	elavl1a morphant 6h rna seq rep1	GSM3409398	source name:elavl1a morphant 6h rna seq rep1\|strain:AB\|tissue:zebrafish embryos\|genotype/variation:elavl1a morphants zebrafish embryos cells\|age:6hpf	elavl1a morphant 6h rna seq rep1	trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM.	elavl1a morphant 6h rna seq rep1	For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol.	Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions.	strain:AB\|tissue:zebrafish embryos\|genotype/variation:elavl1a morphants zebrafish embryos cells\|age:6hpf	GSM3409398	GSM3409398: elavl1a morphant 6h rna seq rep1; Danio rerio; RNA Seq	GSM3409398	1	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.	GEO Accession:GSM3409398	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	HiSeq X Ten	SRP163087	elavl1a_morphant_6h_rna-seq_rep1.R2.fastq.gz elavl1a_morphant_6h_rna-seq_rep1.R1.fastq.gz	fastq fastq	20202214200.0	67340714.0	GSM3409398 r1	0:150 1:150	A:5439747248;C:4667041902;G:4805911969;T:5287977733;N:1535348	150	150	5439747248	4667041902	4805911969	5287977733	1535348	SRX4781874	SRS3862066	SRA787572	GEO	Life Science, Tsinghua University	2	0.94586	0.94757	0.09031	0.09016	0.76019	0.76493	0.55951	0.56185	150	150	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	unknown	bulk	clip	iclip	China	2018-10-01	Gastrula	Embryo	Embryo Imprecise	All anatomical structures
49579	49579	SRR7947924	SRX4781873	SRS3862065	SRP163087	PRJNA494251	Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis	GSE120724	Other	We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.	pubmed:32423473	elavl1a morphant 4h rna seq rep2	GSM3409397	source name:elavl1a morphant 4h rna seq rep2\|strain:AB\|tissue:zebrafish embryos\|genotype/variation:elavl1a morphants zebrafish embryos cells\|age:4hpf	elavl1a morphant 4h rna seq rep2	trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM.	elavl1a morphant 4h rna seq rep2	For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol.	Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions.	strain:AB\|tissue:zebrafish embryos\|genotype/variation:elavl1a morphants zebrafish embryos cells\|age:4hpf	GSM3409397	GSM3409397: elavl1a morphant 4h rna seq rep2; Danio rerio; RNA Seq	GSM3409397	1	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.	GEO Accession:GSM3409397	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	HiSeq X Ten	SRP163087	elavl1a_morphant_4h_rna-seq_rep2.R2.fastq.gz elavl1a_morphant_4h_rna-seq_rep2.R1.fastq.gz	fastq fastq	38764196400.0	129213988.0	GSM3409397 r1	0:150 1:150	A:10980499317;C:8394995318;G:8739322914;T:10645637187;N:3741664	150	150	10980499317	8394995318	8739322914	10645637187	3741664	SRX4781873	SRS3862065	SRA787572	GEO	Life Science, Tsinghua University	2	0.94567	0.94509	0.06713	0.06614	0.76191	0.76508	0.73283	0.74007	150	150	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	unknown	bulk	clip	iclip	China	2018-10-01	Blastula	Embryo	Embryo Imprecise	All anatomical structures
49580	49580	SRR7947923	SRX4781872	SRS3862064	SRP163087	PRJNA494251	Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis	GSE120724	Other	We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.	pubmed:32423473	elavl1a morphant 4h rna seq rep1	GSM3409396	source name:elavl1a morphant 4h rna seq rep1\|strain:AB\|tissue:zebrafish embryos\|genotype/variation:elavl1a morphants zebrafish embryos cells\|age:4hpf	elavl1a morphant 4h rna seq rep1	trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM.	elavl1a morphant 4h rna seq rep1	For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol.	Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions.	strain:AB\|tissue:zebrafish embryos\|genotype/variation:elavl1a morphants zebrafish embryos cells\|age:4hpf	GSM3409396	GSM3409396: elavl1a morphant 4h rna seq rep1; Danio rerio; RNA Seq	GSM3409396	1	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.	GEO Accession:GSM3409396	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	HiSeq X Ten	SRP163087	elavl1a_morphant_4h_rna-seq_rep1.R1.fastq.gz elavl1a_morphant_4h_rna-seq_rep1.R2.fastq.gz	fastq fastq	34417602600.0	114725342.0	GSM3409396 r1	0:150 1:150	A:9798364920;C:7402367067;G:7677976380;T:9534399996;N:4494237	150	150	9798364920	7402367067	7677976380	9534399996	4494237	SRX4781872	SRS3862064	SRA787572	GEO	Life Science, Tsinghua University	2	0.94663	0.94701	0.06442	0.06367	0.76264	0.7655	0.73483	0.74221	150	150	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	unknown	bulk	clip	iclip	China	2018-10-01	Blastula	Embryo	Embryo Imprecise	All anatomical structures
49581	49581	SRR7947922	SRX4781871	SRS3862063	SRP163087	PRJNA494251	Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis	GSE120724	Other	We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.	pubmed:32423473	control 6h rna seq rep2	GSM3409395	source name:control 6h rna seq rep2\|strain:AB\|tissue:zebrafish embryos\|genotype/variation:normal zebrafish embryos cells\|age:6hpf	control 6h rna seq rep2	trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM.	control 6h rna seq rep2	For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol.	Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions.	strain:AB\|tissue:zebrafish embryos\|genotype/variation:normal zebrafish embryos cells\|age:6hpf	GSM3409395	GSM3409395: control 6h rna seq rep2; Danio rerio; RNA Seq	GSM3409395	1	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.	GEO Accession:GSM3409395	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	HiSeq X Ten	SRP163087	control_6h_rna-seq_rep2.R1.fastq.gz control_6h_rna-seq_rep2.R2.fastq.gz	fastq fastq	39198242400.0	130660808.0	GSM3409395 r1	0:150 1:150	A:11268897172;C:8355243125;G:8663182840;T:10907160510;N:3758753	150	150	11268897172	8355243125	8663182840	10907160510	3758753	SRX4781871	SRS3862063	SRA787572	GEO	Life Science, Tsinghua University	2	0.94553	0.94591	0.09312	0.09248	0.78098	0.78397	0.73432	0.73781	150	150	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	unknown	bulk	clip	iclip	China	2018-10-01	Gastrula	Embryo	Embryo Imprecise	All anatomical structures
49582	49582	SRR7947921	SRX4781870	SRS3862062	SRP163087	PRJNA494251	Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis	GSE120724	Other	We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.	pubmed:32423473	control 6h rna seq rep1	GSM3409394	source name:control 6h rna seq rep1\|strain:AB\|tissue:zebrafish embryos\|genotype/variation:normal zebrafish embryos cells\|age:6hpf	control 6h rna seq rep1	trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM.	control 6h rna seq rep1	For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol.	Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions.	strain:AB\|tissue:zebrafish embryos\|genotype/variation:normal zebrafish embryos cells\|age:6hpf	GSM3409394	GSM3409394: control 6h rna seq rep1; Danio rerio; RNA Seq	GSM3409394	1	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.	GEO Accession:GSM3409394	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	HiSeq X Ten	SRP163087	control_6h_rna-seq_rep1.R1.fastq.gz control_6h_rna-seq_rep1.R2.fastq.gz	fastq fastq	49781358600.0	165937862.0	GSM3409394 r1	0:150 1:150	A:14340306167;C:10572507738;G:11006666686;T:13855405563;N:6472446	150	150	14340306167	10572507738	11006666686	13855405563	6472446	SRX4781870	SRS3862062	SRA787572	GEO	Life Science, Tsinghua University	2	0.94466	0.94506	0.09485	0.09402	0.77782	0.78303	0.72367	0.72791	150	150	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	unknown	bulk	clip	iclip	China	2018-10-01	Gastrula	Embryo	Embryo Imprecise	All anatomical structures
49583	49583	SRR7947920	SRX4781869	SRS3862061	SRP163087	PRJNA494251	Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis	GSE120724	Other	We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.	pubmed:32423473	control 4h rna seq rep2	GSM3409393	source name:control 4h rna seq rep2\|strain:AB\|tissue:zebrafish embryos\|genotype/variation:normal zebrafish embryos cells\|age:4hpf	control 4h rna seq rep2	trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM.	control 4h rna seq rep2	For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol.	Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions.	strain:AB\|tissue:zebrafish embryos\|genotype/variation:normal zebrafish embryos cells\|age:4hpf	GSM3409393	GSM3409393: control 4h rna seq rep2; Danio rerio; RNA Seq	GSM3409393	1	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.	GEO Accession:GSM3409393	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	HiSeq X Ten	SRP163087	control_4h_rna-seq_rep2.R1.fastq.gz control_4h_rna-seq_rep2.R2.fastq.gz	fastq fastq	33462197400.0	111540658.0	GSM3409393 r1	0:150 1:150	A:9246596683;C:7497270682;G:7798285753;T:8916810951;N:3233331	150	150	9246596683	7497270682	7798285753	8916810951	3233331	SRX4781869	SRS3862061	SRA787572	GEO	Life Science, Tsinghua University	2	0.94792	0.94861	0.0862	0.08529	0.76084	0.76309	0.73536	0.73703	150	150	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	unknown	bulk	clip	iclip	China	2018-10-01	Blastula	Embryo	Embryo Imprecise	All anatomical structures
49584	49584	SRR7947919	SRX4781868	SRS3862060	SRP163087	PRJNA494251	Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis	GSE120724	Other	We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.	pubmed:32423473	control 4h rna seq rep1	GSM3409392	source name:control 4h rna seq rep1\|strain:AB\|tissue:zebrafish embryos\|genotype/variation:normal zebrafish embryos cells\|age:4hpf	control 4h rna seq rep1	trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM.	control 4h rna seq rep1	For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol.	Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions.	strain:AB\|tissue:zebrafish embryos\|genotype/variation:normal zebrafish embryos cells\|age:4hpf	GSM3409392	GSM3409392: control 4h rna seq rep1; Danio rerio; RNA Seq	GSM3409392	1	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.	GEO Accession:GSM3409392	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	HiSeq X Ten	SRP163087	control_4h_rna-seq_rep1.R1.fastq.gz control_4h_rna-seq_rep1.R2.fastq.gz	fastq fastq	38719753500.0	129065845.0	GSM3409392 r1	0:150 1:150	A:10763970685;C:8606443742;G:8961006857;T:10383272808;N:5059408	150	150	10763970685	8606443742	8961006857	10383272808	5059408	SRX4781868	SRS3862060	SRA787572	GEO	Life Science, Tsinghua University	2	0.94748	0.948	0.08608	0.08505	0.76023	0.76357	0.72873	0.73242	150	150	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	unknown	bulk	clip	iclip	China	2018-10-01	Blastula	Embryo	Embryo Imprecise	All anatomical structures
49585	49585	SRR7947918	SRX4781867	SRS3862059	SRP163087	PRJNA494251	Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis	GSE120724	Other	We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.	pubmed:32423473	control 2h rna seq rep2	GSM3409391	source name:control 2h rna seq rep2\|strain:AB\|tissue:zebrafish embryos\|genotype/variation:normal zebrafish embryos cells\|age:2hpf	control 2h rna seq rep2	trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM.	control 2h rna seq rep2	For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol.	Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions.	strain:AB\|tissue:zebrafish embryos\|genotype/variation:normal zebrafish embryos cells\|age:2hpf	GSM3409391	GSM3409391: control 2h rna seq rep2; Danio rerio; RNA Seq	GSM3409391	1	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.	GEO Accession:GSM3409391	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	HiSeq X Ten	SRP163087	control_2h_rna-seq_rep2.R1.fastq.gz control_2h_rna-seq_rep2.R2.fastq.gz	fastq fastq	39017750100.0	130059167.0	GSM3409391 r1	0:150 1:150	A:10979134932;C:8549683633;G:8854910977;T:10629254366;N:4766192	150	150	10979134932	8549683633	8854910977	10629254366	4766192	SRX4781867	SRS3862059	SRA787572	GEO	Life Science, Tsinghua University	2	0.94685	0.94869	0.03416	0.03311	0.76536	0.76731	0.65079	0.65387	150	150	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	unknown	bulk	clip	iclip	China	2018-10-01	Cleavage	Embryo	Embryo Imprecise	All anatomical structures
49586	49586	SRR7947917	SRX4781866	SRS3862058	SRP163087	PRJNA494251	Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis	GSE120724	Other	We resolved the RNA secondary structure during zebrafish early embryogenesis based on in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages. Also we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2 4 6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.	pubmed:32423473	control 2h rna seq rep1	GSM3409390	source name:control 2h rna seq rep1\|strain:AB\|tissue:zebrafish embryos\|genotype/variation:normal zebrafish embryos cells\|age:2hpf	control 2h rna seq rep1	trimmed three prime adaptor from reads by cutadapt trimmed low quality bases by trimmomatic collapsed duplicated reads as icSHAPE pipeline trimmed the leading 13nt UMI mapping reads to zebrafish reference transcriptomez10 by bowtie2 using the same parameters in icSHAPE pipeline calculate rpkm as icshape pipeline calculate reverse transcription stop sitesRT stop as icshape pipeline RT stop was normalized by using sliding window then icSHAPE score was calculated as icshape pipeline Genome build: z10 Supplementary files format and content: tab delimited text files for icshape files. First column is the Refseq ID second is transcript length third is RPKM then every column is the nucleotide resolution icSHAPE score. NULL means no confident score. Tab delimited text files for read counts and rpkm files. First column is the Refseq ID second is transcript length third is the unique mapped reads count fourth is the mulitple mapped reads count fifth is the RPKM.	control 2h rna seq rep1	For Elavl1a morphants generation morpholino oligonucleotides of elavl1a were injected into one cell stage embryos then embryos were harvested at desired stages	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen.To enrich polyA RNA the total RNA was subjected to polyA selection. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before 3’ adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM 5’ adenylated and 3’ blocked linker 3’ bio for unmodified 3’ ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl 5’ Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer’s protocol.	Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions.	strain:AB\|tissue:zebrafish embryos\|genotype/variation:normal zebrafish embryos cells\|age:2hpf	GSM3409390	GSM3409390: control 2h rna seq rep1; Danio rerio; RNA Seq	GSM3409390	1	The RNA or modified RNA was extracted or cleaned up and eluted in RNase free water by using TRIzol® Reagent invitrogen. For icSHAPE the in vivo modified RNA and unmodified RNA were biotinylated by copper free click reaction followed by fragmentation. The fragmented RNA was end repaired by incubation at 37°C for 1 hours with the following mix 70 mM Tris 7.0 18mM MgCl2 5mM DTT 4 U/µl RiboLock 0.1 U/µl FastAP Life Technology 2 U/µl T4 PNKNEB before three prime adapter ligation with addition of 10 µl ligation mix 5mM DTT 0.5µM five prime adenylated and three prime blocked linker three prime bio for unmodified three prime ddc for modified 0.66 U/µl T4 RNA ligase NEB M0437M 15% PEG8000 1X RNA ligase buffer and incubation at 25°C for extra 3 hours. Then the excess adaptor was removed as described below. The purified RNA was incubated in the mix of 1µl FastAP 0.2µl SSB Promega 0.8µl Ribolock and 1µl five prime Deadenylase NEB in 1X NEB buffer 2 NEB at 30°C for 90 min. And then 1µl RecJf NEB was added with another incubation at 37°C for 1 hour. The following procedures including reverse transcription biotin streptavadin enrichment size selection of cDNA circularization and PCR amplification were the same as described in the standard protocol. For RNA seq， Fragmented mRNA was used for library construction using the KAPA Stranded mRNA Seq Kit KAPA according to manufacturer's protocol.	GEO Accession:GSM3409390	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	HiSeq X Ten	SRP163087	control_2h_rna-seq_rep1.R1.fastq.gz control_2h_rna-seq_rep1.R2.fastq.gz	fastq fastq	33999089400.0	113330298.0	GSM3409390 r1	0:150 1:150	A:9602786363;C:7418727808;G:7667052932;T:9305137704;N:5384593	150	150	9602786363	7418727808	7667052932	9305137704	5384593	SRX4781866	SRS3862058	SRA787572	GEO	Life Science, Tsinghua University	2	0.94874	0.95121	0.03388	0.03264	0.76524	0.76662	0.65127	0.65427	150	150	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	unknown	bulk	clip	iclip	China	2018-10-01	Cleavage	Embryo	Embryo Imprecise	All anatomical structures

Advanced export

JSON shape: default, array, newline-delimited

CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;