metadata: run_metadata: 153 rows where experiment.library_selection = "PolyA", experiment.library_strategy = "RNA-Seq" and tissue

153 rows where experiment.library_selection = "PolyA", experiment.library_strategy = "RNA-Seq" and tissue_curation = "Embryo Imprecise"

descending

Link	rowid ▼	run.accession	experiment.accession	sample.accession	study.accession	bioproject	study.title	study.alias	study.type	study.abstract	study.attributes	sample.description	sample.title	sample.alias	sample.centername	sample.attributes	experiment.title	experiment.alias	experiment.library_name	experiment.design_description	experiment.library_construction_protocol	experiment.attributes	experiment.library_strategy	experiment.library_source	experiment.library_selection	experiment.library_layout	experiment.platform	experiment.instrument_model	experiment.study_ref	run.title	run.attributes	run.filename	run.semantic_name	run.total_bases	run.total_spots	run.alias	run.read_lengths	run.base_counts	run.r1_length	run.r2_length	run.Acount	run.Ccount	run.Gcount	run.Tcount	run.Ncount	run.experiment	run.pool_member	submission.accession	submission.srasource	submission.bioprojectsource	seqdetective.n_mates	seqdetective.mapping_rate.mate1	seqdetective.mapping_rate.mate2	seqdetective.nofeature_rate.mate1	seqdetective.nofeature_rate.mate2	seqdetective.sparsity.mate1	seqdetective.sparsity.mate2	seqdetective.pos_strand_rate.mate1	seqdetective.pos_strand_rate.mate2	seqdetective.readlen.mate1	seqdetective.readlen.mate2	seqdetective.judgement.mate1	seqdetective.judgement.mate2	seqdetective.judgement.reason	platform_family	instrument_generation	read_bias	selection_class	prep_kit	sc_or_bulk	tech_class	technology	submission.bioprojectsource.country	earliest_date	devstage_curation	devstage_curation_coarse	tissue_curation	tissue_curation_coarse
9651	9651	ERR3266392	ERX3293003	ERS3358386	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp positive rep2	SAMEA5556346	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556346\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 6\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp positive rep2 s	sponge tdr gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_9pos_S2_L001_R1_001.fastq.gz	fastq	603238067.0	8014716.0	E MTAB 7846:sponge tdr gfp positive rep2 lane1	0:75.27 1:0	A:164797697;C:136552121;G:141138007;T:160737152;N:13090	75	0	164797697	136552121	141138007	160737152	13090	ERX3293003	ERS3358386	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95083		0.06432		0.71532		0.50098		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9652	9652	ERR3266393	ERX3293003	ERS3358386	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp positive rep2	SAMEA5556346	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556346\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 6\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp positive rep2 s	sponge tdr gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_9pos_S2_L002_R1_001.fastq.gz	fastq	603749720.0	8021069.0	E MTAB 7846:sponge tdr gfp positive rep2 lane2	0:75.27 1:0	A:164972969;C:136661417;G:141205792;T:160896264;N:13278	75	0	164972969	136661417	141205792	160896264	13278	ERX3293003	ERS3358386	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.951		0.06542		0.71768		0.50051		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9653	9653	ERR3266394	ERX3293003	ERS3358386	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp positive rep2	SAMEA5556346	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556346\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 6\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp positive rep2 s	sponge tdr gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_9pos_S2_L003_R1_001.fastq.gz	fastq	608154053.0	8079704.0	E MTAB 7846:sponge tdr gfp positive rep2 lane3	0:75.27 1:0	A:166117918;C:137731172;G:142320339;T:161970092;N:14532	75	0	166117918	137731172	142320339	161970092	14532	ERX3293003	ERS3358386	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95155		0.0657		0.71634		0.49493		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9654	9654	ERR3266395	ERX3293003	ERS3358386	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp positive rep2	SAMEA5556346	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556346\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 6\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp positive rep2 s	sponge tdr gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_9pos_S2_L004_R1_001.fastq.gz	fastq	599143392.0	7959897.0	E MTAB 7846:sponge tdr gfp positive rep2 lane4	0:75.27 1:0	A:163706904;C:135622453;G:140192351;T:159605249;N:16435	75	0	163706904	135622453	140192351	159605249	16435	ERX3293003	ERS3358386	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95061		0.06431		0.71764		0.50166		75		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9655	9655	ERR3266388	ERX3293002	ERS3358385	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp positive rep1	SAMEA5556345	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556345\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 5\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp positive rep1 s	sponge tdr gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_6pos_S4_L001_R1_001.fastq.gz	fastq	616761505.0	8202480.0	E MTAB 7846:sponge tdr gfp positive rep1 lane1	0:75.19 1:0	A:168679238;C:139548565;G:143969797;T:164545362;N:18543	75	0	168679238	139548565	143969797	164545362	18543	ERX3293002	ERS3358385	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95019		0.06806		0.7097		0.50337		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9656	9656	ERR3266389	ERX3293002	ERS3358385	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp positive rep1	SAMEA5556345	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556345\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 5\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp positive rep1 s	sponge tdr gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_6pos_S4_L002_R1_001.fastq.gz	fastq	617529482.0	8212485.0	E MTAB 7846:sponge tdr gfp positive rep1 lane2	0:75.19 1:0	A:168925757;C:139655387;G:144096837;T:164831236;N:20265	75	0	168925757	139655387	144096837	164831236	20265	ERX3293002	ERS3358385	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.9492		0.06753		0.712		0.49881		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9657	9657	ERR3266390	ERX3293002	ERS3358385	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp positive rep1	SAMEA5556345	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556345\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 5\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp positive rep1 s	sponge tdr gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_6pos_S4_L003_R1_001.fastq.gz	fastq	624156883.0	8300861.0	E MTAB 7846:sponge tdr gfp positive rep1 lane3	0:75.19 1:0	A:170696950;C:141302376;G:145759286;T:166377781;N:20490	75	0	170696950	141302376	145759286	166377781	20490	ERX3293002	ERS3358385	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94917		0.06724		0.71291		0.50783		75		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9658	9658	ERR3266391	ERX3293002	ERS3358385	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp positive rep1	SAMEA5556345	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556345\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 5\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp positive rep1 s	sponge tdr gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_6pos_S4_L004_R1_001.fastq.gz	fastq	615013615.0	8179180.0	E MTAB 7846:sponge tdr gfp positive rep1 lane4	0:75.19 1:0	A:168237742;C:139106952;G:143535658;T:164110735;N:22528	75	0	168237742	139106952	143535658	164110735	22528	ERX3293002	ERS3358385	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94892		0.06723		0.71206		0.50775		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9659	9659	ERR3266384	ERX3293001	ERS3358384	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp negative rep2	SAMEA5556344	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556344\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 6\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp negative rep2 s	sponge tdr gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_9neg_S1_L001_R1_001.fastq.gz	fastq	659562366.0	8762947.0	E MTAB 7846:sponge tdr gfp negative rep2 lane1	0:75.27 1:0	A:178744772;C:150091912;G:155092318;T:175619332;N:14032	75	0	178744772	150091912	155092318	175619332	14032	ERX3293001	ERS3358384	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.9517		0.06908		0.70822		0.48025		73		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9660	9660	ERR3266385	ERX3293001	ERS3358384	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp negative rep2	SAMEA5556344	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556344\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 6\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp negative rep2 s	sponge tdr gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_9neg_S1_L002_R1_001.fastq.gz	fastq	658688825.0	8751176.0	E MTAB 7846:sponge tdr gfp negative rep2 lane2	0:75.27 1:0	A:178540155;C:149844100;G:154850294;T:175438757;N:15519	75	0	178540155	149844100	154850294	175438757	15519	ERX3293001	ERS3358384	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95059		0.06748		0.70806		0.48177		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9661	9661	ERR3266386	ERX3293001	ERS3358384	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp negative rep2	SAMEA5556344	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556344\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 6\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp negative rep2 s	sponge tdr gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_9neg_S1_L003_R1_001.fastq.gz	fastq	665901310.0	8846927.0	E MTAB 7846:sponge tdr gfp negative rep2 lane3	0:75.27 1:0	A:180412445;C:151589489;G:156677030;T:177206192;N:16154	75	0	180412445	151589489	156677030	177206192	16154	ERX3293001	ERS3358384	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95095		0.06855		0.7082		0.4787		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9662	9662	ERR3266387	ERX3293001	ERS3358384	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp negative rep2	SAMEA5556344	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556344\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 6\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp negative rep2 s	sponge tdr gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_9neg_S1_L004_R1_001.fastq.gz	fastq	655674573.0	8711278.0	E MTAB 7846:sponge tdr gfp negative rep2 lane4	0:75.27 1:0	A:177658097;C:149188009;G:154201531;T:174609176;N:17760	75	0	177658097	149188009	154201531	174609176	17760	ERX3293001	ERS3358384	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.9503		0.06838		0.70926		0.47475		75		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9663	9663	ERR3266380	ERX3293000	ERS3358383	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp negative rep1	SAMEA5556343	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556343\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 5\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp negative rep1 s	sponge tdr gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_6neg_S3_L001_R1_001.fastq.gz	fastq	634491637.0	8440052.0	E MTAB 7846:sponge tdr gfp negative rep1 lane1	0:75.18 1:0	A:170881257;C:145535643;G:150561786;T:167495156;N:17795	75	0	170881257	145535643	150561786	167495156	17795	ERX3293000	ERS3358383	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94996		0.05672		0.70571		0.48691		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9664	9664	ERR3266381	ERX3293000	ERS3358383	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp negative rep1	SAMEA5556343	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556343\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 5\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp negative rep1 s	sponge tdr gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_6neg_S3_L002_R1_001.fastq.gz	fastq	632900752.0	8418846.0	E MTAB 7846:sponge tdr gfp negative rep1 lane2	0:75.18 1:0	A:170454908;C:145141392;G:150172752;T:167112562;N:19138	75	0	170454908	145141392	150172752	167112562	19138	ERX3293000	ERS3358383	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94905		0.05627		0.70457		0.4865		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9665	9665	ERR3266382	ERX3293000	ERS3358383	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp negative rep1	SAMEA5556343	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556343\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 5\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp negative rep1 s	sponge tdr gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_6neg_S3_L003_R1_001.fastq.gz	fastq	638530115.0	8494045.0	E MTAB 7846:sponge tdr gfp negative rep1 lane3	0:75.17 1:0	A:171907482;C:146526309;G:151612209;T:168464163;N:19952	75	0	171907482	146526309	151612209	168464163	19952	ERX3293000	ERS3358383	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94919		0.05578		0.70849		0.48073		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9666	9666	ERR3266383	ERX3293000	ERS3358383	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp negative rep1	SAMEA5556343	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556343\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 5\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp negative rep1 s	sponge tdr gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_6neg_S3_L004_R1_001.fastq.gz	fastq	627433322.0	8346505.0	E MTAB 7846:sponge tdr gfp negative rep1 lane4	0:75.17 1:0	A:169016383;C:143886824;G:148914725;T:165593528;N:21862	75	0	169016383	143886824	148914725	165593528	21862	ERX3293000	ERS3358383	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94993		0.05721		0.7052		0.48878		75		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9667	9667	ERR3266376	ERX3292999	ERS3358382	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp positive rep2	SAMEA5556342	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556342\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 2\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp positive rep2 s	sponge isl gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_7pos_S10_L001_R1_001.fastq.gz	fastq	618672195.0	8218047.0	E MTAB 7846:sponge isl gfp positive rep2 lane1	0:75.28 1:0	A:166422886;C:142212204;G:146857539;T:163167819;N:11747	75	0	166422886	142212204	146857539	163167819	11747	ERX3292999	ERS3358382	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94979		0.08351		0.70863		0.47581		75		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9668	9668	ERR3266377	ERX3292999	ERS3358382	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp positive rep2	SAMEA5556342	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556342\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 2\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp positive rep2 s	sponge isl gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_7pos_S10_L002_R1_001.fastq.gz	fastq	618709102.0	8218295.0	E MTAB 7846:sponge isl gfp positive rep2 lane2	0:75.28 1:0	A:166470432;C:142189977;G:146819280;T:163216323;N:13090	75	0	166470432	142189977	146819280	163216323	13090	ERX3292999	ERS3358382	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94977		0.08255		0.70644		0.47228		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9669	9669	ERR3266378	ERX3292999	ERS3358382	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp positive rep2	SAMEA5556342	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556342\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 2\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp positive rep2 s	sponge isl gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_7pos_S10_L003_R1_001.fastq.gz	fastq	625353059.0	8306375.0	E MTAB 7846:sponge isl gfp positive rep2 lane3	0:75.29 1:0	A:168233274;C:143793178;G:148510556;T:164802476;N:13575	75	0	168233274	143793178	148510556	164802476	13575	ERX3292999	ERS3358382	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95014		0.08368		0.70743		0.47846		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9670	9670	ERR3266379	ERX3292999	ERS3358382	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp positive rep2	SAMEA5556342	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556342\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 2\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp positive rep2 s	sponge isl gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_7pos_S10_L004_R1_001.fastq.gz	fastq	615204990.0	8171748.0	E MTAB 7846:sponge isl gfp positive rep2 lane4	0:75.28 1:0	A:165565861;C:141380152;G:146028839;T:162214263;N:15875	75	0	165565861	141380152	146028839	162214263	15875	ERX3292999	ERS3358382	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94954		0.08233		0.70834		0.48166		75		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9671	9671	ERR3266372	ERX3292998	ERS3358381	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp positive rep1	SAMEA5556341	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556341\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 1\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp positive rep1 s	sponge isl gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_6pos_S12_L001_R1_001.fastq.gz	fastq	626474467.0	8318996.0	E MTAB 7846:sponge isl gfp positive rep1 lane1	0:75.31 1:0	A:170186220;C:142441110;G:147048643;T:166786401;N:12093	75	0	170186220	142441110	147048643	166786401	12093	ERX3292998	ERS3358381	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94907		0.08132		0.69684		0.4736		75		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9672	9672	ERR3266373	ERX3292998	ERS3358381	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp positive rep1	SAMEA5556341	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556341\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 1\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp positive rep1 s	sponge isl gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_6pos_S12_L002_R1_001.fastq.gz	fastq	626477579.0	8318750.0	E MTAB 7846:sponge isl gfp positive rep1 lane2	0:75.31 1:0	A:170185337;C:142396801;G:147032265;T:166850532;N:12644	75	0	170185337	142396801	147032265	166850532	12644	ERX3292998	ERS3358381	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94941		0.08253		0.6957		0.47554		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9673	9673	ERR3266374	ERX3292998	ERS3358381	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp positive rep1	SAMEA5556341	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556341\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 1\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp positive rep1 s	sponge isl gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_6pos_S12_L003_R1_001.fastq.gz	fastq	632098509.0	8393388.0	E MTAB 7846:sponge isl gfp positive rep1 lane3	0:75.31 1:0	A:171699353;C:143766296;G:148442110;T:168177264;N:13486	75	0	171699353	143766296	148442110	168177264	13486	ERX3292998	ERS3358381	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94866		0.08247		0.69601		0.48009		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9674	9674	ERR3266375	ERX3292998	ERS3358381	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp positive rep1	SAMEA5556341	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556341\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 1\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp positive rep1 s	sponge isl gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_6pos_S12_L004_R1_001.fastq.gz	fastq	622997479.0	8272752.0	E MTAB 7846:sponge isl gfp positive rep1 lane4	0:75.31 1:0	A:169306677;C:141586415;G:146241288;T:165847752;N:15347	75	0	169306677	141586415	146241288	165847752	15347	ERX3292998	ERS3358381	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.9483		0.08034		0.69662		0.47868		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9675	9675	ERR3266368	ERX3292997	ERS3358380	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp negative rep2	SAMEA5556340	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556340\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 2\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp negative rep2 s	sponge isl gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_7neg_S9_L001_R1_001.fastq.gz	fastq	707454819.0	9395082.0	E MTAB 7846:sponge isl gfp negative rep2 lane1	0:75.30 1:0	A:194991862;C:157927850;G:163280639;T:191241488;N:12980	75	0	194991862	157927850	163280639	191241488	12980	ERX3292997	ERS3358380	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.93871		0.08926		0.70806		0.46501		75		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9676	9676	ERR3266369	ERX3292997	ERS3358380	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp negative rep2	SAMEA5556340	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556340\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 2\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp negative rep2 s	sponge isl gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_7neg_S9_L002_R1_001.fastq.gz	fastq	704791838.0	9359668.0	E MTAB 7846:sponge isl gfp negative rep2 lane2	0:75.30 1:0	A:194317422;C:157276895;G:162624670;T:190558322;N:14529	75	0	194317422	157276895	162624670	190558322	14529	ERX3292997	ERS3358380	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.93816		0.08859		0.70999		0.4661		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9677	9677	ERR3266370	ERX3292997	ERS3358380	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp negative rep2	SAMEA5556340	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556340\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 2\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp negative rep2 s	sponge isl gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_7neg_S9_L003_R1_001.fastq.gz	fastq	715991833.0	9508323.0	E MTAB 7846:sponge isl gfp negative rep2 lane3	0:75.30 1:0	A:197297222;C:159913026;G:165363927;T:193402765;N:14893	75	0	197297222	159913026	165363927	193402765	14893	ERX3292997	ERS3358380	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.93844		0.08854		0.70828		0.46042		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9678	9678	ERR3266371	ERX3292997	ERS3358380	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp negative rep2	SAMEA5556340	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556340\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 2\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp negative rep2 s	sponge isl gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_7neg_S9_L004_R1_001.fastq.gz	fastq	703723869.0	9345669.0	E MTAB 7846:sponge isl gfp negative rep2 lane4	0:75.30 1:0	A:194029886;C:157050176;G:162432310;T:190193608;N:17889	75	0	194029886	157050176	162432310	190193608	17889	ERX3292997	ERS3358380	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.93897		0.08993		0.70863		0.45707		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9679	9679	ERR3266364	ERX3292996	ERS3358379	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp negative rep1	SAMEA5556339	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556339\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 1\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp negative rep1 s	sponge isl gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_6neg_S11_L001_R1_001.fastq.gz	fastq	676581458.0	8983758.0	E MTAB 7846:sponge isl gfp negative rep1 lane1	0:75.31 1:0	A:184297337;C:153352193;G:158268476;T:180651038;N:12414	75	0	184297337	153352193	158268476	180651038	12414	ERX3292996	ERS3358379	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94981		0.07715		0.69138		0.47243		74		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9680	9680	ERR3266365	ERX3292996	ERS3358379	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp negative rep1	SAMEA5556339	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556339\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 1\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp negative rep1 s	sponge isl gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_6neg_S11_L002_R1_001.fastq.gz	fastq	676876555.0	8987445.0	E MTAB 7846:sponge isl gfp negative rep1 lane2	0:75.31 1:0	A:184435129;C:153332402;G:158323789;T:180770978;N:14257	75	0	184435129	153332402	158323789	180770978	14257	ERX3292996	ERS3358379	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94901		0.07805		0.69179		0.47182		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9681	9681	ERR3266366	ERX3292996	ERS3358379	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp negative rep1	SAMEA5556339	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556339\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 1\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp negative rep1 s	sponge isl gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_6neg_S11_L003_R1_001.fastq.gz	fastq	681771213.0	9052615.0	E MTAB 7846:sponge isl gfp negative rep1 lane3	0:75.31 1:0	A:185717696;C:154552039;G:159567102;T:181919781;N:14595	75	0	185717696	154552039	159567102	181919781	14595	ERX3292996	ERS3358379	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94923		0.07768		0.69167		0.47219		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9682	9682	ERR3266367	ERX3292996	ERS3358379	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp negative rep1	SAMEA5556339	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556339\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 1\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp negative rep1 s	sponge isl gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_6neg_S11_L004_R1_001.fastq.gz	fastq	671169917.0	8911624.0	E MTAB 7846:sponge isl gfp negative rep1 lane4	0:75.31 1:0	A:182910490;C:152045814;G:157010053;T:179186548;N:17012	75	0	182910490	152045814	157010053	179186548	17012	ERX3292996	ERS3358379	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94941		0.07612		0.69106		0.47736		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9683	9683	ERR3266360	ERX3292995	ERS3358378	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp positive rep2	SAMEA5556338	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556338\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 4\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp positive rep2 s	sponge ccn gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_8pos_S6_L001_R1_001.fastq.gz	fastq	745666738.0	9917771.0	E MTAB 7846:sponge ccn gfp positive rep2 lane1	0:75.18 1:0	A:207714377;C:163732420;G:169037726;T:205161925;N:20290	75	0	207714377	163732420	169037726	205161925	20290	ERX3292995	ERS3358378	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94006		0.17809		0.68166		0.48912		74		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9684	9684	ERR3266361	ERX3292995	ERS3358378	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp positive rep2	SAMEA5556338	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556338\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 4\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp positive rep2 s	sponge ccn gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_8pos_S6_L002_R1_001.fastq.gz	fastq	747693645.0	9944395.0	E MTAB 7846:sponge ccn gfp positive rep2 lane2	0:75.19 1:0	A:208257288;C:164106384;G:169478025;T:205830399;N:21549	75	0	208257288	164106384	169478025	205830399	21549	ERX3292995	ERS3358378	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.93873		0.17738		0.68296		0.49656		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9685	9685	ERR3266362	ERX3292995	ERS3358378	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp positive rep2	SAMEA5556338	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556338\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 4\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp positive rep2 s	sponge ccn gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_8pos_S6_L003_R1_001.fastq.gz	fastq	756134124.0	10056818.0	E MTAB 7846:sponge ccn gfp positive rep2 lane3	0:75.19 1:0	A:210573012;C:166089133;G:171475300;T:207973232;N:23447	75	0	210573012	166089133	171475300	207973232	23447	ERX3292995	ERS3358378	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94077		0.18001		0.68004		0.49812		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9686	9686	ERR3266363	ERX3292995	ERS3358378	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp positive rep2	SAMEA5556338	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556338\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 4\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp positive rep2 s	sponge ccn gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_8pos_S6_L004_R1_001.fastq.gz	fastq	747687619.0	9944417.0	E MTAB 7846:sponge ccn gfp positive rep2 lane4	0:75.19 1:0	A:208315943;C:164104155;G:169484250;T:205757712;N:25559	75	0	208315943	164104155	169484250	205757712	25559	ERX3292995	ERS3358378	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94025		0.17965		0.68124		0.49249		75		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9687	9687	ERR3266356	ERX3292994	ERS3358377	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp positive rep1	SAMEA5556337	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556337\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 3\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp positive rep1 s	sponge ccn gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_7pos_S8_L001_R1_001.fastq.gz	fastq	600153564.0	7972767.0	E MTAB 7846:sponge ccn gfp positive rep1 lane1	0:75.28 1:0	A:165075878;C:133961511;G:138306424;T:162797903;N:11848	75	0	165075878	133961511	138306424	162797903	11848	ERX3292994	ERS3358377	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95367		0.14146		0.69154		0.46621		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9688	9688	ERR3266357	ERX3292994	ERS3358377	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp positive rep1	SAMEA5556337	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556337\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 3\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp positive rep1 s	sponge ccn gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_7pos_S8_L002_R1_001.fastq.gz	fastq	600790169.0	7981038.0	E MTAB 7846:sponge ccn gfp positive rep1 lane2	0:75.28 1:0	A:165262968;C:133988329;G:138458635;T:163066854;N:13383	75	0	165262968	133988329	138458635	163066854	13383	ERX3292994	ERS3358377	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95365		0.14116		0.69301		0.46836		75		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9689	9689	ERR3266358	ERX3292994	ERS3358377	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp positive rep1	SAMEA5556337	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556337\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 3\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp positive rep1 s	sponge ccn gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_7pos_S8_L003_R1_001.fastq.gz	fastq	608611085.0	8084904.0	E MTAB 7846:sponge ccn gfp positive rep1 lane3	0:75.28 1:0	A:167402055;C:135871708;G:140314669;T:165009252;N:13401	75	0	167402055	135871708	140314669	165009252	13401	ERX3292994	ERS3358377	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95403		0.14167		0.69311		0.4702		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9690	9690	ERR3266359	ERX3292994	ERS3358377	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp positive rep1	SAMEA5556337	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556337\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 3\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp positive rep1 s	sponge ccn gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_7pos_S8_L004_R1_001.fastq.gz	fastq	599558663.0	7964718.0	E MTAB 7846:sponge ccn gfp positive rep1 lane4	0:75.28 1:0	A:164965131;C:133749666;G:138194884;T:162633558;N:15424	75	0	164965131	133749666	138194884	162633558	15424	ERX3292994	ERS3358377	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95285		0.14085		0.69037		0.47345		75		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9691	9691	ERR3266352	ERX3292993	ERS3358376	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp negative rep2	SAMEA5556336	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556336\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 4\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp negative rep2 s	sponge ccn gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_8neg_S5_L001_R1_001.fastq.gz	fastq	599599608.0	7970460.0	E MTAB 7846:sponge ccn gfp negative rep2 lane1	0:75.23 1:0	A:162236409;C:136907675;G:141538730;T:158902520;N:14274	75	0	162236409	136907675	141538730	158902520	14274	ERX3292993	ERS3358376	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95404		0.05923		0.69737		0.48627		75		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9692	9692	ERR3266353	ERX3292993	ERS3358376	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp negative rep2	SAMEA5556336	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556336\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 4\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp negative rep2 s	sponge ccn gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_8neg_S5_L002_R1_001.fastq.gz	fastq	600057776.0	7976438.0	E MTAB 7846:sponge ccn gfp negative rep2 lane2	0:75.23 1:0	A:162367410;C:136994919;G:141577782;T:159102194;N:15471	75	0	162367410	136994919	141577782	159102194	15471	ERX3292993	ERS3358376	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.953		0.06085		0.6952		0.48868		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9693	9693	ERR3266354	ERX3292993	ERS3358376	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp negative rep2	SAMEA5556336	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556336\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 4\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp negative rep2 s	sponge ccn gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_8neg_S5_L003_R1_001.fastq.gz	fastq	607089697.0	8069901.0	E MTAB 7846:sponge ccn gfp negative rep2 lane3	0:75.23 1:0	A:164235344;C:138684000;G:143335680;T:160819270;N:15403	75	0	164235344	138684000	143335680	160819270	15403	ERX3292993	ERS3358376	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95245		0.06055		0.69589		0.48813		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9694	9694	ERR3266355	ERX3292993	ERS3358376	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp negative rep2	SAMEA5556336	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556336\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 4\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp negative rep2 s	sponge ccn gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_8neg_S5_L004_R1_001.fastq.gz	fastq	598098243.0	7950223.0	E MTAB 7846:sponge ccn gfp negative rep2 lane4	0:75.23 1:0	A:161836808;C:136564804;G:141157424;T:158521860;N:17347	75	0	161836808	136564804	141157424	158521860	17347	ERX3292993	ERS3358376	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95299		0.06032		0.69501		0.48928		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9695	9695	ERR3266348	ERX3292992	ERS3358375	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp negative rep1	SAMEA5556335	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556335\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 3\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp negative rep1 s	sponge ccn gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_7neg_S7_L001_R1_001.fastq.gz	fastq	668175990.0	8872549.0	E MTAB 7846:sponge ccn gfp negative rep1 lane1	0:75.31 1:0	A:179859350;C:153483169;G:158360605;T:176462088;N:10778	75	0	179859350	153483169	158360605	176462088	10778	ERX3292992	ERS3358375	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95955		0.07154		0.69696		0.46425		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9696	9696	ERR3266349	ERX3292992	ERS3358375	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp negative rep1	SAMEA5556335	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556335\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 3\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp negative rep1 s	sponge ccn gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_7neg_S7_L002_R1_001.fastq.gz	fastq	668154755.0	8872093.0	E MTAB 7846:sponge ccn gfp negative rep1 lane2	0:75.31 1:0	A:179811687;C:153454931;G:158314391;T:176560936;N:12810	75	0	179811687	153454931	158314391	176560936	12810	ERX3292992	ERS3358375	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.96029		0.06969		0.69684		0.46725		75		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9697	9697	ERR3266350	ERX3292992	ERS3358375	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp negative rep1	SAMEA5556335	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556335\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 3\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp negative rep1 s	sponge ccn gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_7neg_S7_L003_R1_001.fastq.gz	fastq	676984426.0	8989004.0	E MTAB 7846:sponge ccn gfp negative rep1 lane3	0:75.31 1:0	A:182159685;C:155578195;G:160511499;T:178722363;N:12684	75	0	182159685	155578195	160511499	178722363	12684	ERX3292992	ERS3358375	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.96012		0.07159		0.69554		0.46811		75		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9698	9698	ERR3266351	ERX3292992	ERS3358375	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp negative rep1	SAMEA5556335	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556335\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 3\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp negative rep1 s	sponge ccn gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_7neg_S7_L004_R1_001.fastq.gz	fastq	666031892.0	8843695.0	E MTAB 7846:sponge ccn gfp negative rep1 lane4	0:75.31 1:0	A:179243298;C:152946459;G:157873912;T:175953752;N:14471	75	0	179243298	152946459	157873912	175953752	14471	ERX3292992	ERS3358375	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.96014		0.07169		0.69493		0.47058		76		B		usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9892	9892	ERR4172795	ERX4136409	ERS4580819	ERP121885	PRJEB38455	RNA seq of sfpq / zebrafish embryos and siblings at 24 hpf	E-MTAB-9113	Transcriptome Analysis	RNA was extracted from whole zebrafish embryos at 24 hpf to examine changes in gene expression and splicing in sfpq null mutants	ENA FIRST PUBLIC:2021 01 27\|ENA LAST UPDATE:2020 05 22	Protocols: Embryos were collected from in crosses of sfpq+/ adult zebrafish RNA was extracted using the RNEasy Mini Kit Qiagen Library constructed with ribodepletion	sibling 3	SAMEA6853229	Centre for Developmental Neurobiology King's College London	ENA FIRST PUBLIC:2020 12 01T04:08:08Z\|ENA LAST UPDATE:2020 05 22T17:13:15Z\|External Id:SAMEA6853229\|INSDC center name:Centre for Developmental Neurobiology King's College London\|INSDC first public:2020 12 01T04:08:08Z\|INSDC last update:2020 05 22T17:13:15Z\|INSDC status:public\|Submitter Id:E MTAB 9113:sibling 3\|age:24\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:embryo\|genotype:wild type genotype\|sample name:E MTAB 9113:sibling 3\|scientific name:Danio rerio	Illumina HiSeq 2500 paired end sequencing; RNA seq of sfpq / zebrafish embryos and siblings at 24 hpf	E MTAB 9113:sibling 3 p	sibling 3 p	RNA seq of sfpq / zebrafish embryos and siblings at 24 hpf	Embryos were collected from in crosses of sfpq+/ adult zebrafish RNA was extracted using the RNEasy Mini Kit Qiagen Library constructed with ribodepletion	Experimental Factor: genotype:wild type genotype	RNA-Seq	TRANSCRIPTOMIC	PolyA	PAIRED	ILLUMINA	Illumina HiSeq 2500	ERP121885	Illumina HiSeq 2500 paired end sequencing; RNA seq of sfpq / zebrafish embryos and siblings at 24 hpf	ENA FIRST PUBLIC:2021 01 27\|ENA LAST UPDATE:2020 06 19	UCLGNS1141-gfp-sibs-3_S6_R1.fastq.gz UCLGNS1141-gfp-sibs-3_S6_R2.fastq.gz	fastq fastq			E MTAB 9113:UCLGNS1141 gfp sibs 3 S6 R	0:81 1:81	A:1144578958;C:1113109875;G:1138809559;T:1117038434;N:213932	81	81	1144578958	1113109875	1138809559	1117038434	213932	ERX4136409	ERS4580819	ERA2625401	Centre for Developmental Neurobiology King	Centre for Developmental Neurobiology King	2	0.96684	0.96492	0.03244	0.0317	0.71236	0.71514	0.45871	0.46189	81	81	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	unknown	bulk	unknown	unknown	United Kingdom	2020-05-22	Multi-stage	Multi-stage	Embryo Imprecise	All anatomical structures
9893	9893	ERR4172794	ERX4136408	ERS4580818	ERP121885	PRJEB38455	RNA seq of sfpq / zebrafish embryos and siblings at 24 hpf	E-MTAB-9113	Transcriptome Analysis	RNA was extracted from whole zebrafish embryos at 24 hpf to examine changes in gene expression and splicing in sfpq null mutants	ENA FIRST PUBLIC:2021 01 27\|ENA LAST UPDATE:2020 05 22	Protocols: Embryos were collected from in crosses of sfpq+/ adult zebrafish RNA was extracted using the RNEasy Mini Kit Qiagen Library constructed with ribodepletion	sibling 2	SAMEA6853228	Centre for Developmental Neurobiology King's College London	ENA FIRST PUBLIC:2020 12 01T04:08:08Z\|ENA LAST UPDATE:2020 05 22T17:13:15Z\|External Id:SAMEA6853228\|INSDC center name:Centre for Developmental Neurobiology King's College London\|INSDC first public:2020 12 01T04:08:08Z\|INSDC last update:2020 05 22T17:13:15Z\|INSDC status:public\|Submitter Id:E MTAB 9113:sibling 2\|age:24\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:embryo\|genotype:wild type genotype\|sample name:E MTAB 9113:sibling 2\|scientific name:Danio rerio	Illumina HiSeq 2500 paired end sequencing; RNA seq of sfpq / zebrafish embryos and siblings at 24 hpf	E MTAB 9113:sibling 2 p	sibling 2 p	RNA seq of sfpq / zebrafish embryos and siblings at 24 hpf	Embryos were collected from in crosses of sfpq+/ adult zebrafish RNA was extracted using the RNEasy Mini Kit Qiagen Library constructed with ribodepletion	Experimental Factor: genotype:wild type genotype	RNA-Seq	TRANSCRIPTOMIC	PolyA	PAIRED	ILLUMINA	Illumina HiSeq 2500	ERP121885	Illumina HiSeq 2500 paired end sequencing; RNA seq of sfpq / zebrafish embryos and siblings at 24 hpf	ENA FIRST PUBLIC:2021 01 27\|ENA LAST UPDATE:2020 06 19	UCLGNS1141-gfp-sibs-2_S4_R1.fastq.gz UCLGNS1141-gfp-sibs-2_S4_R2.fastq.gz	fastq fastq			E MTAB 9113:UCLGNS1141 gfp sibs 2 S4 R	0:81 1:81	A:1056280368;C:1036355469;G:1045429486;T:1035773622;N:189389	81	81	1056280368	1036355469	1045429486	1035773622	189389	ERX4136408	ERS4580818	ERA2625401	Centre for Developmental Neurobiology King	Centre for Developmental Neurobiology King	2	0.95511	0.95696	0.02941	0.02903	0.71492	0.71628	0.45765	0.46537	81	81	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	unknown	bulk	unknown	unknown	United Kingdom	2020-05-22	Multi-stage	Multi-stage	Embryo Imprecise	All anatomical structures
9894	9894	ERR4172793	ERX4136407	ERS4580817	ERP121885	PRJEB38455	RNA seq of sfpq / zebrafish embryos and siblings at 24 hpf	E-MTAB-9113	Transcriptome Analysis	RNA was extracted from whole zebrafish embryos at 24 hpf to examine changes in gene expression and splicing in sfpq null mutants	ENA FIRST PUBLIC:2021 01 27\|ENA LAST UPDATE:2020 05 22	Protocols: Embryos were collected from in crosses of sfpq+/ adult zebrafish RNA was extracted using the RNEasy Mini Kit Qiagen Library constructed with ribodepletion	sibling 1	SAMEA6853227	Centre for Developmental Neurobiology King's College London	ENA FIRST PUBLIC:2020 12 01T04:08:08Z\|ENA LAST UPDATE:2020 05 22T17:13:15Z\|External Id:SAMEA6853227\|INSDC center name:Centre for Developmental Neurobiology King's College London\|INSDC first public:2020 12 01T04:08:08Z\|INSDC last update:2020 05 22T17:13:15Z\|INSDC status:public\|Submitter Id:E MTAB 9113:sibling 1\|age:24\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:embryo\|genotype:wild type genotype\|sample name:E MTAB 9113:sibling 1\|scientific name:Danio rerio	Illumina HiSeq 2500 paired end sequencing; RNA seq of sfpq / zebrafish embryos and siblings at 24 hpf	E MTAB 9113:sibling 1 p	sibling 1 p	RNA seq of sfpq / zebrafish embryos and siblings at 24 hpf	Embryos were collected from in crosses of sfpq+/ adult zebrafish RNA was extracted using the RNEasy Mini Kit Qiagen Library constructed with ribodepletion	Experimental Factor: genotype:wild type genotype	RNA-Seq	TRANSCRIPTOMIC	PolyA	PAIRED	ILLUMINA	Illumina HiSeq 2500	ERP121885	Illumina HiSeq 2500 paired end sequencing; RNA seq of sfpq / zebrafish embryos and siblings at 24 hpf	ENA FIRST PUBLIC:2021 01 27\|ENA LAST UPDATE:2020 06 19	UCLGNS1141-gfp-sibs-1_S2_R1.fastq.gz UCLGNS1141-gfp-sibs-1_S2_R2.fastq.gz	fastq fastq			E MTAB 9113:UCLGNS1141 gfp sibs 1 S2 R	0:81 1:81	A:1121176859;C:1093927654;G:1108608188;T:1101082277;N:209264	81	81	1121176859	1093927654	1108608188	1101082277	209264	ERX4136407	ERS4580817	ERA2625401	Centre for Developmental Neurobiology King	Centre for Developmental Neurobiology King	2	0.95795	0.96004	0.02885	0.02854	0.71648	0.71756	0.44348	0.43956	81	81	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	unknown	bulk	unknown	unknown	United Kingdom	2020-05-22	Multi-stage	Multi-stage	Embryo Imprecise	All anatomical structures
9895	9895	ERR4172792	ERX4136406	ERS4580816	ERP121885	PRJEB38455	RNA seq of sfpq / zebrafish embryos and siblings at 24 hpf	E-MTAB-9113	Transcriptome Analysis	RNA was extracted from whole zebrafish embryos at 24 hpf to examine changes in gene expression and splicing in sfpq null mutants	ENA FIRST PUBLIC:2021 01 27\|ENA LAST UPDATE:2020 05 22	Protocols: Embryos were collected from in crosses of sfpq+/ adult zebrafish RNA was extracted using the RNEasy Mini Kit Qiagen Library constructed with ribodepletion	sfpq 3	SAMEA6853226	Centre for Developmental Neurobiology King's College London	ENA FIRST PUBLIC:2020 12 01T04:08:08Z\|ENA LAST UPDATE:2020 05 22T17:13:15Z\|External Id:SAMEA6853226\|INSDC center name:Centre for Developmental Neurobiology King's College London\|INSDC first public:2020 12 01T04:08:08Z\|INSDC last update:2020 05 22T17:13:15Z\|INSDC status:public\|Submitter Id:E MTAB 9113:sfpq 3\|age:24\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:embryo\|genotype:sfpq / \|sample name:E MTAB 9113:sfpq 3\|scientific name:Danio rerio	Illumina HiSeq 2500 paired end sequencing; RNA seq of sfpq / zebrafish embryos and siblings at 24 hpf	E MTAB 9113:sfpq 3 p	sfpq 3 p	RNA seq of sfpq / zebrafish embryos and siblings at 24 hpf	Embryos were collected from in crosses of sfpq+/ adult zebrafish RNA was extracted using the RNEasy Mini Kit Qiagen Library constructed with ribodepletion	Experimental Factor: genotype:sfpq /	RNA-Seq	TRANSCRIPTOMIC	PolyA	PAIRED	ILLUMINA	Illumina HiSeq 2500	ERP121885	Illumina HiSeq 2500 paired end sequencing; RNA seq of sfpq / zebrafish embryos and siblings at 24 hpf	ENA FIRST PUBLIC:2021 01 27\|ENA LAST UPDATE:2020 06 19	UCLGNS1141-gfp-neg_3_S5_R1.fastq.gz UCLGNS1141-gfp-neg_3_S5_R2.fastq.gz	fastq fastq			E MTAB 9113:UCLGNS1141 gfp neg 3 S5 R	0:81 1:81	A:845849249;C:772302798;G:911660213;T:787409272;N:154042	81	81	845849249	772302798	911660213	787409272	154042	ERX4136406	ERS4580816	ERA2625401	Centre for Developmental Neurobiology King	Centre for Developmental Neurobiology King	2	0.96298	0.95486	0.03415	0.03476	0.7167	0.73503	0.4665	0.45947	81	81	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	unknown	bulk	unknown	unknown	United Kingdom	2020-05-22	Multi-stage	Multi-stage	Embryo Imprecise	All anatomical structures
9896	9896	ERR4172791	ERX4136405	ERS4580815	ERP121885	PRJEB38455	RNA seq of sfpq / zebrafish embryos and siblings at 24 hpf	E-MTAB-9113	Transcriptome Analysis	RNA was extracted from whole zebrafish embryos at 24 hpf to examine changes in gene expression and splicing in sfpq null mutants	ENA FIRST PUBLIC:2021 01 27\|ENA LAST UPDATE:2020 05 22	Protocols: Embryos were collected from in crosses of sfpq+/ adult zebrafish RNA was extracted using the RNEasy Mini Kit Qiagen Library constructed with ribodepletion	sfpq 2	SAMEA6853225	Centre for Developmental Neurobiology King's College London	ENA FIRST PUBLIC:2020 12 01T04:08:08Z\|ENA LAST UPDATE:2020 05 22T17:13:15Z\|External Id:SAMEA6853225\|INSDC center name:Centre for Developmental Neurobiology King's College London\|INSDC first public:2020 12 01T04:08:08Z\|INSDC last update:2020 05 22T17:13:15Z\|INSDC status:public\|Submitter Id:E MTAB 9113:sfpq 2\|age:24\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:embryo\|genotype:sfpq / \|sample name:E MTAB 9113:sfpq 2\|scientific name:Danio rerio	Illumina HiSeq 2500 paired end sequencing; RNA seq of sfpq / zebrafish embryos and siblings at 24 hpf	E MTAB 9113:sfpq 2 p	sfpq 2 p	RNA seq of sfpq / zebrafish embryos and siblings at 24 hpf	Embryos were collected from in crosses of sfpq+/ adult zebrafish RNA was extracted using the RNEasy Mini Kit Qiagen Library constructed with ribodepletion	Experimental Factor: genotype:sfpq /	RNA-Seq	TRANSCRIPTOMIC	PolyA	PAIRED	ILLUMINA	Illumina HiSeq 2500	ERP121885	Illumina HiSeq 2500 paired end sequencing; RNA seq of sfpq / zebrafish embryos and siblings at 24 hpf	ENA FIRST PUBLIC:2021 01 27\|ENA LAST UPDATE:2020 06 19	UCLGNS1141-gfp-neg-2_S3_R1.fastq.gz UCLGNS1141-gfp-neg-2_S3_R2.fastq.gz	fastq fastq			E MTAB 9113:UCLGNS1141 gfp neg 2 S3 R	0:81 1:81	A:961156886;C:917011292;G:942713581;T:936109877;N:157724	81	81	961156886	917011292	942713581	936109877	157724	ERX4136405	ERS4580815	ERA2625401	Centre for Developmental Neurobiology King	Centre for Developmental Neurobiology King	2	0.96276	0.96147	0.03436	0.03382	0.71892	0.72021	0.4581	0.46402	81	81	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	unknown	bulk	unknown	unknown	United Kingdom	2020-05-22	Multi-stage	Multi-stage	Embryo Imprecise	All anatomical structures
9897	9897	ERR4172790	ERX4136404	ERS4580814	ERP121885	PRJEB38455	RNA seq of sfpq / zebrafish embryos and siblings at 24 hpf	E-MTAB-9113	Transcriptome Analysis	RNA was extracted from whole zebrafish embryos at 24 hpf to examine changes in gene expression and splicing in sfpq null mutants	ENA FIRST PUBLIC:2021 01 27\|ENA LAST UPDATE:2020 05 22	Protocols: Embryos were collected from in crosses of sfpq+/ adult zebrafish RNA was extracted using the RNEasy Mini Kit Qiagen Library constructed with ribodepletion	sfpq 1	SAMEA6853224	Centre for Developmental Neurobiology King's College London	ENA FIRST PUBLIC:2020 12 01T04:08:08Z\|ENA LAST UPDATE:2020 05 22T17:13:15Z\|External Id:SAMEA6853224\|INSDC center name:Centre for Developmental Neurobiology King's College London\|INSDC first public:2020 12 01T04:08:08Z\|INSDC last update:2020 05 22T17:13:15Z\|INSDC status:public\|Submitter Id:E MTAB 9113:sfpq 1\|age:24\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:embryo\|genotype:sfpq / \|sample name:E MTAB 9113:sfpq 1\|scientific name:Danio rerio	Illumina HiSeq 2500 paired end sequencing; RNA seq of sfpq / zebrafish embryos and siblings at 24 hpf	E MTAB 9113:sfpq 1 p	sfpq 1 p	RNA seq of sfpq / zebrafish embryos and siblings at 24 hpf	Embryos were collected from in crosses of sfpq+/ adult zebrafish RNA was extracted using the RNEasy Mini Kit Qiagen Library constructed with ribodepletion	Experimental Factor: genotype:sfpq /	RNA-Seq	TRANSCRIPTOMIC	PolyA	PAIRED	ILLUMINA	Illumina HiSeq 2500	ERP121885	Illumina HiSeq 2500 paired end sequencing; RNA seq of sfpq / zebrafish embryos and siblings at 24 hpf	ENA FIRST PUBLIC:2021 01 27\|ENA LAST UPDATE:2020 06 19	UCLGNS1141-gfp-neg-1_S1_R1.fastq.gz UCLGNS1141-gfp-neg-1_S1_R2.fastq.gz	fastq fastq			E MTAB 9113:UCLGNS1141 gfp neg 1 S1 R	0:81 1:81	A:1046317524;C:1014946275;G:1036910299;T:1023619857;N:185237	81	81	1046317524	1014946275	1036910299	1023619857	185237	ERX4136404	ERS4580814	ERA2625401	Centre for Developmental Neurobiology King	Centre for Developmental Neurobiology King	2	0.96015	0.96173	0.03114	0.03098	0.7175	0.71865	0.46666	0.46399	81	81	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	unknown	bulk	unknown	unknown	United Kingdom	2020-05-22	Multi-stage	Multi-stage	Embryo Imprecise	All anatomical structures
9898	9898	ERR4194114	ERX4155254	ERS4601292	ERP122151	PRJEB38705	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E-MTAB-9193	Transcriptome Analysis	TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Sample 2	SAMEA6873729	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada	ENA FIRST PUBLIC:2020 12 31T11:11:47Z\|ENA LAST UPDATE:2020 06 04T16:16:46Z\|External Id:SAMEA6873729\|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada\|INSDC first public:2020 12 31T11:11:47Z\|INSDC last update:2020 06 04T16:16:46Z\|INSDC status:public\|Submitter Id:E MTAB 9193:Sample 2\|age:8\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:embryo stage\|genotype:TgBACgata5: EGFPpd25\|immunophenotype:GFP+\|individual:embryo pool 100 200\|organism part:mesendoderm\|sample name:E MTAB 9193:Sample 2\|scientific name:Danio rerio\|sex:mixed	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E MTAB 9193:Sample 2 s	Sample 2 s	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Experimental Factor: age:8\|Experimental Factor: RNA interference:n1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP122151	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	cDNA8h_1_S2_L001.bam	bam	10087287534.0	99874134.0	E MTAB 9193:cDNA8h 1 S2 L001	0:101	A:2892833391;C:2022466595;G:2198646699;T:2962268446;N:11072403	101		2892833391	2022466595	2198646699	2962268446	11072403	ERX4155254	ERS4601292	ERA2667966	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	1	0.93609		0.12902		0.82158		0.5062		101		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	sc	single_cell_droplet	10x	Canada	2020-06-04	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
9899	9899	ERR4194115	ERX4155254	ERS4601292	ERP122151	PRJEB38705	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E-MTAB-9193	Transcriptome Analysis	TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Sample 2	SAMEA6873729	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada	ENA FIRST PUBLIC:2020 12 31T11:11:47Z\|ENA LAST UPDATE:2020 06 04T16:16:46Z\|External Id:SAMEA6873729\|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada\|INSDC first public:2020 12 31T11:11:47Z\|INSDC last update:2020 06 04T16:16:46Z\|INSDC status:public\|Submitter Id:E MTAB 9193:Sample 2\|age:8\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:embryo stage\|genotype:TgBACgata5: EGFPpd25\|immunophenotype:GFP+\|individual:embryo pool 100 200\|organism part:mesendoderm\|sample name:E MTAB 9193:Sample 2\|scientific name:Danio rerio\|sex:mixed	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E MTAB 9193:Sample 2 s	Sample 2 s	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Experimental Factor: age:8\|Experimental Factor: RNA interference:n1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP122151	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	cDNA8h_1_S2_L002.bam	bam	10191911414.0	100910014.0	E MTAB 9193:cDNA8h 1 S2 L002	0:101	A:2923216190;C:2043975715;G:2221734566;T:2992798366;N:10186577	101		2923216190	2043975715	2221734566	2992798366	10186577	ERX4155254	ERS4601292	ERA2667966	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	1	0.93445		0.13038		0.824		0.49774		101		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	sc	single_cell_droplet	10x	Canada	2020-06-04	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
9900	9900	ERR4194112	ERX4155253	ERS4601291	ERP122151	PRJEB38705	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E-MTAB-9193	Transcriptome Analysis	TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Sample 1	SAMEA6873728	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada	ENA FIRST PUBLIC:2020 12 31T11:11:47Z\|ENA LAST UPDATE:2020 06 04T16:16:46Z\|External Id:SAMEA6873728\|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada\|INSDC first public:2020 12 31T11:11:47Z\|INSDC last update:2020 06 04T16:16:46Z\|INSDC status:public\|Submitter Id:E MTAB 9193:Sample 1\|age:6\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:embryo stage\|genotype:TgBACgata5: EGFPpd25\|immunophenotype:GFP+\|individual:embryo pool 100 200\|organism part:mesendoderm\|sample name:E MTAB 9193:Sample 1\|scientific name:Danio rerio\|sex:mixed	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E MTAB 9193:Sample 1 s	Sample 1 s	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Experimental Factor: age:6\|Experimental Factor: RNA interference:n1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP122151	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	cDNA6h_1_S1_L001.bam	bam	7181772357.0	71106657.0	E MTAB 9193:cDNA6h 1 S1 L001	0:101	A:2074032710;C:1415439071;G:1544274166;T:2140112533;N:7913877	101		2074032710	1415439071	1544274166	2140112533	7913877	ERX4155253	ERS4601291	ERA2667966	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	1	0.9297		0.12156		0.8117		0.51457		101		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	sc	single_cell_droplet	10x	Canada	2020-06-04	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
9901	9901	ERR4194113	ERX4155253	ERS4601291	ERP122151	PRJEB38705	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E-MTAB-9193	Transcriptome Analysis	TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Sample 1	SAMEA6873728	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada	ENA FIRST PUBLIC:2020 12 31T11:11:47Z\|ENA LAST UPDATE:2020 06 04T16:16:46Z\|External Id:SAMEA6873728\|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada\|INSDC first public:2020 12 31T11:11:47Z\|INSDC last update:2020 06 04T16:16:46Z\|INSDC status:public\|Submitter Id:E MTAB 9193:Sample 1\|age:6\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:embryo stage\|genotype:TgBACgata5: EGFPpd25\|immunophenotype:GFP+\|individual:embryo pool 100 200\|organism part:mesendoderm\|sample name:E MTAB 9193:Sample 1\|scientific name:Danio rerio\|sex:mixed	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E MTAB 9193:Sample 1 s	Sample 1 s	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Experimental Factor: age:6\|Experimental Factor: RNA interference:n1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP122151	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	cDNA6h_1_S1_L002.bam	bam	7256542253.0	71846953.0	E MTAB 9193:cDNA6h 1 S1 L002	0:101	A:2096163385;C:1430325700;G:1560530043;T:2162265616;N:7257509	101		2096163385	1430325700	1560530043	2162265616	7257509	ERX4155253	ERS4601291	ERA2667966	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	1	0.92882		0.12127		0.81162		0.51457		101		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	sc	single_cell_droplet	10x	Canada	2020-06-04	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
9902	9902	ERR4194128	ERX4155256	ERS4601294	ERP122151	PRJEB38705	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E-MTAB-9193	Transcriptome Analysis	TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Sample 4	SAMEA6873731	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada	ENA FIRST PUBLIC:2020 12 31T11:11:47Z\|ENA LAST UPDATE:2020 06 04T16:16:46Z\|External Id:SAMEA6873731\|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada\|INSDC first public:2020 12 31T11:11:47Z\|INSDC last update:2020 06 04T16:16:46Z\|INSDC status:public\|Submitter Id:E MTAB 9193:Sample 4\|age:13\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:embryo stage\|genotype:TgBACgata5: EGFPpd25\|immunophenotype:GFP+\|individual:embryo pool 100 200\|organism part:mesendoderm\|sample name:E MTAB 9193:Sample 4\|scientific name:Danio rerio\|sex:mixed	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E MTAB 9193:Sample 4 s	Sample 4 s	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Experimental Factor: age:13\|Experimental Factor: RNA interference:n1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP122151	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	cDNA13h_1_control_S1_L001.bam	bam	10785974123.0	106791823.0	E MTAB 9193:cDNA13h 1 control S1 L001	0:101	A:3007305661;C:2241057062;G:2505494392;T:2986021199;N:46095809	101		3007305661	2241057062	2505494392	2986021199	46095809	ERX4155256	ERS4601294	ERA2667966	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	1	0.67094		0.07571		0.92951		0.5272		101		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	sc	single_cell_droplet	10x	Canada	2020-06-04	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
9903	9903	ERR4194129	ERX4155256	ERS4601294	ERP122151	PRJEB38705	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E-MTAB-9193	Transcriptome Analysis	TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Sample 4	SAMEA6873731	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada	ENA FIRST PUBLIC:2020 12 31T11:11:47Z\|ENA LAST UPDATE:2020 06 04T16:16:46Z\|External Id:SAMEA6873731\|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada\|INSDC first public:2020 12 31T11:11:47Z\|INSDC last update:2020 06 04T16:16:46Z\|INSDC status:public\|Submitter Id:E MTAB 9193:Sample 4\|age:13\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:embryo stage\|genotype:TgBACgata5: EGFPpd25\|immunophenotype:GFP+\|individual:embryo pool 100 200\|organism part:mesendoderm\|sample name:E MTAB 9193:Sample 4\|scientific name:Danio rerio\|sex:mixed	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E MTAB 9193:Sample 4 s	Sample 4 s	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Experimental Factor: age:13\|Experimental Factor: RNA interference:n1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP122151	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	cDNA13h_1_control_S1_L002.bam	bam	10595192294.0	104902894.0	E MTAB 9193:cDNA13h 1 control S1 L002	0:101	A:2971916419;C:2204229263;G:2390854035;T:2949877754;N:78314823	101		2971916419	2204229263	2390854035	2949877754	78314823	ERX4155256	ERS4601294	ERA2667966	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	1	0.67255		0.08054		0.91583		0.52661		101		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	sc	single_cell_droplet	10x	Canada	2020-06-04	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
9904	9904	ERR4194116	ERX4155255	ERS4601293	ERP122151	PRJEB38705	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E-MTAB-9193	Transcriptome Analysis	TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Sample 3	SAMEA6873730	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada	ENA FIRST PUBLIC:2020 12 31T11:11:47Z\|ENA LAST UPDATE:2020 06 04T16:16:46Z\|External Id:SAMEA6873730\|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada\|INSDC first public:2020 12 31T11:11:47Z\|INSDC last update:2020 06 04T16:16:46Z\|INSDC status:public\|Submitter Id:E MTAB 9193:Sample 3\|age:10\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:embryo stage\|genotype:TgBACgata5: EGFPpd25\|immunophenotype:GFP+\|individual:embryo pool 100 200\|organism part:mesendoderm\|sample name:E MTAB 9193:Sample 3\|scientific name:Danio rerio\|sex:mixed	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E MTAB 9193:Sample 3 s	Sample 3 s	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Experimental Factor: age:10\|Experimental Factor: RNA interference:n1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP122151	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	cDNA10h_1_S3_L001.bam	bam	1622536412.0	16556494.0	E MTAB 9193:cDNA10h 1 S3 L001	0:98	A:491141175;C:317161060;G:354179755;T:459976409;N:78013	98		491141175	317161060	354179755	459976409	78013	ERX4155255	ERS4601293	ERA2667966	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	1	0.93238		0.13033		0.89132		0.47076		98		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	sc	single_cell_droplet	10x	Canada	2020-06-04	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
9905	9905	ERR4194117	ERX4155255	ERS4601293	ERP122151	PRJEB38705	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E-MTAB-9193	Transcriptome Analysis	TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Sample 3	SAMEA6873730	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada	ENA FIRST PUBLIC:2020 12 31T11:11:47Z\|ENA LAST UPDATE:2020 06 04T16:16:46Z\|External Id:SAMEA6873730\|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada\|INSDC first public:2020 12 31T11:11:47Z\|INSDC last update:2020 06 04T16:16:46Z\|INSDC status:public\|Submitter Id:E MTAB 9193:Sample 3\|age:10\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:embryo stage\|genotype:TgBACgata5: EGFPpd25\|immunophenotype:GFP+\|individual:embryo pool 100 200\|organism part:mesendoderm\|sample name:E MTAB 9193:Sample 3\|scientific name:Danio rerio\|sex:mixed	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E MTAB 9193:Sample 3 s	Sample 3 s	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Experimental Factor: age:10\|Experimental Factor: RNA interference:n1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP122151	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	cDNA10h_1_S3_L002.bam	bam	1484328776.0	15146212.0	E MTAB 9193:cDNA10h 1 S3 L002	0:98	A:450782055;C:290088574;G:322801188;T:420570801;N:86158	98		450782055	290088574	322801188	420570801	86158	ERX4155255	ERS4601293	ERA2667966	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	1	0.92846		0.13128		0.89923		0.46879		98		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	sc	single_cell_droplet	10x	Canada	2020-06-04	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
9906	9906	ERR4194118	ERX4155255	ERS4601293	ERP122151	PRJEB38705	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E-MTAB-9193	Transcriptome Analysis	TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Sample 3	SAMEA6873730	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada	ENA FIRST PUBLIC:2020 12 31T11:11:47Z\|ENA LAST UPDATE:2020 06 04T16:16:46Z\|External Id:SAMEA6873730\|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada\|INSDC first public:2020 12 31T11:11:47Z\|INSDC last update:2020 06 04T16:16:46Z\|INSDC status:public\|Submitter Id:E MTAB 9193:Sample 3\|age:10\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:embryo stage\|genotype:TgBACgata5: EGFPpd25\|immunophenotype:GFP+\|individual:embryo pool 100 200\|organism part:mesendoderm\|sample name:E MTAB 9193:Sample 3\|scientific name:Danio rerio\|sex:mixed	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E MTAB 9193:Sample 3 s	Sample 3 s	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Experimental Factor: age:10\|Experimental Factor: RNA interference:n1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP122151	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	cDNA10h_1_S3_L003.bam	bam	1578833116.0	16110542.0	E MTAB 9193:cDNA10h 1 S3 L003	0:98	A:477600666;C:308260969;G:347303289;T:445467384;N:200808	98		477600666	308260969	347303289	445467384	200808	ERX4155255	ERS4601293	ERA2667966	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	1	0.93107		0.12965		0.91265		0.47375		98		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	sc	single_cell_droplet	10x	Canada	2020-06-04	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
9907	9907	ERR4194119	ERX4155255	ERS4601293	ERP122151	PRJEB38705	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E-MTAB-9193	Transcriptome Analysis	TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Sample 3	SAMEA6873730	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada	ENA FIRST PUBLIC:2020 12 31T11:11:47Z\|ENA LAST UPDATE:2020 06 04T16:16:46Z\|External Id:SAMEA6873730\|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada\|INSDC first public:2020 12 31T11:11:47Z\|INSDC last update:2020 06 04T16:16:46Z\|INSDC status:public\|Submitter Id:E MTAB 9193:Sample 3\|age:10\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:embryo stage\|genotype:TgBACgata5: EGFPpd25\|immunophenotype:GFP+\|individual:embryo pool 100 200\|organism part:mesendoderm\|sample name:E MTAB 9193:Sample 3\|scientific name:Danio rerio\|sex:mixed	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E MTAB 9193:Sample 3 s	Sample 3 s	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Experimental Factor: age:10\|Experimental Factor: RNA interference:n1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP122151	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	cDNA10h_1_S3_L004.bam	bam	1859564994.0	18975153.0	E MTAB 9193:cDNA10h 1 S3 L004	0:98	A:562936790;C:364057256;G:406607636;T:525811595;N:151717	98		562936790	364057256	406607636	525811595	151717	ERX4155255	ERS4601293	ERA2667966	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	1	0.93453		0.1266		0.87714		0.46957		98		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	sc	single_cell_droplet	10x	Canada	2020-06-04	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
9908	9908	ERR4194120	ERX4155255	ERS4601293	ERP122151	PRJEB38705	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E-MTAB-9193	Transcriptome Analysis	TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Sample 3	SAMEA6873730	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada	ENA FIRST PUBLIC:2020 12 31T11:11:47Z\|ENA LAST UPDATE:2020 06 04T16:16:46Z\|External Id:SAMEA6873730\|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada\|INSDC first public:2020 12 31T11:11:47Z\|INSDC last update:2020 06 04T16:16:46Z\|INSDC status:public\|Submitter Id:E MTAB 9193:Sample 3\|age:10\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:embryo stage\|genotype:TgBACgata5: EGFPpd25\|immunophenotype:GFP+\|individual:embryo pool 100 200\|organism part:mesendoderm\|sample name:E MTAB 9193:Sample 3\|scientific name:Danio rerio\|sex:mixed	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E MTAB 9193:Sample 3 s	Sample 3 s	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Experimental Factor: age:10\|Experimental Factor: RNA interference:n1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP122151	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	cDNA10h_2_S3_L001.bam	bam	1156341102.0	11799399.0	E MTAB 9193:cDNA10h 2 S3 L001	0:98	A:345857612;C:224453195;G:257551986;T:327969064;N:509245	98		345857612	224453195	257551986	327969064	509245	ERX4155255	ERS4601293	ERA2667966	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	1	0.93863		0.10744		0.81984		0.501		98		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	sc	single_cell_droplet	10x	Canada	2020-06-04	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
9909	9909	ERR4194121	ERX4155255	ERS4601293	ERP122151	PRJEB38705	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E-MTAB-9193	Transcriptome Analysis	TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Sample 3	SAMEA6873730	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada	ENA FIRST PUBLIC:2020 12 31T11:11:47Z\|ENA LAST UPDATE:2020 06 04T16:16:46Z\|External Id:SAMEA6873730\|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada\|INSDC first public:2020 12 31T11:11:47Z\|INSDC last update:2020 06 04T16:16:46Z\|INSDC status:public\|Submitter Id:E MTAB 9193:Sample 3\|age:10\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:embryo stage\|genotype:TgBACgata5: EGFPpd25\|immunophenotype:GFP+\|individual:embryo pool 100 200\|organism part:mesendoderm\|sample name:E MTAB 9193:Sample 3\|scientific name:Danio rerio\|sex:mixed	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E MTAB 9193:Sample 3 s	Sample 3 s	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Experimental Factor: age:10\|Experimental Factor: RNA interference:n1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP122151	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	cDNA10h_2_S3_L002.bam	bam	1105219696.0	11277752.0	E MTAB 9193:cDNA10h 2 S3 L002	0:98	A:331051973;C:214369903;G:246546338;T:312897773;N:353709	98		331051973	214369903	246546338	312897773	353709	ERX4155255	ERS4601293	ERA2667966	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	1	0.93941		0.10818		0.82211		0.50079		98		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	sc	single_cell_droplet	10x	Canada	2020-06-04	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
9910	9910	ERR4194122	ERX4155255	ERS4601293	ERP122151	PRJEB38705	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E-MTAB-9193	Transcriptome Analysis	TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Sample 3	SAMEA6873730	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada	ENA FIRST PUBLIC:2020 12 31T11:11:47Z\|ENA LAST UPDATE:2020 06 04T16:16:46Z\|External Id:SAMEA6873730\|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada\|INSDC first public:2020 12 31T11:11:47Z\|INSDC last update:2020 06 04T16:16:46Z\|INSDC status:public\|Submitter Id:E MTAB 9193:Sample 3\|age:10\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:embryo stage\|genotype:TgBACgata5: EGFPpd25\|immunophenotype:GFP+\|individual:embryo pool 100 200\|organism part:mesendoderm\|sample name:E MTAB 9193:Sample 3\|scientific name:Danio rerio\|sex:mixed	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E MTAB 9193:Sample 3 s	Sample 3 s	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Experimental Factor: age:10\|Experimental Factor: RNA interference:n1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP122151	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	cDNA10h_2_S3_L003.bam	bam	1105199606.0	11277547.0	E MTAB 9193:cDNA10h 2 S3 L003	0:98	A:331158619;C:214305131;G:246465559;T:312930408;N:339889	98		331158619	214305131	246465559	312930408	339889	ERX4155255	ERS4601293	ERA2667966	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	1	0.93767		0.10645		0.82329		0.50057		98		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	sc	single_cell_droplet	10x	Canada	2020-06-04	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
9911	9911	ERR4194123	ERX4155255	ERS4601293	ERP122151	PRJEB38705	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E-MTAB-9193	Transcriptome Analysis	TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Sample 3	SAMEA6873730	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada	ENA FIRST PUBLIC:2020 12 31T11:11:47Z\|ENA LAST UPDATE:2020 06 04T16:16:46Z\|External Id:SAMEA6873730\|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada\|INSDC first public:2020 12 31T11:11:47Z\|INSDC last update:2020 06 04T16:16:46Z\|INSDC status:public\|Submitter Id:E MTAB 9193:Sample 3\|age:10\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:embryo stage\|genotype:TgBACgata5: EGFPpd25\|immunophenotype:GFP+\|individual:embryo pool 100 200\|organism part:mesendoderm\|sample name:E MTAB 9193:Sample 3\|scientific name:Danio rerio\|sex:mixed	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E MTAB 9193:Sample 3 s	Sample 3 s	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Experimental Factor: age:10\|Experimental Factor: RNA interference:n1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP122151	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	cDNA10h_2_S3_L004.bam	bam	1108707712.0	11313344.0	E MTAB 9193:cDNA10h 2 S3 L004	0:98	A:331374433;C:215925150;G:247131942;T:313865174;N:411013	98		331374433	215925150	247131942	313865174	411013	ERX4155255	ERS4601293	ERA2667966	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	1	0.93827		0.10842		0.82031		0.49241		98		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	sc	single_cell_droplet	10x	Canada	2020-06-04	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
9912	9912	ERR4194124	ERX4155255	ERS4601293	ERP122151	PRJEB38705	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E-MTAB-9193	Transcriptome Analysis	TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Sample 3	SAMEA6873730	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada	ENA FIRST PUBLIC:2020 12 31T11:11:47Z\|ENA LAST UPDATE:2020 06 04T16:16:46Z\|External Id:SAMEA6873730\|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada\|INSDC first public:2020 12 31T11:11:47Z\|INSDC last update:2020 06 04T16:16:46Z\|INSDC status:public\|Submitter Id:E MTAB 9193:Sample 3\|age:10\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:embryo stage\|genotype:TgBACgata5: EGFPpd25\|immunophenotype:GFP+\|individual:embryo pool 100 200\|organism part:mesendoderm\|sample name:E MTAB 9193:Sample 3\|scientific name:Danio rerio\|sex:mixed	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E MTAB 9193:Sample 3 s	Sample 3 s	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Experimental Factor: age:10\|Experimental Factor: RNA interference:n1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP122151	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	cDNA10h_2_S3_L005.bam	bam	1110084612.0	11327394.0	E MTAB 9193:cDNA10h 2 S3 L005	0:98	A:332881960;C:215360330;G:247563319;T:313842331;N:436672	98		332881960	215360330	247563319	313842331	436672	ERX4155255	ERS4601293	ERA2667966	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	1	0.93827		0.10719		0.8238		0.50406		98		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	sc	single_cell_droplet	10x	Canada	2020-06-04	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
9913	9913	ERR4194125	ERX4155255	ERS4601293	ERP122151	PRJEB38705	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E-MTAB-9193	Transcriptome Analysis	TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Sample 3	SAMEA6873730	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada	ENA FIRST PUBLIC:2020 12 31T11:11:47Z\|ENA LAST UPDATE:2020 06 04T16:16:46Z\|External Id:SAMEA6873730\|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada\|INSDC first public:2020 12 31T11:11:47Z\|INSDC last update:2020 06 04T16:16:46Z\|INSDC status:public\|Submitter Id:E MTAB 9193:Sample 3\|age:10\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:embryo stage\|genotype:TgBACgata5: EGFPpd25\|immunophenotype:GFP+\|individual:embryo pool 100 200\|organism part:mesendoderm\|sample name:E MTAB 9193:Sample 3\|scientific name:Danio rerio\|sex:mixed	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E MTAB 9193:Sample 3 s	Sample 3 s	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Experimental Factor: age:10\|Experimental Factor: RNA interference:n1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP122151	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	cDNA10h_2_S3_L006.bam	bam	1113812728.0	11365436.0	E MTAB 9193:cDNA10h 2 S3 L006	0:98	A:333112288;C:216649152;G:248341020;T:315338848;N:371420	98		333112288	216649152	248341020	315338848	371420	ERX4155255	ERS4601293	ERA2667966	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	1	0.93843		0.10675		0.82079		0.49284		98		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	sc	single_cell_droplet	10x	Canada	2020-06-04	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
9914	9914	ERR4194126	ERX4155255	ERS4601293	ERP122151	PRJEB38705	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E-MTAB-9193	Transcriptome Analysis	TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Sample 3	SAMEA6873730	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada	ENA FIRST PUBLIC:2020 12 31T11:11:47Z\|ENA LAST UPDATE:2020 06 04T16:16:46Z\|External Id:SAMEA6873730\|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada\|INSDC first public:2020 12 31T11:11:47Z\|INSDC last update:2020 06 04T16:16:46Z\|INSDC status:public\|Submitter Id:E MTAB 9193:Sample 3\|age:10\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:embryo stage\|genotype:TgBACgata5: EGFPpd25\|immunophenotype:GFP+\|individual:embryo pool 100 200\|organism part:mesendoderm\|sample name:E MTAB 9193:Sample 3\|scientific name:Danio rerio\|sex:mixed	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E MTAB 9193:Sample 3 s	Sample 3 s	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Experimental Factor: age:10\|Experimental Factor: RNA interference:n1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP122151	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	cDNA10h_2_S3_L007.bam	bam	1119495748.0	11423426.0	E MTAB 9193:cDNA10h 2 S3 L007	0:98	A:335288339;C:217283719;G:249624836;T:316900388;N:398466	98		335288339	217283719	249624836	316900388	398466	ERX4155255	ERS4601293	ERA2667966	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	1	0.93711		0.10749		0.82266		0.49382		98		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	sc	single_cell_droplet	10x	Canada	2020-06-04	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
9915	9915	ERR4194127	ERX4155255	ERS4601293	ERP122151	PRJEB38705	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E-MTAB-9193	Transcriptome Analysis	TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Sample 3	SAMEA6873730	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada	ENA FIRST PUBLIC:2020 12 31T11:11:47Z\|ENA LAST UPDATE:2020 06 04T16:16:46Z\|External Id:SAMEA6873730\|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada\|INSDC first public:2020 12 31T11:11:47Z\|INSDC last update:2020 06 04T16:16:46Z\|INSDC status:public\|Submitter Id:E MTAB 9193:Sample 3\|age:10\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:embryo stage\|genotype:TgBACgata5: EGFPpd25\|immunophenotype:GFP+\|individual:embryo pool 100 200\|organism part:mesendoderm\|sample name:E MTAB 9193:Sample 3\|scientific name:Danio rerio\|sex:mixed	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E MTAB 9193:Sample 3 s	Sample 3 s	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Experimental Factor: age:10\|Experimental Factor: RNA interference:n1	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP122151	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	cDNA10h_2_S3_L008.bam	bam	1175946688.0	11999456.0	E MTAB 9193:cDNA10h 2 S3 L008	0:98	A:351364169;C:228318193;G:261971072;T:333863943;N:429311	98		351364169	228318193	261971072	333863943	429311	ERX4155255	ERS4601293	ERA2667966	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	1	0.93851		0.10755		0.82158		0.49895		98		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	sc	single_cell_droplet	10x	Canada	2020-06-04	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
9916	9916	ERR4194130	ERX4155257	ERS4601295	ERP122151	PRJEB38705	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E-MTAB-9193	Transcriptome Analysis	TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Sample 5	SAMEA6873732	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada	ENA FIRST PUBLIC:2020 12 31T11:11:47Z\|ENA LAST UPDATE:2020 06 04T16:16:46Z\|External Id:SAMEA6873732\|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada\|INSDC first public:2020 12 31T11:11:47Z\|INSDC last update:2020 06 04T16:16:46Z\|INSDC status:public\|Submitter Id:E MTAB 9193:Sample 5\|age:13\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:embryo stage\|genotype:TgBACgata5: EGFPpd25\|immunophenotype:GFP+\|individual:embryo pool 100 200\|organism part:mesendoderm\|sample name:E MTAB 9193:Sample 5\|scientific name:Danio rerio\|sex:mixed	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E MTAB 9193:Sample 5 s	Sample 5 s	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Experimental Factor: age:13\|Experimental Factor: RNA interference:morpholino mediated Gata5/6 knockdown	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP122151	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	cDNA13h_2_gata56KD_S2_L001.bam	bam	7791309377.0	77141677.0	E MTAB 9193:cDNA13h 2 gata56KD S2 L001	0:101	A:2198242220;C:1593746618;G:1784167452;T:2181979820;N:33173267	101		2198242220	1593746618	1784167452	2181979820	33173267	ERX4155257	ERS4601295	ERA2667966	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	1	0.66736		0.08039		0.93026		0.50796		101		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	sc	single_cell_droplet	10x	Canada	2020-06-04	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
9917	9917	ERR4194131	ERX4155257	ERS4601295	ERP122151	PRJEB38705	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E-MTAB-9193	Transcriptome Analysis	TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately.	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Sample 5	SAMEA6873732	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada	ENA FIRST PUBLIC:2020 12 31T11:11:47Z\|ENA LAST UPDATE:2020 06 04T16:16:46Z\|External Id:SAMEA6873732\|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada\|INSDC first public:2020 12 31T11:11:47Z\|INSDC last update:2020 06 04T16:16:46Z\|INSDC status:public\|Submitter Id:E MTAB 9193:Sample 5\|age:13\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:embryo stage\|genotype:TgBACgata5: EGFPpd25\|immunophenotype:GFP+\|individual:embryo pool 100 200\|organism part:mesendoderm\|sample name:E MTAB 9193:Sample 5\|scientific name:Danio rerio\|sex:mixed	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	E MTAB 9193:Sample 5 s	Sample 5 s	Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry.	Experimental Factor: age:13\|Experimental Factor: RNA interference:morpholino mediated Gata5/6 knockdown	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	PolyA	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP122151	Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish	ENA FIRST PUBLIC:2021 06 02\|ENA LAST UPDATE:2021 12 01	cDNA13h_2_gata56KD_S2_L002.bam	bam	7658149967.0	75823267.0	E MTAB 9193:cDNA13h 2 gata56KD S2 L002	0:101	A:2172230233;C:1568805100;G:1703587704;T:2157181071;N:56345859	101		2172230233	1568805100	1703587704	2157181071	56345859	ERX4155257	ERS4601295	ERA2667966	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada\|European Nucleotide Archive	1	0.66565		0.08597		0.91804		0.51772		101		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	unknown	sc	single_cell_droplet	10x	Canada	2020-06-04	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
10285	10285	ERR7132868	ERX6700306	ERS8071630	ERP132573	PRJEB48231	RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	E-MTAB-11086	Transcriptome Analysis	RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.	ENA FIRST PUBLIC:2022 01 24\|ENA LAST UPDATE:2022 01 24	Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.	Oxy 6	SAMEA10418786	Cambridge Institute of Therapeutic Immunology & Infectious Disease	ENA first public:2022 01 24\|ENA last update:2022 01 24\|External Id:SAMEA10418786\|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease\|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease\|INSDC first public:2022 01 24T16:27:32Z\|INSDC last update:2022 01 24T16:27:32Z\|INSDC status:public\|Submitter Id:E MTAB 11086:Oxy 6\|age:5\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:larval day 5\|genotype:wild type genotype\|individual:pool of 7 embryos\|organism part:whole organism\|replicate:6\|sample name:E MTAB 11086:Oxy 6\|sex:not available\|strain:Tüpfel long fin TLF	Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs	E MTAB 11086:Oxy 6 p	Oxy 6 p	RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.	Experimental Factor: compound:oxycod1\|Experimental Factor: dose:1.14	RNA-Seq	TRANSCRIPTOMIC	PolyA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	ERP132573	Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	ENA FIRST PUBLIC:2022 01 24\|ENA LAST UPDATE:2022 01 24	SLX-19351.B11.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.B11.HMLG7DRXX.s_2.r_2.fq.gz	fastq fastq	2330698400.0	23306984.0	E MTAB 11086:SLX 19351.B11.HMLG7DRXX.s 2.r	0:50 1:50	A:619569172;C:544582535;G:551543197;T:614938437;N:65059	50	50	619569172	544582535	551543197	614938437	65059	ERX6700306	ERS8071630	ERA6757821	Cambridge Institute of Therapeutic Immunology & Infectious Disease\|European Nucleotide Archive	Cambridge Institute of Therapeutic Immunology & Infectious Disease\|European Nucleotide Archive	2	0.9448	0.95044	0.1029	0.09965	0.67152	0.66864	0.46844	0.47553	50	50	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	United Kingdom	2022-01-24	Larval	Larval	Embryo Imprecise	All anatomical structures
10286	10286	ERR7132867	ERX6700305	ERS8071629	ERP132573	PRJEB48231	RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	E-MTAB-11086	Transcriptome Analysis	RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.	ENA FIRST PUBLIC:2022 01 24\|ENA LAST UPDATE:2022 01 24	Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.	Oxy 5	SAMEA10418785	Cambridge Institute of Therapeutic Immunology & Infectious Disease	ENA first public:2022 01 24\|ENA last update:2022 01 24\|External Id:SAMEA10418785\|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease\|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease\|INSDC first public:2022 01 24T16:27:32Z\|INSDC last update:2022 01 24T16:27:32Z\|INSDC status:public\|Submitter Id:E MTAB 11086:Oxy 5\|age:5\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:larval day 5\|genotype:wild type genotype\|individual:pool of 7 embryos\|organism part:whole organism\|replicate:5\|sample name:E MTAB 11086:Oxy 5\|sex:not available\|strain:Tüpfel long fin TLF	Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs	E MTAB 11086:Oxy 5 p	Oxy 5 p	RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.	Experimental Factor: compound:oxycod1\|Experimental Factor: dose:1.14	RNA-Seq	TRANSCRIPTOMIC	PolyA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	ERP132573	Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	ENA FIRST PUBLIC:2022 01 24\|ENA LAST UPDATE:2022 01 24	SLX-19351.H9.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.H9.HMLG7DRXX.s_2.r_2.fq.gz	fastq fastq	2005314000.0	20053140.0	E MTAB 11086:SLX 19351.H9.HMLG7DRXX.s 2.r	0:50 1:50	A:533671597;C:466449227;G:473126638;T:532010412;N:56126	50	50	533671597	466449227	473126638	532010412	56126	ERX6700305	ERS8071629	ERA6757821	Cambridge Institute of Therapeutic Immunology & Infectious Disease\|European Nucleotide Archive	Cambridge Institute of Therapeutic Immunology & Infectious Disease\|European Nucleotide Archive	2	0.94406	0.94793	0.11192	0.10798	0.66184	0.66074	0.4603	0.4683	50	50	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	United Kingdom	2022-01-24	Larval	Larval	Embryo Imprecise	All anatomical structures
10287	10287	ERR7132866	ERX6700304	ERS8071628	ERP132573	PRJEB48231	RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	E-MTAB-11086	Transcriptome Analysis	RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.	ENA FIRST PUBLIC:2022 01 24\|ENA LAST UPDATE:2022 01 24	Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.	Oxy 4	SAMEA10418784	Cambridge Institute of Therapeutic Immunology & Infectious Disease	ENA first public:2022 01 24\|ENA last update:2022 01 24\|External Id:SAMEA10418784\|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease\|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease\|INSDC first public:2022 01 24T16:27:32Z\|INSDC last update:2022 01 24T16:27:32Z\|INSDC status:public\|Submitter Id:E MTAB 11086:Oxy 4\|age:5\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:larval day 5\|genotype:wild type genotype\|individual:pool of 7 embryos\|organism part:whole organism\|replicate:4\|sample name:E MTAB 11086:Oxy 4\|sex:not available\|strain:Tüpfel long fin TLF	Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs	E MTAB 11086:Oxy 4 p	Oxy 4 p	RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.	Experimental Factor: compound:oxycod1\|Experimental Factor: dose:1.14	RNA-Seq	TRANSCRIPTOMIC	PolyA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	ERP132573	Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	ENA FIRST PUBLIC:2022 01 24\|ENA LAST UPDATE:2022 01 24	SLX-19351.A9.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.A9.HMLG7DRXX.s_2.r_2.fq.gz	fastq fastq	2036392600.0	20363926.0	E MTAB 11086:SLX 19351.A9.HMLG7DRXX.s 2.r	0:50 1:50	A:547586305;C:468797712;G:476477515;T:543474510;N:56558	50	50	547586305	468797712	476477515	543474510	56558	ERX6700304	ERS8071628	ERA6757821	Cambridge Institute of Therapeutic Immunology & Infectious Disease\|European Nucleotide Archive	Cambridge Institute of Therapeutic Immunology & Infectious Disease\|European Nucleotide Archive	2	0.94235	0.94873	0.11388	0.11054	0.67655	0.67294	0.47135	0.47234	50	50	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	United Kingdom	2022-01-24	Larval	Larval	Embryo Imprecise	All anatomical structures
10288	10288	ERR7132865	ERX6700303	ERS8071627	ERP132573	PRJEB48231	RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	E-MTAB-11086	Transcriptome Analysis	RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.	ENA FIRST PUBLIC:2022 01 24\|ENA LAST UPDATE:2022 01 24	Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.	Oxy 3	SAMEA10418783	Cambridge Institute of Therapeutic Immunology & Infectious Disease	ENA first public:2022 01 24\|ENA last update:2022 01 24\|External Id:SAMEA10418783\|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease\|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease\|INSDC first public:2022 01 24T16:27:32Z\|INSDC last update:2022 01 24T16:27:32Z\|INSDC status:public\|Submitter Id:E MTAB 11086:Oxy 3\|age:5\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:larval day 5\|genotype:wild type genotype\|individual:pool of 7 embryos\|organism part:whole organism\|replicate:3\|sample name:E MTAB 11086:Oxy 3\|sex:not available\|strain:Tüpfel long fin TLF	Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs	E MTAB 11086:Oxy 3 p	Oxy 3 p	RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.	Experimental Factor: compound:oxycod1\|Experimental Factor: dose:1.14	RNA-Seq	TRANSCRIPTOMIC	PolyA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	ERP132573	Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	ENA FIRST PUBLIC:2022 01 24\|ENA LAST UPDATE:2022 01 24	SLX-19351.B9.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.B9.HMLG7DRXX.s_2.r_2.fq.gz	fastq fastq	2409819000.0	24098190.0	E MTAB 11086:SLX 19351.B9.HMLG7DRXX.s 2.r	0:50 1:50	A:641053989;C:561685242;G:569693271;T:637320302;N:66196	50	50	641053989	561685242	569693271	637320302	66196	ERX6700303	ERS8071627	ERA6757821	Cambridge Institute of Therapeutic Immunology & Infectious Disease\|European Nucleotide Archive	Cambridge Institute of Therapeutic Immunology & Infectious Disease\|European Nucleotide Archive	2	0.94407	0.94902	0.10789	0.10496	0.66478	0.66387	0.47154	0.47373	50	50	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	United Kingdom	2022-01-24	Larval	Larval	Embryo Imprecise	All anatomical structures
10289	10289	ERR7132864	ERX6700302	ERS8071626	ERP132573	PRJEB48231	RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	E-MTAB-11086	Transcriptome Analysis	RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.	ENA FIRST PUBLIC:2022 01 24\|ENA LAST UPDATE:2022 01 24	Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.	Oxy 2	SAMEA10418782	Cambridge Institute of Therapeutic Immunology & Infectious Disease	ENA first public:2022 01 24\|ENA last update:2022 01 24\|External Id:SAMEA10418782\|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease\|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease\|INSDC first public:2022 01 24T16:27:32Z\|INSDC last update:2022 01 24T16:27:32Z\|INSDC status:public\|Submitter Id:E MTAB 11086:Oxy 2\|age:5\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:larval day 5\|genotype:wild type genotype\|individual:pool of 7 embryos\|organism part:whole organism\|replicate:2\|sample name:E MTAB 11086:Oxy 2\|sex:not available\|strain:Tüpfel long fin TLF	Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs	E MTAB 11086:Oxy 2 p	Oxy 2 p	RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.	Experimental Factor: compound:oxycod1\|Experimental Factor: dose:1.14	RNA-Seq	TRANSCRIPTOMIC	PolyA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	ERP132573	Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	ENA FIRST PUBLIC:2022 01 24\|ENA LAST UPDATE:2022 01 24	SLX-19351.A11.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.A11.HMLG7DRXX.s_2.r_2.fq.gz	fastq fastq	2068575200.0	20685752.0	E MTAB 11086:SLX 19351.A11.HMLG7DRXX.s 2.r	0:50 1:50	A:547986796;C:484533693;G:490663629;T:545334125;N:56957	50	50	547986796	484533693	490663629	545334125	56957	ERX6700302	ERS8071626	ERA6757821	Cambridge Institute of Therapeutic Immunology & Infectious Disease\|European Nucleotide Archive	Cambridge Institute of Therapeutic Immunology & Infectious Disease\|European Nucleotide Archive	2	0.94539	0.95188	0.10373	0.10116	0.66718	0.66584	0.46991	0.47611	50	50	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	United Kingdom	2022-01-24	Larval	Larval	Embryo Imprecise	All anatomical structures
10290	10290	ERR7132863	ERX6700301	ERS8071625	ERP132573	PRJEB48231	RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	E-MTAB-11086	Transcriptome Analysis	RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.	ENA FIRST PUBLIC:2022 01 24\|ENA LAST UPDATE:2022 01 24	Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.	Oxy 1	SAMEA10418781	Cambridge Institute of Therapeutic Immunology & Infectious Disease	ENA first public:2022 01 24\|ENA last update:2022 01 24\|External Id:SAMEA10418781\|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease\|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease\|INSDC first public:2022 01 24T16:27:32Z\|INSDC last update:2022 01 24T16:27:32Z\|INSDC status:public\|Submitter Id:E MTAB 11086:Oxy 1\|age:5\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:larval day 5\|genotype:wild type genotype\|individual:pool of 7 embryos\|organism part:whole organism\|replicate:1\|sample name:E MTAB 11086:Oxy 1\|sex:not available\|strain:Tüpfel long fin TLF	Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs	E MTAB 11086:Oxy 1 p	Oxy 1 p	RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.	Experimental Factor: compound:oxycod1\|Experimental Factor: dose:1.14	RNA-Seq	TRANSCRIPTOMIC	PolyA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	ERP132573	Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	ENA FIRST PUBLIC:2022 01 24\|ENA LAST UPDATE:2022 01 24	SLX-19351.G9.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.G9.HMLG7DRXX.s_2.r_2.fq.gz	fastq fastq	2101607900.0	21016079.0	E MTAB 11086:SLX 19351.G9.HMLG7DRXX.s 2.r	0:50 1:50	A:557420271;C:491161431;G:497494262;T:555471610;N:60326	50	50	557420271	491161431	497494262	555471610	60326	ERX6700301	ERS8071625	ERA6757821	Cambridge Institute of Therapeutic Immunology & Infectious Disease\|European Nucleotide Archive	Cambridge Institute of Therapeutic Immunology & Infectious Disease\|European Nucleotide Archive	2	0.94378	0.94916	0.10779	0.10431	0.66507	0.66377	0.45477	0.4679	50	50	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	United Kingdom	2022-01-24	Larval	Larval	Embryo Imprecise	All anatomical structures
10291	10291	ERR7132862	ERX6700300	ERS8071624	ERP132573	PRJEB48231	RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	E-MTAB-11086	Transcriptome Analysis	RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.	ENA FIRST PUBLIC:2022 01 24\|ENA LAST UPDATE:2022 01 24	Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.	Nic 6	SAMEA10418780	Cambridge Institute of Therapeutic Immunology & Infectious Disease	ENA first public:2022 01 24\|ENA last update:2022 01 24\|External Id:SAMEA10418780\|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease\|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease\|INSDC first public:2022 01 24T16:27:32Z\|INSDC last update:2022 01 24T16:27:32Z\|INSDC status:public\|Submitter Id:E MTAB 11086:Nic 6\|age:5\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:larval day 5\|genotype:wild type genotype\|individual:pool of 7 embryos\|organism part:whole organism\|replicate:6\|sample name:E MTAB 11086:Nic 6\|sex:not available\|strain:Tüpfel long fin TLF	Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs	E MTAB 11086:Nic 6 p	Nic 6 p	RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.	Experimental Factor: compound:nicotine\|Experimental Factor: dose:5	RNA-Seq	TRANSCRIPTOMIC	PolyA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	ERP132573	Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	ENA FIRST PUBLIC:2022 01 24\|ENA LAST UPDATE:2022 01 24	SLX-19351.H11.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.H11.HMLG7DRXX.s_2.r_2.fq.gz	fastq fastq	2236235700.0	22362357.0	E MTAB 11086:SLX 19351.H11.HMLG7DRXX.s 2.r	0:50 1:50	A:597573047;C:518264376;G:525314754;T:595021334;N:62189	50	50	597573047	518264376	525314754	595021334	62189	ERX6700300	ERS8071624	ERA6757821	Cambridge Institute of Therapeutic Immunology & Infectious Disease\|European Nucleotide Archive	Cambridge Institute of Therapeutic Immunology & Infectious Disease\|European Nucleotide Archive	2	0.94255	0.94893	0.11268	0.10955	0.66819	0.66687	0.46882	0.47485	50	50	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	United Kingdom	2022-01-24	Larval	Larval	Embryo Imprecise	All anatomical structures
10292	10292	ERR7132861	ERX6700299	ERS8071623	ERP132573	PRJEB48231	RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	E-MTAB-11086	Transcriptome Analysis	RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.	ENA FIRST PUBLIC:2022 01 24\|ENA LAST UPDATE:2022 01 24	Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.	Nic 5	SAMEA10418779	Cambridge Institute of Therapeutic Immunology & Infectious Disease	ENA first public:2022 01 24\|ENA last update:2022 01 24\|External Id:SAMEA10418779\|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease\|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease\|INSDC first public:2022 01 24T16:27:32Z\|INSDC last update:2022 01 24T16:27:32Z\|INSDC status:public\|Submitter Id:E MTAB 11086:Nic 5\|age:5\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:larval day 5\|genotype:wild type genotype\|individual:pool of 7 embryos\|organism part:whole organism\|replicate:5\|sample name:E MTAB 11086:Nic 5\|sex:not available\|strain:Tüpfel long fin TLF	Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs	E MTAB 11086:Nic 5 p	Nic 5 p	RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.	Experimental Factor: compound:nicotine\|Experimental Factor: dose:5	RNA-Seq	TRANSCRIPTOMIC	PolyA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	ERP132573	Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	ENA FIRST PUBLIC:2022 01 24\|ENA LAST UPDATE:2022 01 24	SLX-19351.D10.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.D10.HMLG7DRXX.s_2.r_2.fq.gz	fastq fastq	1904348300.0	19043483.0	E MTAB 11086:SLX 19351.D10.HMLG7DRXX.s 2.r	0:50 1:50	A:506678821;C:443756285;G:450118827;T:503742221;N:52146	50	50	506678821	443756285	450118827	503742221	52146	ERX6700299	ERS8071623	ERA6757821	Cambridge Institute of Therapeutic Immunology & Infectious Disease\|European Nucleotide Archive	Cambridge Institute of Therapeutic Immunology & Infectious Disease\|European Nucleotide Archive	2	0.94468	0.95019	0.10313	0.10023	0.66762	0.66513	0.47749	0.47611	50	50	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	United Kingdom	2022-01-24	Larval	Larval	Embryo Imprecise	All anatomical structures
10293	10293	ERR7132860	ERX6700298	ERS8071622	ERP132573	PRJEB48231	RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	E-MTAB-11086	Transcriptome Analysis	RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.	ENA FIRST PUBLIC:2022 01 24\|ENA LAST UPDATE:2022 01 24	Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.	Nic 4	SAMEA10418778	Cambridge Institute of Therapeutic Immunology & Infectious Disease	ENA first public:2022 01 24\|ENA last update:2022 01 24\|External Id:SAMEA10418778\|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease\|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease\|INSDC first public:2022 01 24T16:27:32Z\|INSDC last update:2022 01 24T16:27:32Z\|INSDC status:public\|Submitter Id:E MTAB 11086:Nic 4\|age:5\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:larval day 5\|genotype:wild type genotype\|individual:pool of 7 embryos\|organism part:whole organism\|replicate:4\|sample name:E MTAB 11086:Nic 4\|sex:not available\|strain:Tüpfel long fin TLF	Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs	E MTAB 11086:Nic 4 p	Nic 4 p	RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.	Experimental Factor: compound:nicotine\|Experimental Factor: dose:5	RNA-Seq	TRANSCRIPTOMIC	PolyA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	ERP132573	Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	ENA FIRST PUBLIC:2022 01 24\|ENA LAST UPDATE:2022 01 24	SLX-19351.C10.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.C10.HMLG7DRXX.s_2.r_2.fq.gz	fastq fastq	2134565600.0	21345656.0	E MTAB 11086:SLX 19351.C10.HMLG7DRXX.s 2.r	0:50 1:50	A:568799307;C:496480840;G:503115671;T:566109163;N:60619	50	50	568799307	496480840	503115671	566109163	60619	ERX6700298	ERS8071622	ERA6757821	Cambridge Institute of Therapeutic Immunology & Infectious Disease\|European Nucleotide Archive	Cambridge Institute of Therapeutic Immunology & Infectious Disease\|European Nucleotide Archive	2	0.94279	0.94878	0.11466	0.1122	0.66291	0.66176	0.46991	0.47168	50	50	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	United Kingdom	2022-01-24	Larval	Larval	Embryo Imprecise	All anatomical structures
10294	10294	ERR7132859	ERX6700297	ERS8071621	ERP132573	PRJEB48231	RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	E-MTAB-11086	Transcriptome Analysis	RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.	ENA FIRST PUBLIC:2022 01 24\|ENA LAST UPDATE:2022 01 24	Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.	Nic 3	SAMEA10418777	Cambridge Institute of Therapeutic Immunology & Infectious Disease	ENA first public:2022 01 24\|ENA last update:2022 01 24\|External Id:SAMEA10418777\|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease\|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease\|INSDC first public:2022 01 24T16:27:32Z\|INSDC last update:2022 01 24T16:27:32Z\|INSDC status:public\|Submitter Id:E MTAB 11086:Nic 3\|age:5\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:larval day 5\|genotype:wild type genotype\|individual:pool of 7 embryos\|organism part:whole organism\|replicate:3\|sample name:E MTAB 11086:Nic 3\|sex:not available\|strain:Tüpfel long fin TLF	Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs	E MTAB 11086:Nic 3 p	Nic 3 p	RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.	Experimental Factor: compound:nicotine\|Experimental Factor: dose:5	RNA-Seq	TRANSCRIPTOMIC	PolyA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	ERP132573	Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	ENA FIRST PUBLIC:2022 01 24\|ENA LAST UPDATE:2022 01 24	SLX-19351.B10.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.B10.HMLG7DRXX.s_2.r_2.fq.gz	fastq fastq	2409355400.0	24093554.0	E MTAB 11086:SLX 19351.B10.HMLG7DRXX.s 2.r	0:50 1:50	A:643046449;C:559571909;G:567748411;T:638920943;N:67688	50	50	643046449	559571909	567748411	638920943	67688	ERX6700297	ERS8071621	ERA6757821	Cambridge Institute of Therapeutic Immunology & Infectious Disease\|European Nucleotide Archive	Cambridge Institute of Therapeutic Immunology & Infectious Disease\|European Nucleotide Archive	2	0.94305	0.94796	0.11097	0.10766	0.66149	0.65888	0.46643	0.47512	50	50	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	United Kingdom	2022-01-24	Larval	Larval	Embryo Imprecise	All anatomical structures
10295	10295	ERR7132858	ERX6700296	ERS8071620	ERP132573	PRJEB48231	RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	E-MTAB-11086	Transcriptome Analysis	RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.	ENA FIRST PUBLIC:2022 01 24\|ENA LAST UPDATE:2022 01 24	Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.	Nic 2	SAMEA10418776	Cambridge Institute of Therapeutic Immunology & Infectious Disease	ENA first public:2022 01 24\|ENA last update:2022 01 24\|External Id:SAMEA10418776\|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease\|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease\|INSDC first public:2022 01 24T16:27:32Z\|INSDC last update:2022 01 24T16:27:32Z\|INSDC status:public\|Submitter Id:E MTAB 11086:Nic 2\|age:5\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:larval day 5\|genotype:wild type genotype\|individual:pool of 7 embryos\|organism part:whole organism\|replicate:2\|sample name:E MTAB 11086:Nic 2\|sex:not available\|strain:Tüpfel long fin TLF	Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs	E MTAB 11086:Nic 2 p	Nic 2 p	RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.	Experimental Factor: compound:nicotine\|Experimental Factor: dose:5	RNA-Seq	TRANSCRIPTOMIC	PolyA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	ERP132573	Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	ENA FIRST PUBLIC:2022 01 24\|ENA LAST UPDATE:2022 01 24	SLX-19351.F10.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.F10.HMLG7DRXX.s_2.r_2.fq.gz	fastq fastq	2046910800.0	20469108.0	E MTAB 11086:SLX 19351.F10.HMLG7DRXX.s 2.r	0:50 1:50	A:547096034;C:475610002;G:481041169;T:543104402;N:59193	50	50	547096034	475610002	481041169	543104402	59193	ERX6700296	ERS8071620	ERA6757821	Cambridge Institute of Therapeutic Immunology & Infectious Disease\|European Nucleotide Archive	Cambridge Institute of Therapeutic Immunology & Infectious Disease\|European Nucleotide Archive	2	0.94391	0.94965	0.10824	0.10557	0.66241	0.65963	0.47747	0.47375	50	50	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	United Kingdom	2022-01-24	Larval	Larval	Embryo Imprecise	All anatomical structures
10296	10296	ERR7132857	ERX6700295	ERS8071619	ERP132573	PRJEB48231	RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	E-MTAB-11086	Transcriptome Analysis	RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.	ENA FIRST PUBLIC:2022 01 24\|ENA LAST UPDATE:2022 01 24	Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.	Nic 1	SAMEA10418775	Cambridge Institute of Therapeutic Immunology & Infectious Disease	ENA first public:2022 01 24\|ENA last update:2022 01 24\|External Id:SAMEA10418775\|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease\|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease\|INSDC first public:2022 01 24T16:27:32Z\|INSDC last update:2022 01 24T16:27:32Z\|INSDC status:public\|Submitter Id:E MTAB 11086:Nic 1\|age:5\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:larval day 5\|genotype:wild type genotype\|individual:pool of 7 embryos\|organism part:whole organism\|replicate:1\|sample name:E MTAB 11086:Nic 1\|sex:not available\|strain:Tüpfel long fin TLF	Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs	E MTAB 11086:Nic 1 p	Nic 1 p	RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.	Experimental Factor: compound:nicotine\|Experimental Factor: dose:5	RNA-Seq	TRANSCRIPTOMIC	PolyA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	ERP132573	Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	ENA FIRST PUBLIC:2022 01 24\|ENA LAST UPDATE:2022 01 24	SLX-19351.G10.HMLG7DRXX.s_2.r_2.fq.gz SLX-19351.G10.HMLG7DRXX.s_2.r_1.fq.gz	fastq fastq	2001312600.0	20013126.0	E MTAB 11086:SLX 19351.G10.HMLG7DRXX.s 2.r	0:50 1:50	A:535065614;C:463328218;G:468900497;T:533963156;N:55115	50	50	535065614	463328218	468900497	533963156	55115	ERX6700295	ERS8071619	ERA6757821	Cambridge Institute of Therapeutic Immunology & Infectious Disease\|European Nucleotide Archive	Cambridge Institute of Therapeutic Immunology & Infectious Disease\|European Nucleotide Archive	2	0.94179	0.9477	0.11455	0.11139	0.66697	0.66569	0.45749	0.47217	50	50	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	United Kingdom	2022-01-24	Larval	Larval	Embryo Imprecise	All anatomical structures
10297	10297	ERR7132856	ERX6700294	ERS8071618	ERP132573	PRJEB48231	RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	E-MTAB-11086	Transcriptome Analysis	RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.	ENA FIRST PUBLIC:2022 01 24\|ENA LAST UPDATE:2022 01 24	Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.	Cnt 6	SAMEA10418774	Cambridge Institute of Therapeutic Immunology & Infectious Disease	ENA first public:2022 01 24\|ENA last update:2022 01 24\|External Id:SAMEA10418774\|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease\|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease\|INSDC first public:2022 01 24T16:27:32Z\|INSDC last update:2022 01 24T16:27:32Z\|INSDC status:public\|Submitter Id:E MTAB 11086:Cnt 6\|age:5\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:larval day 5\|genotype:wild type genotype\|individual:pool of 7 embryos\|organism part:whole organism\|replicate:6\|sample name:E MTAB 11086:Cnt 6\|sex:not available\|strain:Tüpfel long fin TLF	Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs	E MTAB 11086:Cnt 6 p	Cnt 6 p	RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.	Experimental Factor: compound:n1	RNA-Seq	TRANSCRIPTOMIC	PolyA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	ERP132573	Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	ENA FIRST PUBLIC:2022 01 24\|ENA LAST UPDATE:2022 01 24	SLX-19351.C11.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.C11.HMLG7DRXX.s_2.r_2.fq.gz	fastq fastq	2311609400.0	23116094.0	E MTAB 11086:SLX 19351.C11.HMLG7DRXX.s 2.r	0:50 1:50	A:616569709;C:538286683;G:545161394;T:611525546;N:66068	50	50	616569709	538286683	545161394	611525546	66068	ERX6700294	ERS8071618	ERA6757821	Cambridge Institute of Therapeutic Immunology & Infectious Disease\|European Nucleotide Archive	Cambridge Institute of Therapeutic Immunology & Infectious Disease\|European Nucleotide Archive	2	0.94486	0.95028	0.1097	0.10661	0.66703	0.6644	0.47311	0.47453	50	50	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	United Kingdom	2022-01-24	Larval	Larval	Embryo Imprecise	All anatomical structures
10298	10298	ERR7132855	ERX6700293	ERS8071617	ERP132573	PRJEB48231	RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	E-MTAB-11086	Transcriptome Analysis	RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.	ENA FIRST PUBLIC:2022 01 24\|ENA LAST UPDATE:2022 01 24	Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.	Cnt 5	SAMEA10418773	Cambridge Institute of Therapeutic Immunology & Infectious Disease	ENA first public:2022 01 24\|ENA last update:2022 01 24\|External Id:SAMEA10418773\|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease\|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease\|INSDC first public:2022 01 24T16:27:32Z\|INSDC last update:2022 01 24T16:27:32Z\|INSDC status:public\|Submitter Id:E MTAB 11086:Cnt 5\|age:5\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:larval day 5\|genotype:wild type genotype\|individual:pool of 7 embryos\|organism part:whole organism\|replicate:5\|sample name:E MTAB 11086:Cnt 5\|sex:not available\|strain:Tüpfel long fin TLF	Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs	E MTAB 11086:Cnt 5 p	Cnt 5 p	RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.	Experimental Factor: compound:n1	RNA-Seq	TRANSCRIPTOMIC	PolyA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	ERP132573	Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	ENA FIRST PUBLIC:2022 01 24\|ENA LAST UPDATE:2022 01 24	SLX-19351.G11.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.G11.HMLG7DRXX.s_2.r_2.fq.gz	fastq fastq	1590322800.0	15903228.0	E MTAB 11086:SLX 19351.G11.HMLG7DRXX.s 2.r	0:50 1:50	A:407583907;C:385496371;G:392945463;T:404250386;N:46673	50	50	407583907	385496371	392945463	404250386	46673	ERX6700293	ERS8071617	ERA6757821	Cambridge Institute of Therapeutic Immunology & Infectious Disease\|European Nucleotide Archive	Cambridge Institute of Therapeutic Immunology & Infectious Disease\|European Nucleotide Archive	2	0.94942	0.95571	0.10693	0.10576	0.69329	0.69063	0.46419	0.4826	50	50	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	United Kingdom	2022-01-24	Larval	Larval	Embryo Imprecise	All anatomical structures
10299	10299	ERR7132854	ERX6700292	ERS8071616	ERP132573	PRJEB48231	RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	E-MTAB-11086	Transcriptome Analysis	RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.	ENA FIRST PUBLIC:2022 01 24\|ENA LAST UPDATE:2022 01 24	Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.	Cnt 4	SAMEA10418772	Cambridge Institute of Therapeutic Immunology & Infectious Disease	ENA first public:2022 01 24\|ENA last update:2022 01 24\|External Id:SAMEA10418772\|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease\|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease\|INSDC first public:2022 01 24T16:27:32Z\|INSDC last update:2022 01 24T16:27:32Z\|INSDC status:public\|Submitter Id:E MTAB 11086:Cnt 4\|age:5\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:larval day 5\|genotype:wild type genotype\|individual:pool of 7 embryos\|organism part:whole organism\|replicate:4\|sample name:E MTAB 11086:Cnt 4\|sex:not available\|strain:Tüpfel long fin TLF	Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs	E MTAB 11086:Cnt 4 p	Cnt 4 p	RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.	Experimental Factor: compound:n1	RNA-Seq	TRANSCRIPTOMIC	PolyA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	ERP132573	Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	ENA FIRST PUBLIC:2022 01 24\|ENA LAST UPDATE:2022 01 24	SLX-19351.C9.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.C9.HMLG7DRXX.s_2.r_2.fq.gz	fastq fastq	2079441500.0	20794415.0	E MTAB 11086:SLX 19351.C9.HMLG7DRXX.s 2.r	0:50 1:50	A:555430147;C:483109623;G:489773903;T:551069513;N:58314	50	50	555430147	483109623	489773903	551069513	58314	ERX6700292	ERS8071616	ERA6757821	Cambridge Institute of Therapeutic Immunology & Infectious Disease\|European Nucleotide Archive	Cambridge Institute of Therapeutic Immunology & Infectious Disease\|European Nucleotide Archive	2	0.94258	0.9491	0.10928	0.10545	0.66561	0.66279	0.46967	0.47237	50	50	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	United Kingdom	2022-01-24	Larval	Larval	Embryo Imprecise	All anatomical structures
10300	10300	ERR7132853	ERX6700291	ERS8071615	ERP132573	PRJEB48231	RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	E-MTAB-11086	Transcriptome Analysis	RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.	ENA FIRST PUBLIC:2022 01 24\|ENA LAST UPDATE:2022 01 24	Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.	Cnt 3	SAMEA10418771	Cambridge Institute of Therapeutic Immunology & Infectious Disease	ENA first public:2022 01 24\|ENA last update:2022 01 24\|External Id:SAMEA10418771\|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease\|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease\|INSDC first public:2022 01 24T16:27:32Z\|INSDC last update:2022 01 24T16:27:32Z\|INSDC status:public\|Submitter Id:E MTAB 11086:Cnt 3\|age:5\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:larval day 5\|genotype:wild type genotype\|individual:pool of 7 embryos\|organism part:whole organism\|replicate:3\|sample name:E MTAB 11086:Cnt 3\|sex:not available\|strain:Tüpfel long fin TLF	Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs	E MTAB 11086:Cnt 3 p	Cnt 3 p	RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.	Experimental Factor: compound:n1	RNA-Seq	TRANSCRIPTOMIC	PolyA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	ERP132573	Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	ENA FIRST PUBLIC:2022 01 24\|ENA LAST UPDATE:2022 01 24	SLX-19351.H10.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.H10.HMLG7DRXX.s_2.r_2.fq.gz	fastq fastq	2606680900.0	26066809.0	E MTAB 11086:SLX 19351.H10.HMLG7DRXX.s 2.r	0:50 1:50	A:698010494;C:604285893;G:612505273;T:691805693;N:73547	50	50	698010494	604285893	612505273	691805693	73547	ERX6700291	ERS8071615	ERA6757821	Cambridge Institute of Therapeutic Immunology & Infectious Disease\|European Nucleotide Archive	Cambridge Institute of Therapeutic Immunology & Infectious Disease\|European Nucleotide Archive	2	0.94271	0.94917	0.11288	0.10987	0.67115	0.66827	0.4729	0.4736	50	50	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	United Kingdom	2022-01-24	Larval	Larval	Embryo Imprecise	All anatomical structures
10301	10301	ERR7132852	ERX6700290	ERS8071614	ERP132573	PRJEB48231	RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	E-MTAB-11086	Transcriptome Analysis	RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.	ENA FIRST PUBLIC:2022 01 24\|ENA LAST UPDATE:2022 01 24	Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.	Cnt 2	SAMEA10418770	Cambridge Institute of Therapeutic Immunology & Infectious Disease	ENA first public:2022 01 24\|ENA last update:2022 01 24\|External Id:SAMEA10418770\|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease\|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease\|INSDC first public:2022 01 24T16:27:32Z\|INSDC last update:2022 01 24T16:27:32Z\|INSDC status:public\|Submitter Id:E MTAB 11086:Cnt 2\|age:5\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:larval day 5\|genotype:wild type genotype\|individual:pool of 7 embryos\|organism part:whole organism\|replicate:2\|sample name:E MTAB 11086:Cnt 2\|sex:not available\|strain:Tüpfel long fin TLF	Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs	E MTAB 11086:Cnt 2 p	Cnt 2 p	RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.	Experimental Factor: compound:n1	RNA-Seq	TRANSCRIPTOMIC	PolyA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	ERP132573	Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	ENA FIRST PUBLIC:2022 01 24\|ENA LAST UPDATE:2022 01 24	SLX-19351.E11.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.E11.HMLG7DRXX.s_2.r_2.fq.gz	fastq fastq	2248468400.0	22484684.0	E MTAB 11086:SLX 19351.E11.HMLG7DRXX.s 2.r	0:50 1:50	A:601914808;C:521501189;G:527610060;T:597380501;N:61842	50	50	601914808	521501189	527610060	597380501	61842	ERX6700290	ERS8071614	ERA6757821	Cambridge Institute of Therapeutic Immunology & Infectious Disease\|European Nucleotide Archive	Cambridge Institute of Therapeutic Immunology & Infectious Disease\|European Nucleotide Archive	2	0.94347	0.94939	0.11234	0.10984	0.66689	0.66342	0.46711	0.46831	50	50	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	United Kingdom	2022-01-24	Larval	Larval	Embryo Imprecise	All anatomical structures
10302	10302	ERR7132851	ERX6700289	ERS8071613	ERP132573	PRJEB48231	RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	E-MTAB-11086	Transcriptome Analysis	RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.	ENA FIRST PUBLIC:2022 01 24\|ENA LAST UPDATE:2022 01 24	Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.	Cnt 1	SAMEA10418769	Cambridge Institute of Therapeutic Immunology & Infectious Disease	ENA first public:2022 01 24\|ENA last update:2022 01 24\|External Id:SAMEA10418769\|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease\|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease\|INSDC first public:2022 01 24T16:27:32Z\|INSDC last update:2022 01 24T16:27:32Z\|INSDC status:public\|Submitter Id:E MTAB 11086:Cnt 1\|age:5\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:larval day 5\|genotype:wild type genotype\|individual:pool of 7 embryos\|organism part:whole organism\|replicate:1\|sample name:E MTAB 11086:Cnt 1\|sex:not available\|strain:Tüpfel long fin TLF	Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs	E MTAB 11086:Cnt 1 p	Cnt 1 p	RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.	Experimental Factor: compound:n1	RNA-Seq	TRANSCRIPTOMIC	PolyA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	ERP132573	Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	ENA FIRST PUBLIC:2022 01 24\|ENA LAST UPDATE:2022 01 24	SLX-19351.D11.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.D11.HMLG7DRXX.s_2.r_2.fq.gz	fastq fastq	1958517300.0	19585173.0	E MTAB 11086:SLX 19351.D11.HMLG7DRXX.s 2.r	0:50 1:50	A:523101436;C:454540970;G:459925156;T:520895141;N:54597	50	50	523101436	454540970	459925156	520895141	54597	ERX6700289	ERS8071613	ERA6757821	Cambridge Institute of Therapeutic Immunology & Infectious Disease\|European Nucleotide Archive	Cambridge Institute of Therapeutic Immunology & Infectious Disease\|European Nucleotide Archive	2	0.94413	0.95047	0.10482	0.10253	0.67044	0.66782	0.47233	0.4771	50	50	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	United Kingdom	2022-01-24	Larval	Larval	Embryo Imprecise	All anatomical structures
10303	10303	ERR7132850	ERX6700288	ERS8071612	ERP132573	PRJEB48231	RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	E-MTAB-11086	Transcriptome Analysis	RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.	ENA FIRST PUBLIC:2022 01 24\|ENA LAST UPDATE:2022 01 24	Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.	Amp 6	SAMEA10418768	Cambridge Institute of Therapeutic Immunology & Infectious Disease	ENA first public:2022 01 24\|ENA last update:2022 01 24\|External Id:SAMEA10418768\|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease\|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease\|INSDC first public:2022 01 24T16:27:32Z\|INSDC last update:2022 01 24T16:27:32Z\|INSDC status:public\|Submitter Id:E MTAB 11086:Amp 6\|age:5\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:larval day 5\|genotype:wild type genotype\|individual:pool of 7 embryos\|organism part:whole organism\|replicate:6\|sample name:E MTAB 11086:Amp 6\|sex:not available\|strain:Tüpfel long fin TLF	Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs	E MTAB 11086:Amp 6 p	Amp 6 p	RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.	Experimental Factor: compound:amphetamine\|Experimental Factor: dose:25	RNA-Seq	TRANSCRIPTOMIC	PolyA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	ERP132573	Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	ENA FIRST PUBLIC:2022 01 24\|ENA LAST UPDATE:2022 01 24	SLX-19351.E9.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.E9.HMLG7DRXX.s_2.r_2.fq.gz	fastq fastq	1712505000.0	17125050.0	E MTAB 11086:SLX 19351.E9.HMLG7DRXX.s 2.r	0:50 1:50	A:455641002;C:398314392;G:404466444;T:454036255;N:46907	50	50	455641002	398314392	404466444	454036255	46907	ERX6700288	ERS8071612	ERA6757821	Cambridge Institute of Therapeutic Immunology & Infectious Disease\|European Nucleotide Archive	Cambridge Institute of Therapeutic Immunology & Infectious Disease\|European Nucleotide Archive	2	0.94358	0.94966	0.10681	0.1037	0.66665	0.66373	0.46688	0.47225	50	50	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	United Kingdom	2022-01-24	Larval	Larval	Embryo Imprecise	All anatomical structures
10304	10304	ERR7132849	ERX6700287	ERS8071611	ERP132573	PRJEB48231	RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	E-MTAB-11086	Transcriptome Analysis	RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.	ENA FIRST PUBLIC:2022 01 24\|ENA LAST UPDATE:2022 01 24	Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.	Amp 5	SAMEA10418767	Cambridge Institute of Therapeutic Immunology & Infectious Disease	ENA first public:2022 01 24\|ENA last update:2022 01 24\|External Id:SAMEA10418767\|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease\|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease\|INSDC first public:2022 01 24T16:27:32Z\|INSDC last update:2022 01 24T16:27:32Z\|INSDC status:public\|Submitter Id:E MTAB 11086:Amp 5\|age:5\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:larval day 5\|genotype:wild type genotype\|individual:pool of 7 embryos\|organism part:whole organism\|replicate:5\|sample name:E MTAB 11086:Amp 5\|sex:not available\|strain:Tüpfel long fin TLF	Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs	E MTAB 11086:Amp 5 p	Amp 5 p	RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.	Experimental Factor: compound:amphetamine\|Experimental Factor: dose:25	RNA-Seq	TRANSCRIPTOMIC	PolyA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	ERP132573	Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	ENA FIRST PUBLIC:2022 01 24\|ENA LAST UPDATE:2022 01 24	SLX-19351.A10.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.A10.HMLG7DRXX.s_2.r_2.fq.gz	fastq fastq	2007519200.0	20075192.0	E MTAB 11086:SLX 19351.A10.HMLG7DRXX.s 2.r	0:50 1:50	A:534568558;C:467539630;G:473805079;T:531550688;N:55245	50	50	534568558	467539630	473805079	531550688	55245	ERX6700287	ERS8071611	ERA6757821	Cambridge Institute of Therapeutic Immunology & Infectious Disease\|European Nucleotide Archive	Cambridge Institute of Therapeutic Immunology & Infectious Disease\|European Nucleotide Archive	2	0.94408	0.9499	0.10888	0.10604	0.66797	0.66458	0.46039	0.46669	50	50	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	United Kingdom	2022-01-24	Larval	Larval	Embryo Imprecise	All anatomical structures
10305	10305	ERR7132848	ERX6700286	ERS8071610	ERP132573	PRJEB48231	RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	E-MTAB-11086	Transcriptome Analysis	RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.	ENA FIRST PUBLIC:2022 01 24\|ENA LAST UPDATE:2022 01 24	Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.	Amp 4	SAMEA10418766	Cambridge Institute of Therapeutic Immunology & Infectious Disease	ENA first public:2022 01 24\|ENA last update:2022 01 24\|External Id:SAMEA10418766\|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease\|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease\|INSDC first public:2022 01 24T16:27:32Z\|INSDC last update:2022 01 24T16:27:32Z\|INSDC status:public\|Submitter Id:E MTAB 11086:Amp 4\|age:5\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:larval day 5\|genotype:wild type genotype\|individual:pool of 7 embryos\|organism part:whole organism\|replicate:4\|sample name:E MTAB 11086:Amp 4\|sex:not available\|strain:Tüpfel long fin TLF	Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs	E MTAB 11086:Amp 4 p	Amp 4 p	RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.	Experimental Factor: compound:amphetamine\|Experimental Factor: dose:25	RNA-Seq	TRANSCRIPTOMIC	PolyA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	ERP132573	Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	ENA FIRST PUBLIC:2022 01 24\|ENA LAST UPDATE:2022 01 24	SLX-19351.F11.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.F11.HMLG7DRXX.s_2.r_2.fq.gz	fastq fastq	1845345300.0	18453453.0	E MTAB 11086:SLX 19351.F11.HMLG7DRXX.s 2.r	0:50 1:50	A:490920758;C:430637266;G:435667744;T:488067453;N:52079	50	50	490920758	430637266	435667744	488067453	52079	ERX6700286	ERS8071610	ERA6757821	Cambridge Institute of Therapeutic Immunology & Infectious Disease\|European Nucleotide Archive	Cambridge Institute of Therapeutic Immunology & Infectious Disease\|European Nucleotide Archive	2	0.94484	0.9504	0.10472	0.10237	0.66618	0.66336	0.46903	0.47774	50	50	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	United Kingdom	2022-01-24	Larval	Larval	Embryo Imprecise	All anatomical structures
10306	10306	ERR7132847	ERX6700285	ERS8071609	ERP132573	PRJEB48231	RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	E-MTAB-11086	Transcriptome Analysis	RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.	ENA FIRST PUBLIC:2022 01 24\|ENA LAST UPDATE:2022 01 24	Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.	Amp 3	SAMEA10418765	Cambridge Institute of Therapeutic Immunology & Infectious Disease	ENA first public:2022 01 24\|ENA last update:2022 01 24\|External Id:SAMEA10418765\|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease\|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease\|INSDC first public:2022 01 24T16:27:32Z\|INSDC last update:2022 01 24T16:27:32Z\|INSDC status:public\|Submitter Id:E MTAB 11086:Amp 3\|age:5\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:larval day 5\|genotype:wild type genotype\|individual:pool of 7 embryos\|organism part:whole organism\|replicate:3\|sample name:E MTAB 11086:Amp 3\|sex:not available\|strain:Tüpfel long fin TLF	Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs	E MTAB 11086:Amp 3 p	Amp 3 p	RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.	Experimental Factor: compound:amphetamine\|Experimental Factor: dose:25	RNA-Seq	TRANSCRIPTOMIC	PolyA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	ERP132573	Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	ENA FIRST PUBLIC:2022 01 24\|ENA LAST UPDATE:2022 01 24	SLX-19351.F9.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.F9.HMLG7DRXX.s_2.r_2.fq.gz	fastq fastq	2195415300.0	21954153.0	E MTAB 11086:SLX 19351.F9.HMLG7DRXX.s 2.r	0:50 1:50	A:583956682;C:511927452;G:518373455;T:581095379;N:62332	50	50	583956682	511927452	518373455	581095379	62332	ERX6700285	ERS8071609	ERA6757821	Cambridge Institute of Therapeutic Immunology & Infectious Disease\|European Nucleotide Archive	Cambridge Institute of Therapeutic Immunology & Infectious Disease\|European Nucleotide Archive	2	0.94571	0.95178	0.10567	0.10288	0.6688	0.66661	0.4677	0.47288	50	50	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	United Kingdom	2022-01-24	Larval	Larval	Embryo Imprecise	All anatomical structures
10307	10307	ERR7132846	ERX6700284	ERS8071608	ERP132573	PRJEB48231	RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	E-MTAB-11086	Transcriptome Analysis	RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.	ENA FIRST PUBLIC:2022 01 24\|ENA LAST UPDATE:2022 01 24	Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.	Amp 2	SAMEA10418764	Cambridge Institute of Therapeutic Immunology & Infectious Disease	ENA first public:2022 01 24\|ENA last update:2022 01 24\|External Id:SAMEA10418764\|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease\|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease\|INSDC first public:2022 01 24T16:27:32Z\|INSDC last update:2022 01 24T16:27:32Z\|INSDC status:public\|Submitter Id:E MTAB 11086:Amp 2\|age:5\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:larval day 5\|genotype:wild type genotype\|individual:pool of 7 embryos\|organism part:whole organism\|replicate:2\|sample name:E MTAB 11086:Amp 2\|sex:not available\|strain:Tüpfel long fin TLF	Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs	E MTAB 11086:Amp 2 p	Amp 2 p	RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.	Experimental Factor: compound:amphetamine\|Experimental Factor: dose:25	RNA-Seq	TRANSCRIPTOMIC	PolyA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	ERP132573	Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	ENA FIRST PUBLIC:2022 01 24\|ENA LAST UPDATE:2022 01 24	SLX-19351.D9.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.D9.HMLG7DRXX.s_2.r_2.fq.gz	fastq fastq	2093635000.0	20936350.0	E MTAB 11086:SLX 19351.D9.HMLG7DRXX.s 2.r	0:50 1:50	A:556451381;C:488314672;G:495691630;T:553118514;N:58803	50	50	556451381	488314672	495691630	553118514	58803	ERX6700284	ERS8071608	ERA6757821	Cambridge Institute of Therapeutic Immunology & Infectious Disease\|European Nucleotide Archive	Cambridge Institute of Therapeutic Immunology & Infectious Disease\|European Nucleotide Archive	2	0.94407	0.95012	0.11198	0.10872	0.66651	0.66352	0.46901	0.47198	50	50	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	United Kingdom	2022-01-24	Larval	Larval	Embryo Imprecise	All anatomical structures
10308	10308	ERR7132845	ERX6700283	ERS8071607	ERP132573	PRJEB48231	RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	E-MTAB-11086	Transcriptome Analysis	RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.	ENA FIRST PUBLIC:2022 01 24\|ENA LAST UPDATE:2022 01 24	Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.	Amp 1	SAMEA10418763	Cambridge Institute of Therapeutic Immunology & Infectious Disease	ENA first public:2022 01 24\|ENA last update:2022 01 24\|External Id:SAMEA10418763\|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease\|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease\|INSDC first public:2022 01 24T16:27:32Z\|INSDC last update:2022 01 24T16:27:32Z\|INSDC status:public\|Submitter Id:E MTAB 11086:Amp 1\|age:5\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:larval day 5\|genotype:wild type genotype\|individual:pool of 7 embryos\|organism part:whole organism\|replicate:1\|sample name:E MTAB 11086:Amp 1\|sex:not available\|strain:Tüpfel long fin TLF	Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs	E MTAB 11086:Amp 1 p	Amp 1 p	RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.	Experimental Factor: compound:amphetamine\|Experimental Factor: dose:25	RNA-Seq	TRANSCRIPTOMIC	PolyA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	ERP132573	Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs	ENA FIRST PUBLIC:2022 01 24\|ENA LAST UPDATE:2022 01 24	SLX-19351.E10.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.E10.HMLG7DRXX.s_2.r_2.fq.gz	fastq fastq	2254130000.0	22541300.0	E MTAB 11086:SLX 19351.E10.HMLG7DRXX.s 2.r	0:50 1:50	A:599784010;C:525655199;G:531849347;T:596777643;N:63801	50	50	599784010	525655199	531849347	596777643	63801	ERX6700283	ERS8071607	ERA6757821	Cambridge Institute of Therapeutic Immunology & Infectious Disease\|European Nucleotide Archive	Cambridge Institute of Therapeutic Immunology & Infectious Disease\|European Nucleotide Archive	2	0.94449	0.95026	0.10608	0.10323	0.66758	0.66257	0.46869	0.47045	50	50	B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	United Kingdom	2022-01-24	Larval	Larval	Embryo Imprecise	All anatomical structures
11723	11723	ERR11422840	ERX10830011	ERS15422295	ERP147133	PRJEB62042	RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein	E-MTAB-12934	Transcriptome Analysis	RNA seq of zebrafish embryos with mutations in srpk3 sa1890 allele and/or ttn.1 sa5562 allele. Each of the 24 samples six samples for each of four genotypes represents RNA from a pool of three 5 dpf zebrafish embryos.	ENA FIRST PUBLIC:2024 02 09\|ENA LAST UPDATE:2024 02 09	Protocols: Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina.	srpk3 hom ttn1 het 1	SAMEA113427169	QMUL	ENA FIRST PUBLIC:2024 02 09T16:00:07Z\|ENA LAST UPDATE:2024 02 09T16:00:07Z\|External Id:SAMEA113427169\|INSDC center name:QMUL\|INSDC first public:2024 02 09T16:00:07Z\|INSDC last update:2024 02 09T16:00:07Z\|INSDC status:public\|Submitter Id:E MTAB 12934:srpk3 hom ttn1 het 1\|age:5\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:embryo\|genotype:srpk3 / ; ttn.1 +/ \|individual:pool of 3 embryos 1\|organism part:embryo\|replicate:1\|sample name:E MTAB 12934:srpk3 hom ttn1 het 1\|scientific name:Danio rerio\|sex:not available\|strain:Tüpfel long fin	RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein	E MTAB 12934:srpk3 hom ttn1 het 1 p	srpk3 hom ttn1 het 1 p	RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein	Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina.	Experimental Factor: genotype:srpk3 / ; ttn.1 +/	RNA-Seq	TRANSCRIPTOMIC	PolyA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	ERP147133	Illumina NovaSeq 6000 paired end sequencing; RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein	ENA FIRST PUBLIC:2024 02 09\|ENA LAST UPDATE:2024 02 09	SLX-21419.C4.HV2TTDRXY.s_2.r_1.fq.gz SLX-21419.C4.HV2TTDRXY.s_2.r_2.fq.gz	fastq fastq	5201588100.0	17338627.0	E MTAB 12934:SLX 21419.C4.HV2TTDRXY.s 2.r	0:150 1:150	A:1395812979;C:1209220590;G:1233107747;T:1363200419;N:246365	150	150	1395812979	1209220590	1233107747	1363200419	246365	ERX10830011	ERS15422295	ERA23329494	European Bioinformatics Institute\|European Nucleotide Archive	European Bioinformatics Institute\|European Nucleotide Archive												B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	nebnext	bulk	unknown	unknown	United Kingdom	2024-02-09	Larval	Larval	Embryo Imprecise	All anatomical structures
11724	11724	ERR11422856	ERX10830027	ERS15422311	ERP147133	PRJEB62042	RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein	E-MTAB-12934	Transcriptome Analysis	RNA seq of zebrafish embryos with mutations in srpk3 sa1890 allele and/or ttn.1 sa5562 allele. Each of the 24 samples six samples for each of four genotypes represents RNA from a pool of three 5 dpf zebrafish embryos.	ENA FIRST PUBLIC:2024 02 09\|ENA LAST UPDATE:2024 02 09	Protocols: Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina.	srpk3 wt ttn1 het 8	SAMEA113427185	QMUL	ENA FIRST PUBLIC:2024 02 09T16:00:07Z\|ENA LAST UPDATE:2024 02 09T16:00:07Z\|External Id:SAMEA113427185\|INSDC center name:QMUL\|INSDC first public:2024 02 09T16:00:07Z\|INSDC last update:2024 02 09T16:00:07Z\|INSDC status:public\|Submitter Id:E MTAB 12934:srpk3 wt ttn1 het 8\|age:5\|broker name:ArrayExpress\|common name:zebrafish\|developmental stage:embryo\|genotype:srpk3 +/+; ttn.1 +/ \|individual:pool of 3 embryos 8\|organism part:embryo\|replicate:8\|sample name:E MTAB 12934:srpk3 wt ttn1 het 8\|scientific name:Danio rerio\|sex:not available\|strain:Tüpfel long fin	RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein	E MTAB 12934:srpk3 wt ttn1 het 8 p	srpk3 wt ttn1 het 8 p	RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein	Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina.	Experimental Factor: genotype:srpk3 +/+; ttn.1 +/	RNA-Seq	TRANSCRIPTOMIC	PolyA	PAIRED	ILLUMINA	Illumina NovaSeq 6000	ERP147133	Illumina NovaSeq 6000 paired end sequencing; RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein	ENA FIRST PUBLIC:2024 02 09\|ENA LAST UPDATE:2024 02 09	SLX-21419.C5.HV2TTDRXY.s_2.r_1.fq.gz SLX-21419.C5.HV2TTDRXY.s_2.r_2.fq.gz	fastq fastq	6243031800.0	20810106.0	E MTAB 12934:SLX 21419.C5.HV2TTDRXY.s 2.r	0:150 1:150	A:1678428066;C:1448795147;G:1483028868;T:1632478253;N:301466	150	150	1678428066	1448795147	1483028868	1632478253	301466	ERX10830027	ERS15422311	ERA23329494	European Bioinformatics Institute\|European Nucleotide Archive	European Bioinformatics Institute\|European Nucleotide Archive												B	B	biological fallback assumption	illumina	novaseq_era	unknown	poly_a	nebnext	bulk	unknown	unknown	United Kingdom	2024-02-09	Larval	Larval	Embryo Imprecise	All anatomical structures

Advanced export

JSON shape: default, array, newline-delimited

CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;