run_metadata
79 rows where experiment.library_selection = "PolyA", experiment.library_strategy = "RNA-Seq" and technology = "smartseq"
This data as json, CSV (advanced)
| Link | rowid ▼ | run.accession | experiment.accession | sample.accession | study.accession | bioproject | study.title | study.alias | study.type | study.abstract | study.attributes | study.PMIDs | sample.description | sample.title | sample.alias | sample.centername | sample.attributes | GEOsample.title | GEOsample.dataprocessing | GEOsample.source | GEOsample.treatmentprotocol | GEOsample.extractprotocol | GEOsample.growthprotocol | GEOsample.characteristics | GEOsample.accession | experiment.title | experiment.alias | experiment.library_name | experiment.design_description | experiment.library_construction_protocol | experiment.attributes | experiment.library_strategy | experiment.library_source | experiment.library_selection | experiment.library_layout | experiment.platform | experiment.instrument_model | experiment.spot_descriptor | experiment.study_ref | run.title | run.attributes | run.filename | run.semantic_name | run.total_bases | run.total_spots | run.alias | run.read_lengths | run.base_counts | run.r1_length | run.r2_length | run.r3_length | run.r4_length | run.Acount | run.Ccount | run.Gcount | run.Tcount | run.Ncount | run.experiment | run.pool_member | submission.accession | submission.srasource | submission.bioprojectsource | seqdetective.n_mates | seqdetective.mapping_rate.mate1 | seqdetective.mapping_rate.mate2 | seqdetective.nofeature_rate.mate1 | seqdetective.nofeature_rate.mate2 | seqdetective.sparsity.mate1 | seqdetective.sparsity.mate2 | seqdetective.pos_strand_rate.mate1 | seqdetective.pos_strand_rate.mate2 | seqdetective.readlen.mate1 | seqdetective.readlen.mate2 | seqdetective.judgement.mate1 | seqdetective.judgement.mate2 | seqdetective.judgement.reason | platform_family | instrument_generation | read_bias | selection_class | prep_kit | sc_or_bulk | tech_class | technology | tech_variant | submission.bioprojectsource.country | earliest_date | devstage_curation | devstage_curation_coarse | tissue_curation | tissue_curation_coarse |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 9651 | 9651 | ERR3266392 | ERX3293003 | ERS3358386 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp positive rep2 | SAMEA5556346 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp positive rep2 s | sponge tdr gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_9pos_S2_L001_R1_001.fastq.gz | fastq | 603238067.0 | 8014716.0 | E MTAB 7846:sponge tdr gfp positive rep2 lane1 | 0:75.27 1:0 | A:164797697;C:136552121;G:141138007;T:160737152;N:13090 | 75 | 0 | 164797697 | 136552121 | 141138007 | 160737152 | 13090 | ERX3293003 | ERS3358386 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95083 | 0.06432 | 0.71532 | 0.50098 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9652 | 9652 | ERR3266393 | ERX3293003 | ERS3358386 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp positive rep2 | SAMEA5556346 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp positive rep2 s | sponge tdr gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_9pos_S2_L002_R1_001.fastq.gz | fastq | 603749720.0 | 8021069.0 | E MTAB 7846:sponge tdr gfp positive rep2 lane2 | 0:75.27 1:0 | A:164972969;C:136661417;G:141205792;T:160896264;N:13278 | 75 | 0 | 164972969 | 136661417 | 141205792 | 160896264 | 13278 | ERX3293003 | ERS3358386 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.951 | 0.06542 | 0.71768 | 0.50051 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9653 | 9653 | ERR3266394 | ERX3293003 | ERS3358386 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp positive rep2 | SAMEA5556346 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp positive rep2 s | sponge tdr gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_9pos_S2_L003_R1_001.fastq.gz | fastq | 608154053.0 | 8079704.0 | E MTAB 7846:sponge tdr gfp positive rep2 lane3 | 0:75.27 1:0 | A:166117918;C:137731172;G:142320339;T:161970092;N:14532 | 75 | 0 | 166117918 | 137731172 | 142320339 | 161970092 | 14532 | ERX3293003 | ERS3358386 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95155 | 0.0657 | 0.71634 | 0.49493 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9654 | 9654 | ERR3266395 | ERX3293003 | ERS3358386 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp positive rep2 | SAMEA5556346 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp positive rep2 s | sponge tdr gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_9pos_S2_L004_R1_001.fastq.gz | fastq | 599143392.0 | 7959897.0 | E MTAB 7846:sponge tdr gfp positive rep2 lane4 | 0:75.27 1:0 | A:163706904;C:135622453;G:140192351;T:159605249;N:16435 | 75 | 0 | 163706904 | 135622453 | 140192351 | 159605249 | 16435 | ERX3293003 | ERS3358386 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95061 | 0.06431 | 0.71764 | 0.50166 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9655 | 9655 | ERR3266388 | ERX3293002 | ERS3358385 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp positive rep1 | SAMEA5556345 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp positive rep1 s | sponge tdr gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_6pos_S4_L001_R1_001.fastq.gz | fastq | 616761505.0 | 8202480.0 | E MTAB 7846:sponge tdr gfp positive rep1 lane1 | 0:75.19 1:0 | A:168679238;C:139548565;G:143969797;T:164545362;N:18543 | 75 | 0 | 168679238 | 139548565 | 143969797 | 164545362 | 18543 | ERX3293002 | ERS3358385 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95019 | 0.06806 | 0.7097 | 0.50337 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9656 | 9656 | ERR3266389 | ERX3293002 | ERS3358385 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp positive rep1 | SAMEA5556345 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp positive rep1 s | sponge tdr gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_6pos_S4_L002_R1_001.fastq.gz | fastq | 617529482.0 | 8212485.0 | E MTAB 7846:sponge tdr gfp positive rep1 lane2 | 0:75.19 1:0 | A:168925757;C:139655387;G:144096837;T:164831236;N:20265 | 75 | 0 | 168925757 | 139655387 | 144096837 | 164831236 | 20265 | ERX3293002 | ERS3358385 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.9492 | 0.06753 | 0.712 | 0.49881 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9657 | 9657 | ERR3266390 | ERX3293002 | ERS3358385 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp positive rep1 | SAMEA5556345 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp positive rep1 s | sponge tdr gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_6pos_S4_L003_R1_001.fastq.gz | fastq | 624156883.0 | 8300861.0 | E MTAB 7846:sponge tdr gfp positive rep1 lane3 | 0:75.19 1:0 | A:170696950;C:141302376;G:145759286;T:166377781;N:20490 | 75 | 0 | 170696950 | 141302376 | 145759286 | 166377781 | 20490 | ERX3293002 | ERS3358385 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94917 | 0.06724 | 0.71291 | 0.50783 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9658 | 9658 | ERR3266391 | ERX3293002 | ERS3358385 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp positive rep1 | SAMEA5556345 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp positive rep1 s | sponge tdr gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_6pos_S4_L004_R1_001.fastq.gz | fastq | 615013615.0 | 8179180.0 | E MTAB 7846:sponge tdr gfp positive rep1 lane4 | 0:75.19 1:0 | A:168237742;C:139106952;G:143535658;T:164110735;N:22528 | 75 | 0 | 168237742 | 139106952 | 143535658 | 164110735 | 22528 | ERX3293002 | ERS3358385 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94892 | 0.06723 | 0.71206 | 0.50775 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9659 | 9659 | ERR3266384 | ERX3293001 | ERS3358384 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp negative rep2 | SAMEA5556344 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556344|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp negative rep2 s | sponge tdr gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_9neg_S1_L001_R1_001.fastq.gz | fastq | 659562366.0 | 8762947.0 | E MTAB 7846:sponge tdr gfp negative rep2 lane1 | 0:75.27 1:0 | A:178744772;C:150091912;G:155092318;T:175619332;N:14032 | 75 | 0 | 178744772 | 150091912 | 155092318 | 175619332 | 14032 | ERX3293001 | ERS3358384 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.9517 | 0.06908 | 0.70822 | 0.48025 | 73 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9660 | 9660 | ERR3266385 | ERX3293001 | ERS3358384 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp negative rep2 | SAMEA5556344 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556344|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp negative rep2 s | sponge tdr gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_9neg_S1_L002_R1_001.fastq.gz | fastq | 658688825.0 | 8751176.0 | E MTAB 7846:sponge tdr gfp negative rep2 lane2 | 0:75.27 1:0 | A:178540155;C:149844100;G:154850294;T:175438757;N:15519 | 75 | 0 | 178540155 | 149844100 | 154850294 | 175438757 | 15519 | ERX3293001 | ERS3358384 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95059 | 0.06748 | 0.70806 | 0.48177 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9661 | 9661 | ERR3266386 | ERX3293001 | ERS3358384 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp negative rep2 | SAMEA5556344 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556344|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp negative rep2 s | sponge tdr gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_9neg_S1_L003_R1_001.fastq.gz | fastq | 665901310.0 | 8846927.0 | E MTAB 7846:sponge tdr gfp negative rep2 lane3 | 0:75.27 1:0 | A:180412445;C:151589489;G:156677030;T:177206192;N:16154 | 75 | 0 | 180412445 | 151589489 | 156677030 | 177206192 | 16154 | ERX3293001 | ERS3358384 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95095 | 0.06855 | 0.7082 | 0.4787 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9662 | 9662 | ERR3266387 | ERX3293001 | ERS3358384 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp negative rep2 | SAMEA5556344 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556344|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp negative rep2 s | sponge tdr gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_9neg_S1_L004_R1_001.fastq.gz | fastq | 655674573.0 | 8711278.0 | E MTAB 7846:sponge tdr gfp negative rep2 lane4 | 0:75.27 1:0 | A:177658097;C:149188009;G:154201531;T:174609176;N:17760 | 75 | 0 | 177658097 | 149188009 | 154201531 | 174609176 | 17760 | ERX3293001 | ERS3358384 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.9503 | 0.06838 | 0.70926 | 0.47475 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9663 | 9663 | ERR3266380 | ERX3293000 | ERS3358383 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp negative rep1 | SAMEA5556343 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556343|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp negative rep1 s | sponge tdr gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_6neg_S3_L001_R1_001.fastq.gz | fastq | 634491637.0 | 8440052.0 | E MTAB 7846:sponge tdr gfp negative rep1 lane1 | 0:75.18 1:0 | A:170881257;C:145535643;G:150561786;T:167495156;N:17795 | 75 | 0 | 170881257 | 145535643 | 150561786 | 167495156 | 17795 | ERX3293000 | ERS3358383 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94996 | 0.05672 | 0.70571 | 0.48691 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9664 | 9664 | ERR3266381 | ERX3293000 | ERS3358383 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp negative rep1 | SAMEA5556343 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556343|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp negative rep1 s | sponge tdr gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_6neg_S3_L002_R1_001.fastq.gz | fastq | 632900752.0 | 8418846.0 | E MTAB 7846:sponge tdr gfp negative rep1 lane2 | 0:75.18 1:0 | A:170454908;C:145141392;G:150172752;T:167112562;N:19138 | 75 | 0 | 170454908 | 145141392 | 150172752 | 167112562 | 19138 | ERX3293000 | ERS3358383 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94905 | 0.05627 | 0.70457 | 0.4865 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9665 | 9665 | ERR3266382 | ERX3293000 | ERS3358383 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp negative rep1 | SAMEA5556343 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556343|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp negative rep1 s | sponge tdr gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_6neg_S3_L003_R1_001.fastq.gz | fastq | 638530115.0 | 8494045.0 | E MTAB 7846:sponge tdr gfp negative rep1 lane3 | 0:75.17 1:0 | A:171907482;C:146526309;G:151612209;T:168464163;N:19952 | 75 | 0 | 171907482 | 146526309 | 151612209 | 168464163 | 19952 | ERX3293000 | ERS3358383 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94919 | 0.05578 | 0.70849 | 0.48073 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9666 | 9666 | ERR3266383 | ERX3293000 | ERS3358383 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp negative rep1 | SAMEA5556343 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556343|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp negative rep1 s | sponge tdr gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_6neg_S3_L004_R1_001.fastq.gz | fastq | 627433322.0 | 8346505.0 | E MTAB 7846:sponge tdr gfp negative rep1 lane4 | 0:75.17 1:0 | A:169016383;C:143886824;G:148914725;T:165593528;N:21862 | 75 | 0 | 169016383 | 143886824 | 148914725 | 165593528 | 21862 | ERX3293000 | ERS3358383 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94993 | 0.05721 | 0.7052 | 0.48878 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9667 | 9667 | ERR3266376 | ERX3292999 | ERS3358382 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp positive rep2 | SAMEA5556342 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556342|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp positive rep2 s | sponge isl gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_7pos_S10_L001_R1_001.fastq.gz | fastq | 618672195.0 | 8218047.0 | E MTAB 7846:sponge isl gfp positive rep2 lane1 | 0:75.28 1:0 | A:166422886;C:142212204;G:146857539;T:163167819;N:11747 | 75 | 0 | 166422886 | 142212204 | 146857539 | 163167819 | 11747 | ERX3292999 | ERS3358382 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94979 | 0.08351 | 0.70863 | 0.47581 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9668 | 9668 | ERR3266377 | ERX3292999 | ERS3358382 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp positive rep2 | SAMEA5556342 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556342|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp positive rep2 s | sponge isl gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_7pos_S10_L002_R1_001.fastq.gz | fastq | 618709102.0 | 8218295.0 | E MTAB 7846:sponge isl gfp positive rep2 lane2 | 0:75.28 1:0 | A:166470432;C:142189977;G:146819280;T:163216323;N:13090 | 75 | 0 | 166470432 | 142189977 | 146819280 | 163216323 | 13090 | ERX3292999 | ERS3358382 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94977 | 0.08255 | 0.70644 | 0.47228 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9669 | 9669 | ERR3266378 | ERX3292999 | ERS3358382 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp positive rep2 | SAMEA5556342 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556342|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp positive rep2 s | sponge isl gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_7pos_S10_L003_R1_001.fastq.gz | fastq | 625353059.0 | 8306375.0 | E MTAB 7846:sponge isl gfp positive rep2 lane3 | 0:75.29 1:0 | A:168233274;C:143793178;G:148510556;T:164802476;N:13575 | 75 | 0 | 168233274 | 143793178 | 148510556 | 164802476 | 13575 | ERX3292999 | ERS3358382 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95014 | 0.08368 | 0.70743 | 0.47846 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9670 | 9670 | ERR3266379 | ERX3292999 | ERS3358382 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp positive rep2 | SAMEA5556342 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556342|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp positive rep2 s | sponge isl gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_7pos_S10_L004_R1_001.fastq.gz | fastq | 615204990.0 | 8171748.0 | E MTAB 7846:sponge isl gfp positive rep2 lane4 | 0:75.28 1:0 | A:165565861;C:141380152;G:146028839;T:162214263;N:15875 | 75 | 0 | 165565861 | 141380152 | 146028839 | 162214263 | 15875 | ERX3292999 | ERS3358382 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94954 | 0.08233 | 0.70834 | 0.48166 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9671 | 9671 | ERR3266372 | ERX3292998 | ERS3358381 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp positive rep1 | SAMEA5556341 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556341|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp positive rep1 s | sponge isl gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_6pos_S12_L001_R1_001.fastq.gz | fastq | 626474467.0 | 8318996.0 | E MTAB 7846:sponge isl gfp positive rep1 lane1 | 0:75.31 1:0 | A:170186220;C:142441110;G:147048643;T:166786401;N:12093 | 75 | 0 | 170186220 | 142441110 | 147048643 | 166786401 | 12093 | ERX3292998 | ERS3358381 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94907 | 0.08132 | 0.69684 | 0.4736 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9672 | 9672 | ERR3266373 | ERX3292998 | ERS3358381 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp positive rep1 | SAMEA5556341 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556341|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp positive rep1 s | sponge isl gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_6pos_S12_L002_R1_001.fastq.gz | fastq | 626477579.0 | 8318750.0 | E MTAB 7846:sponge isl gfp positive rep1 lane2 | 0:75.31 1:0 | A:170185337;C:142396801;G:147032265;T:166850532;N:12644 | 75 | 0 | 170185337 | 142396801 | 147032265 | 166850532 | 12644 | ERX3292998 | ERS3358381 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94941 | 0.08253 | 0.6957 | 0.47554 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9673 | 9673 | ERR3266374 | ERX3292998 | ERS3358381 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp positive rep1 | SAMEA5556341 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556341|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp positive rep1 s | sponge isl gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_6pos_S12_L003_R1_001.fastq.gz | fastq | 632098509.0 | 8393388.0 | E MTAB 7846:sponge isl gfp positive rep1 lane3 | 0:75.31 1:0 | A:171699353;C:143766296;G:148442110;T:168177264;N:13486 | 75 | 0 | 171699353 | 143766296 | 148442110 | 168177264 | 13486 | ERX3292998 | ERS3358381 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94866 | 0.08247 | 0.69601 | 0.48009 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9674 | 9674 | ERR3266375 | ERX3292998 | ERS3358381 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp positive rep1 | SAMEA5556341 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556341|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp positive rep1 s | sponge isl gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_6pos_S12_L004_R1_001.fastq.gz | fastq | 622997479.0 | 8272752.0 | E MTAB 7846:sponge isl gfp positive rep1 lane4 | 0:75.31 1:0 | A:169306677;C:141586415;G:146241288;T:165847752;N:15347 | 75 | 0 | 169306677 | 141586415 | 146241288 | 165847752 | 15347 | ERX3292998 | ERS3358381 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.9483 | 0.08034 | 0.69662 | 0.47868 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9675 | 9675 | ERR3266368 | ERX3292997 | ERS3358380 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp negative rep2 | SAMEA5556340 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556340|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp negative rep2 s | sponge isl gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_7neg_S9_L001_R1_001.fastq.gz | fastq | 707454819.0 | 9395082.0 | E MTAB 7846:sponge isl gfp negative rep2 lane1 | 0:75.30 1:0 | A:194991862;C:157927850;G:163280639;T:191241488;N:12980 | 75 | 0 | 194991862 | 157927850 | 163280639 | 191241488 | 12980 | ERX3292997 | ERS3358380 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.93871 | 0.08926 | 0.70806 | 0.46501 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9676 | 9676 | ERR3266369 | ERX3292997 | ERS3358380 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp negative rep2 | SAMEA5556340 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556340|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp negative rep2 s | sponge isl gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_7neg_S9_L002_R1_001.fastq.gz | fastq | 704791838.0 | 9359668.0 | E MTAB 7846:sponge isl gfp negative rep2 lane2 | 0:75.30 1:0 | A:194317422;C:157276895;G:162624670;T:190558322;N:14529 | 75 | 0 | 194317422 | 157276895 | 162624670 | 190558322 | 14529 | ERX3292997 | ERS3358380 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.93816 | 0.08859 | 0.70999 | 0.4661 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9677 | 9677 | ERR3266370 | ERX3292997 | ERS3358380 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp negative rep2 | SAMEA5556340 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556340|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp negative rep2 s | sponge isl gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_7neg_S9_L003_R1_001.fastq.gz | fastq | 715991833.0 | 9508323.0 | E MTAB 7846:sponge isl gfp negative rep2 lane3 | 0:75.30 1:0 | A:197297222;C:159913026;G:165363927;T:193402765;N:14893 | 75 | 0 | 197297222 | 159913026 | 165363927 | 193402765 | 14893 | ERX3292997 | ERS3358380 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.93844 | 0.08854 | 0.70828 | 0.46042 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9678 | 9678 | ERR3266371 | ERX3292997 | ERS3358380 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp negative rep2 | SAMEA5556340 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556340|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp negative rep2 s | sponge isl gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_7neg_S9_L004_R1_001.fastq.gz | fastq | 703723869.0 | 9345669.0 | E MTAB 7846:sponge isl gfp negative rep2 lane4 | 0:75.30 1:0 | A:194029886;C:157050176;G:162432310;T:190193608;N:17889 | 75 | 0 | 194029886 | 157050176 | 162432310 | 190193608 | 17889 | ERX3292997 | ERS3358380 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.93897 | 0.08993 | 0.70863 | 0.45707 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9679 | 9679 | ERR3266364 | ERX3292996 | ERS3358379 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp negative rep1 | SAMEA5556339 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556339|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp negative rep1 s | sponge isl gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_6neg_S11_L001_R1_001.fastq.gz | fastq | 676581458.0 | 8983758.0 | E MTAB 7846:sponge isl gfp negative rep1 lane1 | 0:75.31 1:0 | A:184297337;C:153352193;G:158268476;T:180651038;N:12414 | 75 | 0 | 184297337 | 153352193 | 158268476 | 180651038 | 12414 | ERX3292996 | ERS3358379 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94981 | 0.07715 | 0.69138 | 0.47243 | 74 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9680 | 9680 | ERR3266365 | ERX3292996 | ERS3358379 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp negative rep1 | SAMEA5556339 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556339|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp negative rep1 s | sponge isl gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_6neg_S11_L002_R1_001.fastq.gz | fastq | 676876555.0 | 8987445.0 | E MTAB 7846:sponge isl gfp negative rep1 lane2 | 0:75.31 1:0 | A:184435129;C:153332402;G:158323789;T:180770978;N:14257 | 75 | 0 | 184435129 | 153332402 | 158323789 | 180770978 | 14257 | ERX3292996 | ERS3358379 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94901 | 0.07805 | 0.69179 | 0.47182 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9681 | 9681 | ERR3266366 | ERX3292996 | ERS3358379 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp negative rep1 | SAMEA5556339 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556339|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp negative rep1 s | sponge isl gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_6neg_S11_L003_R1_001.fastq.gz | fastq | 681771213.0 | 9052615.0 | E MTAB 7846:sponge isl gfp negative rep1 lane3 | 0:75.31 1:0 | A:185717696;C:154552039;G:159567102;T:181919781;N:14595 | 75 | 0 | 185717696 | 154552039 | 159567102 | 181919781 | 14595 | ERX3292996 | ERS3358379 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94923 | 0.07768 | 0.69167 | 0.47219 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9682 | 9682 | ERR3266367 | ERX3292996 | ERS3358379 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp negative rep1 | SAMEA5556339 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556339|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp negative rep1 s | sponge isl gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_6neg_S11_L004_R1_001.fastq.gz | fastq | 671169917.0 | 8911624.0 | E MTAB 7846:sponge isl gfp negative rep1 lane4 | 0:75.31 1:0 | A:182910490;C:152045814;G:157010053;T:179186548;N:17012 | 75 | 0 | 182910490 | 152045814 | 157010053 | 179186548 | 17012 | ERX3292996 | ERS3358379 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94941 | 0.07612 | 0.69106 | 0.47736 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9683 | 9683 | ERR3266360 | ERX3292995 | ERS3358378 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp positive rep2 | SAMEA5556338 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556338|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp positive rep2 s | sponge ccn gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_8pos_S6_L001_R1_001.fastq.gz | fastq | 745666738.0 | 9917771.0 | E MTAB 7846:sponge ccn gfp positive rep2 lane1 | 0:75.18 1:0 | A:207714377;C:163732420;G:169037726;T:205161925;N:20290 | 75 | 0 | 207714377 | 163732420 | 169037726 | 205161925 | 20290 | ERX3292995 | ERS3358378 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94006 | 0.17809 | 0.68166 | 0.48912 | 74 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9684 | 9684 | ERR3266361 | ERX3292995 | ERS3358378 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp positive rep2 | SAMEA5556338 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556338|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp positive rep2 s | sponge ccn gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_8pos_S6_L002_R1_001.fastq.gz | fastq | 747693645.0 | 9944395.0 | E MTAB 7846:sponge ccn gfp positive rep2 lane2 | 0:75.19 1:0 | A:208257288;C:164106384;G:169478025;T:205830399;N:21549 | 75 | 0 | 208257288 | 164106384 | 169478025 | 205830399 | 21549 | ERX3292995 | ERS3358378 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.93873 | 0.17738 | 0.68296 | 0.49656 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9685 | 9685 | ERR3266362 | ERX3292995 | ERS3358378 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp positive rep2 | SAMEA5556338 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556338|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp positive rep2 s | sponge ccn gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_8pos_S6_L003_R1_001.fastq.gz | fastq | 756134124.0 | 10056818.0 | E MTAB 7846:sponge ccn gfp positive rep2 lane3 | 0:75.19 1:0 | A:210573012;C:166089133;G:171475300;T:207973232;N:23447 | 75 | 0 | 210573012 | 166089133 | 171475300 | 207973232 | 23447 | ERX3292995 | ERS3358378 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94077 | 0.18001 | 0.68004 | 0.49812 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9686 | 9686 | ERR3266363 | ERX3292995 | ERS3358378 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp positive rep2 | SAMEA5556338 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556338|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp positive rep2 s | sponge ccn gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_8pos_S6_L004_R1_001.fastq.gz | fastq | 747687619.0 | 9944417.0 | E MTAB 7846:sponge ccn gfp positive rep2 lane4 | 0:75.19 1:0 | A:208315943;C:164104155;G:169484250;T:205757712;N:25559 | 75 | 0 | 208315943 | 164104155 | 169484250 | 205757712 | 25559 | ERX3292995 | ERS3358378 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94025 | 0.17965 | 0.68124 | 0.49249 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9687 | 9687 | ERR3266356 | ERX3292994 | ERS3358377 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp positive rep1 | SAMEA5556337 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556337|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp positive rep1 s | sponge ccn gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_7pos_S8_L001_R1_001.fastq.gz | fastq | 600153564.0 | 7972767.0 | E MTAB 7846:sponge ccn gfp positive rep1 lane1 | 0:75.28 1:0 | A:165075878;C:133961511;G:138306424;T:162797903;N:11848 | 75 | 0 | 165075878 | 133961511 | 138306424 | 162797903 | 11848 | ERX3292994 | ERS3358377 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95367 | 0.14146 | 0.69154 | 0.46621 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9688 | 9688 | ERR3266357 | ERX3292994 | ERS3358377 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp positive rep1 | SAMEA5556337 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556337|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp positive rep1 s | sponge ccn gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_7pos_S8_L002_R1_001.fastq.gz | fastq | 600790169.0 | 7981038.0 | E MTAB 7846:sponge ccn gfp positive rep1 lane2 | 0:75.28 1:0 | A:165262968;C:133988329;G:138458635;T:163066854;N:13383 | 75 | 0 | 165262968 | 133988329 | 138458635 | 163066854 | 13383 | ERX3292994 | ERS3358377 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95365 | 0.14116 | 0.69301 | 0.46836 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9689 | 9689 | ERR3266358 | ERX3292994 | ERS3358377 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp positive rep1 | SAMEA5556337 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556337|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp positive rep1 s | sponge ccn gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_7pos_S8_L003_R1_001.fastq.gz | fastq | 608611085.0 | 8084904.0 | E MTAB 7846:sponge ccn gfp positive rep1 lane3 | 0:75.28 1:0 | A:167402055;C:135871708;G:140314669;T:165009252;N:13401 | 75 | 0 | 167402055 | 135871708 | 140314669 | 165009252 | 13401 | ERX3292994 | ERS3358377 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95403 | 0.14167 | 0.69311 | 0.4702 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9690 | 9690 | ERR3266359 | ERX3292994 | ERS3358377 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp positive rep1 | SAMEA5556337 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556337|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp positive rep1 s | sponge ccn gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_7pos_S8_L004_R1_001.fastq.gz | fastq | 599558663.0 | 7964718.0 | E MTAB 7846:sponge ccn gfp positive rep1 lane4 | 0:75.28 1:0 | A:164965131;C:133749666;G:138194884;T:162633558;N:15424 | 75 | 0 | 164965131 | 133749666 | 138194884 | 162633558 | 15424 | ERX3292994 | ERS3358377 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95285 | 0.14085 | 0.69037 | 0.47345 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9691 | 9691 | ERR3266352 | ERX3292993 | ERS3358376 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp negative rep2 | SAMEA5556336 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556336|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp negative rep2 s | sponge ccn gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_8neg_S5_L001_R1_001.fastq.gz | fastq | 599599608.0 | 7970460.0 | E MTAB 7846:sponge ccn gfp negative rep2 lane1 | 0:75.23 1:0 | A:162236409;C:136907675;G:141538730;T:158902520;N:14274 | 75 | 0 | 162236409 | 136907675 | 141538730 | 158902520 | 14274 | ERX3292993 | ERS3358376 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95404 | 0.05923 | 0.69737 | 0.48627 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9692 | 9692 | ERR3266353 | ERX3292993 | ERS3358376 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp negative rep2 | SAMEA5556336 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556336|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp negative rep2 s | sponge ccn gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_8neg_S5_L002_R1_001.fastq.gz | fastq | 600057776.0 | 7976438.0 | E MTAB 7846:sponge ccn gfp negative rep2 lane2 | 0:75.23 1:0 | A:162367410;C:136994919;G:141577782;T:159102194;N:15471 | 75 | 0 | 162367410 | 136994919 | 141577782 | 159102194 | 15471 | ERX3292993 | ERS3358376 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.953 | 0.06085 | 0.6952 | 0.48868 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9693 | 9693 | ERR3266354 | ERX3292993 | ERS3358376 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp negative rep2 | SAMEA5556336 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556336|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp negative rep2 s | sponge ccn gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_8neg_S5_L003_R1_001.fastq.gz | fastq | 607089697.0 | 8069901.0 | E MTAB 7846:sponge ccn gfp negative rep2 lane3 | 0:75.23 1:0 | A:164235344;C:138684000;G:143335680;T:160819270;N:15403 | 75 | 0 | 164235344 | 138684000 | 143335680 | 160819270 | 15403 | ERX3292993 | ERS3358376 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95245 | 0.06055 | 0.69589 | 0.48813 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9694 | 9694 | ERR3266355 | ERX3292993 | ERS3358376 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp negative rep2 | SAMEA5556336 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556336|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp negative rep2 s | sponge ccn gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_8neg_S5_L004_R1_001.fastq.gz | fastq | 598098243.0 | 7950223.0 | E MTAB 7846:sponge ccn gfp negative rep2 lane4 | 0:75.23 1:0 | A:161836808;C:136564804;G:141157424;T:158521860;N:17347 | 75 | 0 | 161836808 | 136564804 | 141157424 | 158521860 | 17347 | ERX3292993 | ERS3358376 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95299 | 0.06032 | 0.69501 | 0.48928 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9695 | 9695 | ERR3266348 | ERX3292992 | ERS3358375 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp negative rep1 | SAMEA5556335 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556335|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp negative rep1 s | sponge ccn gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_7neg_S7_L001_R1_001.fastq.gz | fastq | 668175990.0 | 8872549.0 | E MTAB 7846:sponge ccn gfp negative rep1 lane1 | 0:75.31 1:0 | A:179859350;C:153483169;G:158360605;T:176462088;N:10778 | 75 | 0 | 179859350 | 153483169 | 158360605 | 176462088 | 10778 | ERX3292992 | ERS3358375 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95955 | 0.07154 | 0.69696 | 0.46425 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9696 | 9696 | ERR3266349 | ERX3292992 | ERS3358375 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp negative rep1 | SAMEA5556335 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556335|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp negative rep1 s | sponge ccn gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_7neg_S7_L002_R1_001.fastq.gz | fastq | 668154755.0 | 8872093.0 | E MTAB 7846:sponge ccn gfp negative rep1 lane2 | 0:75.31 1:0 | A:179811687;C:153454931;G:158314391;T:176560936;N:12810 | 75 | 0 | 179811687 | 153454931 | 158314391 | 176560936 | 12810 | ERX3292992 | ERS3358375 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.96029 | 0.06969 | 0.69684 | 0.46725 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9697 | 9697 | ERR3266350 | ERX3292992 | ERS3358375 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp negative rep1 | SAMEA5556335 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556335|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp negative rep1 s | sponge ccn gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_7neg_S7_L003_R1_001.fastq.gz | fastq | 676984426.0 | 8989004.0 | E MTAB 7846:sponge ccn gfp negative rep1 lane3 | 0:75.31 1:0 | A:182159685;C:155578195;G:160511499;T:178722363;N:12684 | 75 | 0 | 182159685 | 155578195 | 160511499 | 178722363 | 12684 | ERX3292992 | ERS3358375 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.96012 | 0.07159 | 0.69554 | 0.46811 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9698 | 9698 | ERR3266351 | ERX3292992 | ERS3358375 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp negative rep1 | SAMEA5556335 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556335|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp negative rep1 s | sponge ccn gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_7neg_S7_L004_R1_001.fastq.gz | fastq | 666031892.0 | 8843695.0 | E MTAB 7846:sponge ccn gfp negative rep1 lane4 | 0:75.31 1:0 | A:179243298;C:152946459;G:157873912;T:175953752;N:14471 | 75 | 0 | 179243298 | 152946459 | 157873912 | 175953752 | 14471 | ERX3292992 | ERS3358375 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.96014 | 0.07169 | 0.69493 | 0.47058 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 55864 | 55864 | SRR10863006 | SRX7533063 | SRS5972272 | SRP241074 | PRJNA597223 | Danio rerio primordial germ cell expression pofiling | PRJNA597223 | Whole Genome Sequencing | Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation. | The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done. | wt PGCs 6dpf rep4 | strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:6dpf|dev stage:larval|sex:not applicable|tissue:germline|biological replicate:replicate 4|BioSampleModel:Model organism or animal | mRNA of Zebrafish: PGCs 6dpf | wt PGCs 6dpf S3 | wt PGCs 6dpf S3 | Library prep was performed with SmartSeq2 RNA Seq System following NuGen`s standard protocol M01406v2. Libraries were prepared with a starting amount of 1 ng and amplified in 12 PCR cycles. | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 550 | SRP241074 | wt_PGCs_6dpf_S3.R1.fastq.gz | fastq | 7769926725.0 | 93613575.0 | wt PGCs 6dpf S3.R1.fastq.gz | 0:83 1:0 | A:2066232192;C:1833469023;G:1789669356;T:2080457369;N:98785 | 83 | 0 | 2066232192 | 1833469023 | 1789669356 | 2080457369 | 98785 | SRX7533063 | SRS5972272 | SRA1023320 | Rene Ketting group|Ketting Lab | Rene Ketting group | 1 | 0.94606 | 0.05002 | 0.68189 | 0.45731 | 83 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | unknown | sc | single_cell_plate | smartseq | Germany | 2020-01-10 | Larval | Larval | Whole Organism | All anatomical structures | ||||||||||||||||||||||||||
| 55865 | 55865 | SRR10863007 | SRX7533062 | SRS5972271 | SRP241074 | PRJNA597223 | Danio rerio primordial germ cell expression pofiling | PRJNA597223 | Whole Genome Sequencing | Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation. | The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done. | wt PGCs 3dpf rep4 | strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:3dpf|dev stage:protruding mouth|sex:not applicable|tissue:germline|biological replicate:replicate 4|BioSampleModel:Model organism or animal | mRNA of Zebrafish: PGCs 3dpf | wt PGCs 3dpf S2 | wt PGCs 3dpf S2 | Library prep was performed with SmartSeq2 RNA Seq System following NuGen`s standard protocol M01406v2. Libraries were prepared with a starting amount of 1 ng and amplified in 12 PCR cycles. | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 550 | SRP241074 | wt_PGCs_3dpf_S2.R1.fastq.gz | fastq | 7911386779.0 | 95317913.0 | wt PGCs 3dpf S2.R1.fastq.gz | 0:83 1:0 | A:2123308854;C:1846753353;G:1805771181;T:2135451936;N:101455 | 83 | 0 | 2123308854 | 1846753353 | 1805771181 | 2135451936 | 101455 | SRX7533062 | SRS5972271 | SRA1023320 | Rene Ketting group|Ketting Lab | Rene Ketting group | 1 | 0.9461 | 0.05273 | 0.67042 | 0.47729 | 83 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | unknown | sc | single_cell_plate | smartseq | Germany | 2020-01-10 | Larval | Larval | Whole Organism | All anatomical structures | ||||||||||||||||||||||||||
| 55866 | 55866 | SRR10863008 | SRX7533061 | SRS5972270 | SRP241074 | PRJNA597223 | Danio rerio primordial germ cell expression pofiling | PRJNA597223 | Whole Genome Sequencing | Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation. | The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done. | wt PGCs 1dpf rep4 | strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:1dpf|dev stage:Pharyngula period|sex:not applicable|tissue:germline|biological replicate:replicate 4|BioSampleModel:Model organism or animal | mRNA of Zebrafish: PGCs 1dpf | wt PGCs 1dpf S1 | wt PGCs 1dpf S1 | Library prep was performed with SmartSeq2 RNA Seq System following NuGen`s standard protocol M01406v2. Libraries were prepared with a starting amount of 1 ng and amplified in 12 PCR cycles. | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 550 | SRP241074 | wt_PGCs_1dpf_S1.R1.fastq.gz | fastq | 6787337699.0 | 81775153.0 | wt PGCs 1dpf S1.R1.fastq.gz | 0:83 1:0 | A:1839754910;C:1566044514;G:1538211923;T:1843241243;N:85109 | 83 | 0 | 1839754910 | 1566044514 | 1538211923 | 1843241243 | 85109 | SRX7533061 | SRS5972270 | SRA1023320 | Rene Ketting group|Ketting Lab | Rene Ketting group | 1 | 0.94441 | 0.056 | 0.68866 | 0.47945 | 83 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | unknown | sc | single_cell_plate | smartseq | Germany | 2020-01-10 | Pharyngula | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||||||||
| 55867 | 55867 | SRR10863009 | SRX7533060 | SRS5972251 | SRP241074 | PRJNA597223 | Danio rerio primordial germ cell expression pofiling | PRJNA597223 | Whole Genome Sequencing | Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation. | The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done. | wt PGCs 10dpf rep3 | strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:10dpf|dev stage:larval|sex:not applicable|tissue:germline|biological replicate:replicate 3|BioSampleModel:Model organism or animal | mRNA of Zebrafish: PGCs 10dpf | imb ketting 2018 18 redl SmartSeq2 05 10dpf PGCs rep3 S22 | imb ketting 2018 18 redl SmartSeq2 05 10dpf PGCs rep3 S22 | Library prep was performed with SmartSeq2 RNA Seq System following NuGen`s standard protocol M01406v2. Libraries were prepared with a starting amount of 1 ng and amplified in 12 PCR cycles. | RNA-Seq | TRANSCRIPTOMIC | PolyA | PAIRED | ILLUMINA | NextSeq 550 | SRP241074 | imb_ketting_2018_18_redl_SmartSeq2-05_10dpf_PGCs_rep3_S22.R1.fastq.gz imb_ketting_2018_18_redl_SmartSeq2-05_10dpf_PGCs_rep3_S22.R2.fastq.gz | fastq fastq | 2398956750.0 | 15993045.0 | imb ketting 2018 18 redl SmartSeq2 05 10dpf PGCs rep3 S22.R1.fastq.gz | 0:75 1:75 | A:644406123;C:549461993;G:551876029;T:653190800;N:21805 | 75 | 75 | 644406123 | 549461993 | 551876029 | 653190800 | 21805 | SRX7533060 | SRS5972251 | SRA1023320 | Rene Ketting group|Ketting Lab | Rene Ketting group | 2 | 0.93212 | 0.93465 | 0.08119 | 0.0809 | 0.64924 | 0.65273 | 0.49088 | 0.48853 | 75 | 75 | B | B | biological fallback assumption | illumina | nextseq | unknown | poly_a | unknown | sc | single_cell_plate | smartseq | Germany | 2020-01-10 | Larval | Larval | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 55868 | 55868 | SRR10863010 | SRX7533059 | SRS5972250 | SRP241074 | PRJNA597223 | Danio rerio primordial germ cell expression pofiling | PRJNA597223 | Whole Genome Sequencing | Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation. | The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done. | wt PGCs 10dpf rep2 | strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:10dpf|dev stage:larval|sex:not applicable|tissue:germline|biological replicate:replicate 2|BioSampleModel:Model organism or animal | mRNA of Zebrafish: PGCs 10dpf | imb ketting 2018 18 redl SmartSeq2 04 10dpf PGCs rep2 S21 | imb ketting 2018 18 redl SmartSeq2 04 10dpf PGCs rep2 S21 | Library prep was performed with SmartSeq2 RNA Seq System following NuGen`s standard protocol M01406v2. Libraries were prepared with a starting amount of 1 ng and amplified in 12 PCR cycles. | RNA-Seq | TRANSCRIPTOMIC | PolyA | PAIRED | ILLUMINA | NextSeq 550 | SRP241074 | imb_ketting_2018_18_redl_SmartSeq2-04_10dpf_PGCs_rep2_S21.R1.fastq.gz imb_ketting_2018_18_redl_SmartSeq2-04_10dpf_PGCs_rep2_S21.R2.fastq.gz | fastq fastq | 1718401350.0 | 11456009.0 | imb ketting 2018 18 redl SmartSeq2 04 10dpf PGCs rep2 S21.R1.fastq.gz | 0:75 1:75 | A:458124712;C:395812381;G:396455319;T:467992998;N:15940 | 75 | 75 | 458124712 | 395812381 | 396455319 | 467992998 | 15940 | SRX7533059 | SRS5972250 | SRA1023320 | Rene Ketting group|Ketting Lab | Rene Ketting group | 2 | 0.9304 | 0.93343 | 0.06159 | 0.06103 | 0.6648 | 0.66778 | 0.4903 | 0.48931 | 75 | 75 | B | B | biological fallback assumption | illumina | nextseq | unknown | poly_a | unknown | sc | single_cell_plate | smartseq | Germany | 2020-01-10 | Larval | Larval | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 55869 | 55869 | SRR10863011 | SRX7533058 | SRS5972249 | SRP241074 | PRJNA597223 | Danio rerio primordial germ cell expression pofiling | PRJNA597223 | Whole Genome Sequencing | Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation. | The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done. | wt PGCs 10dpf rep1 | strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:10dpf|dev stage:larval|sex:not applicable|tissue:germline|biological replicate:replicate 1|BioSampleModel:Model organism or animal | mRNA of Zebrafish: PGCs 10dpf | imb ketting 2018 18 redl SmartSeq2 03 10dpf PGCs rep1 S20 | imb ketting 2018 18 redl SmartSeq2 03 10dpf PGCs rep1 S20 | Library prep was performed with SmartSeq2 RNA Seq System following NuGen`s standard protocol M01406v2. Libraries were prepared with a starting amount of 1 ng and amplified in 12 PCR cycles. | RNA-Seq | TRANSCRIPTOMIC | PolyA | PAIRED | ILLUMINA | NextSeq 550 | SRP241074 | imb_ketting_2018_18_redl_SmartSeq2-03_10dpf_PGCs_rep1_S20.R1.fastq.gz imb_ketting_2018_18_redl_SmartSeq2-03_10dpf_PGCs_rep1_S20.R2.fastq.gz | fastq fastq | 2233099350.0 | 14887329.0 | imb ketting 2018 18 redl SmartSeq2 03 10dpf PGCs rep1 S20.R1.fastq.gz | 0:75 1:75 | A:593248327;C:517482903;G:517558773;T:604789107;N:20240 | 75 | 75 | 593248327 | 517482903 | 517558773 | 604789107 | 20240 | SRX7533058 | SRS5972249 | SRA1023320 | Rene Ketting group|Ketting Lab | Rene Ketting group | 2 | 0.93341 | 0.93608 | 0.06727 | 0.06743 | 0.65202 | 0.65518 | 0.48494 | 0.48863 | 75 | 75 | B | B | biological fallback assumption | illumina | nextseq | unknown | poly_a | unknown | sc | single_cell_plate | smartseq | Germany | 2020-01-10 | Larval | Larval | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 55870 | 55870 | SRR10863012 | SRX7533057 | SRS5972247 | SRP241074 | PRJNA597223 | Danio rerio primordial germ cell expression pofiling | PRJNA597223 | Whole Genome Sequencing | Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation. | The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done. | wt PGCs 6dpf rep2 | strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:6dpf|dev stage:larval|sex:not applicable|tissue:germline|biological replicate:replicate 2|BioSampleModel:Model organism or animal | mRNA of Zebrafish: PGCs 6dpf | imb ketting 2018 02 redl SmartSeq 11 16 6dpf PGCs rep2 S11 | imb ketting 2018 02 redl SmartSeq 11 16 6dpf PGCs rep2 S11 | Library prep was performed with SmartSeq2 RNA Seq System following NuGen`s standard protocol M01406v2. Libraries were prepared with a starting amount of 1 ng and amplified in 12 PCR cycles. | RNA-Seq | TRANSCRIPTOMIC | PolyA | PAIRED | ILLUMINA | NextSeq 550 | SRP241074 | imb_ketting_2018_02_redl_SmartSeq_11_16_6dpf_PGCs_rep2_S11.R2.fastq.gz imb_ketting_2018_02_redl_SmartSeq_11_16_6dpf_PGCs_rep2_S11.R1.fastq.gz | fastq fastq | 3073587588.0 | 19453086.0 | imb ketting 2018 02 redl SmartSeq 11 16 6dpf PGCs rep2 S11.R1.fastq.gz | 0:79 1:79 | A:818976238;C:715663048;G:701056981;T:837683663;N:207658 | 79 | 79 | 818976238 | 715663048 | 701056981 | 837683663 | 207658 | SRX7533057 | SRS5972247 | SRA1023320 | Rene Ketting group|Ketting Lab | Rene Ketting group | 2 | 0.93657 | 0.93564 | 0.07313 | 0.07324 | 0.66732 | 0.66927 | 0.51839 | 0.51879 | 79 | 79 | B | B | biological fallback assumption | illumina | nextseq | unknown | poly_a | unknown | sc | single_cell_plate | smartseq | Germany | 2020-01-10 | Larval | Larval | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 55871 | 55871 | SRR10863014 | SRX7533056 | SRS5972246 | SRP241074 | PRJNA597223 | Danio rerio primordial germ cell expression pofiling | PRJNA597223 | Whole Genome Sequencing | Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation. | The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done. | wt PGCs 6dpf rep1 | strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:6dpf|dev stage:larval|sex:not applicable|tissue:germline|biological replicate:replicate 1|BioSampleModel:Model organism or animal | mRNA of Zebrafish: PGCs 6dpf | imb ketting 2018 02 redl SmartSeq 10 15 6dpf PGCs rep1 S10 | imb ketting 2018 02 redl SmartSeq 10 15 6dpf PGCs rep1 S10 | Library prep was performed with SmartSeq2 RNA Seq System following NuGen`s standard protocol M01406v2. Libraries were prepared with a starting amount of 1 ng and amplified in 12 PCR cycles. | RNA-Seq | TRANSCRIPTOMIC | PolyA | PAIRED | ILLUMINA | NextSeq 550 | SRP241074 | imb_ketting_2018_02_redl_SmartSeq_10_15_6dpf_PGCs_rep1_S10.R1.fastq.gz imb_ketting_2018_02_redl_SmartSeq_10_15_6dpf_PGCs_rep1_S10.R2.fastq.gz | fastq fastq | 3659744204.0 | 23162938.0 | imb ketting 2018 02 redl SmartSeq 10 15 6dpf PGCs rep1 S10.R1.fastq.gz | 0:79 1:79 | A:975611259;C:856115631;G:822696649;T:1005067499;N:253166 | 79 | 79 | 975611259 | 856115631 | 822696649 | 1005067499 | 253166 | SRX7533056 | SRS5972246 | SRA1023320 | Rene Ketting group|Ketting Lab | Rene Ketting group | 2 | 0.9257 | 0.92714 | 0.08263 | 0.08288 | 0.66403 | 0.66606 | 0.51827 | 0.51415 | 79 | 79 | B | B | biological fallback assumption | illumina | nextseq | unknown | poly_a | unknown | sc | single_cell_plate | smartseq | Germany | 2020-01-10 | Larval | Larval | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 55873 | 55873 | SRR10863013 | SRX7533054 | SRS5972248 | SRP241074 | PRJNA597223 | Danio rerio primordial germ cell expression pofiling | PRJNA597223 | Whole Genome Sequencing | Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation. | The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done. | wt PGCs 6dpf rep3 | strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:6dpf|dev stage:larval|sex:not applicable|tissue:germline|biological replicate:replicate 3|BioSampleModel:Model organism or animal | mRNA of Zebrafish: PGCs 6dpf | imb ketting 2018 02 redl SmartSeq 12 57 6dpf PGCs rep3 S12 | imb ketting 2018 02 redl SmartSeq 12 57 6dpf PGCs rep3 S12 | Library prep was performed with SmartSeq2 RNA Seq System following NuGen`s standard protocol M01406v2. Libraries were prepared with a starting amount of 1 ng and amplified in 12 PCR cycles. | RNA-Seq | TRANSCRIPTOMIC | PolyA | PAIRED | ILLUMINA | NextSeq 550 | SRP241074 | imb_ketting_2018_02_redl_SmartSeq_12_57_6dpf_PGCs_rep3_S12.R1.fastq.gz imb_ketting_2018_02_redl_SmartSeq_12_57_6dpf_PGCs_rep3_S12.R2.fastq.gz | fastq fastq | 3238333398.0 | 20495781.0 | imb ketting 2018 02 redl SmartSeq 12 57 6dpf PGCs rep3 S12.R1.fastq.gz | 0:79 1:79 | A:863266932;C:756411819;G:730470194;T:887962716;N:221737 | 79 | 79 | 863266932 | 756411819 | 730470194 | 887962716 | 221737 | SRX7533054 | SRS5972248 | SRA1023320 | Rene Ketting group|Ketting Lab | Rene Ketting group | 2 | 0.93352 | 0.93414 | 0.07865 | 0.07846 | 0.6619 | 0.66365 | 0.50442 | 0.5037 | 79 | 79 | B | B | biological fallback assumption | illumina | nextseq | unknown | poly_a | unknown | sc | single_cell_plate | smartseq | Germany | 2020-01-10 | Larval | Larval | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 55874 | 55874 | SRR10863016 | SRX7533053 | SRS5972245 | SRP241074 | PRJNA597223 | Danio rerio primordial germ cell expression pofiling | PRJNA597223 | Whole Genome Sequencing | Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation. | The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done. | wt PGCs 3dpf rep3 | strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:3dpf|dev stage:protruding mouth|sex:not applicable|tissue:germline|biological replicate:replicate 3|BioSampleModel:Model organism or animal | mRNA of Zebrafish: PGCs 3dpf | imb ketting 2018 02 redl SmartSeq 09 52 3dpf PGCs rep3 S9 | imb ketting 2018 02 redl SmartSeq 09 52 3dpf PGCs rep3 S9 | Library prep was performed with SmartSeq2 RNA Seq System following NuGen`s standard protocol M01406v2. Libraries were prepared with a starting amount of 1 ng and amplified in 12 PCR cycles. | RNA-Seq | TRANSCRIPTOMIC | PolyA | PAIRED | ILLUMINA | NextSeq 550 | SRP241074 | imb_ketting_2018_02_redl_SmartSeq_09_52_3dpf_PGCs_rep3_S9.R1.fastq.gz imb_ketting_2018_02_redl_SmartSeq_09_52_3dpf_PGCs_rep3_S9.R2.fastq.gz | fastq fastq | 3249954930.0 | 20569335.0 | imb ketting 2018 02 redl SmartSeq 09 52 3dpf PGCs rep3 S9.R1.fastq.gz | 0:79 1:79 | A:869000041;C:756586733;G:737450634;T:886691114;N:226408 | 79 | 79 | 869000041 | 756586733 | 737450634 | 886691114 | 226408 | SRX7533053 | SRS5972245 | SRA1023320 | Rene Ketting group|Ketting Lab | Rene Ketting group | 2 | 0.93775 | 0.93746 | 0.05915 | 0.05925 | 0.66559 | 0.66813 | 0.4987 | 0.49658 | 79 | 79 | B | B | biological fallback assumption | illumina | nextseq | unknown | poly_a | unknown | sc | single_cell_plate | smartseq | Germany | 2020-01-10 | Larval | Larval | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 55875 | 55875 | SRR10863017 | SRX7533052 | SRS5972243 | SRP241074 | PRJNA597223 | Danio rerio primordial germ cell expression pofiling | PRJNA597223 | Whole Genome Sequencing | Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation. | The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done. | wt PGCs 3dpf rep2 | strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:3dpf|dev stage:protruding mouth|sex:not applicable|tissue:germline|biological replicate:replicate 2|BioSampleModel:Model organism or animal | mRNA of Zebrafish: PGCs 3dpf | imb ketting 2018 02 redl SmartSeq 08 46 3dpf PGCs rep2 S8 | imb ketting 2018 02 redl SmartSeq 08 46 3dpf PGCs rep2 S8 | Library prep was performed with SmartSeq2 RNA Seq System following NuGen`s standard protocol M01406v2. Libraries were prepared with a starting amount of 1 ng and amplified in 12 PCR cycles. | RNA-Seq | TRANSCRIPTOMIC | PolyA | PAIRED | ILLUMINA | NextSeq 550 | SRP241074 | imb_ketting_2018_02_redl_SmartSeq_08_46_3dpf_PGCs_rep2_S8.R1.fastq.gz imb_ketting_2018_02_redl_SmartSeq_08_46_3dpf_PGCs_rep2_S8.R2.fastq.gz | fastq fastq | 2750070738.0 | 17405511.0 | imb ketting 2018 02 redl SmartSeq 08 46 3dpf PGCs rep2 S8.R1.fastq.gz | 0:79 1:79 | A:733848756;C:641808995;G:625301352;T:748928086;N:183549 | 79 | 79 | 733848756 | 641808995 | 625301352 | 748928086 | 183549 | SRX7533052 | SRS5972243 | SRA1023320 | Rene Ketting group|Ketting Lab | Rene Ketting group | 2 | 0.93969 | 0.94099 | 0.07298 | 0.07296 | 0.6591 | 0.6608 | 0.46537 | 0.46521 | 79 | 79 | B | B | biological fallback assumption | illumina | nextseq | unknown | poly_a | unknown | sc | single_cell_plate | smartseq | Germany | 2020-01-10 | Larval | Larval | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 55876 | 55876 | SRR10863018 | SRX7533051 | SRS5972242 | SRP241074 | PRJNA597223 | Danio rerio primordial germ cell expression pofiling | PRJNA597223 | Whole Genome Sequencing | Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation. | The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done. | wt PGCs 3dpf rep1 | strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:3dpf|dev stage:protruding mouth|sex:not applicable|tissue:germline|biological replicate:replicate 1|BioSampleModel:Model organism or animal | mRNA of Zebrafish: PGCs 3dpf | imb ketting 2018 02 redl SmartSeq 07 32 3dpf PGCs rep1 S7 | imb ketting 2018 02 redl SmartSeq 07 32 3dpf PGCs rep1 S7 | Library prep was performed with SmartSeq2 RNA Seq System following NuGen`s standard protocol M01406v2. Libraries were prepared with a starting amount of 1 ng and amplified in 12 PCR cycles. | RNA-Seq | TRANSCRIPTOMIC | PolyA | PAIRED | ILLUMINA | NextSeq 550 | SRP241074 | imb_ketting_2018_02_redl_SmartSeq_07_32_3dpf_PGCs_rep1_S7.R1.fastq.gz imb_ketting_2018_02_redl_SmartSeq_07_32_3dpf_PGCs_rep1_S7.R2.fastq.gz | fastq fastq | 3579619086.0 | 22655817.0 | imb ketting 2018 02 redl SmartSeq 07 32 3dpf PGCs rep1 S7.R1.fastq.gz | 0:79 1:79 | A:953705275;C:837082021;G:815003971;T:973585384;N:242435 | 79 | 79 | 953705275 | 837082021 | 815003971 | 973585384 | 242435 | SRX7533051 | SRS5972242 | SRA1023320 | Rene Ketting group|Ketting Lab | Rene Ketting group | 2 | 0.94105 | 0.94076 | 0.07884 | 0.07956 | 0.66046 | 0.66188 | 0.46606 | 0.46734 | 79 | 79 | B | B | biological fallback assumption | illumina | nextseq | unknown | poly_a | unknown | sc | single_cell_plate | smartseq | Germany | 2020-01-10 | Larval | Larval | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 55877 | 55877 | SRR10863019 | SRX7533050 | SRS5972252 | SRP241074 | PRJNA597223 | Danio rerio primordial germ cell expression pofiling | PRJNA597223 | Whole Genome Sequencing | Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation. | The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done. | wt PGCs 2dpf rep3 | strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:2dpf|dev stage:Long pec stage|sex:not applicable|tissue:germline|biological replicate:replicate 3|BioSampleModel:Model organism or animal | mRNA of Zebrafish: PGCs 2dpf | imb ketting 2018 02 redl SmartSeq 06 61 2dpf PGCs rep3 S6 | imb ketting 2018 02 redl SmartSeq 06 61 2dpf PGCs rep3 S6 | Library prep was performed with SmartSeq2 RNA Seq System following NuGen`s standard protocol M01406v2. Libraries were prepared with a starting amount of 1 ng and amplified in 12 PCR cycles. | RNA-Seq | TRANSCRIPTOMIC | PolyA | PAIRED | ILLUMINA | NextSeq 550 | SRP241074 | imb_ketting_2018_02_redl_SmartSeq_06_61_2dpf_PGCs_rep3_S6.R1.fastq.gz imb_ketting_2018_02_redl_SmartSeq_06_61_2dpf_PGCs_rep3_S6.R2.fastq.gz | fastq fastq | 3108720942.0 | 19675449.0 | imb ketting 2018 02 redl SmartSeq 06 61 2dpf PGCs rep3 S6.R1.fastq.gz | 0:79 1:79 | A:837919918;C:714812252;G:702998193;T:852776390;N:214189 | 79 | 79 | 837919918 | 714812252 | 702998193 | 852776390 | 214189 | SRX7533050 | SRS5972252 | SRA1023320 | Rene Ketting group|Ketting Lab | Rene Ketting group | 2 | 0.93952 | 0.93945 | 0.07277 | 0.07278 | 0.66983 | 0.67221 | 0.50192 | 0.50133 | 79 | 79 | B | B | biological fallback assumption | illumina | nextseq | unknown | poly_a | unknown | sc | single_cell_plate | smartseq | Germany | 2020-01-10 | Hatching | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 55878 | 55878 | SRR10863020 | SRX7533049 | SRS5972244 | SRP241074 | PRJNA597223 | Danio rerio primordial germ cell expression pofiling | PRJNA597223 | Whole Genome Sequencing | Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation. | The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done. | wt PGCs 2dpf rep2 | strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:2dpf|dev stage:Long pec stage|sex:not applicable|tissue:germline|biological replicate:replicate 2|BioSampleModel:Model organism or animal | mRNA of Zebrafish: PGCs 2dpf | imb ketting 2018 02 redl SmartSeq 05 22 2dpf PGCs rep2 S5 | imb ketting 2018 02 redl SmartSeq 05 22 2dpf PGCs rep2 S5 | Library prep was performed with SmartSeq2 RNA Seq System following NuGen`s standard protocol M01406v2. Libraries were prepared with a starting amount of 1 ng and amplified in 12 PCR cycles. | RNA-Seq | TRANSCRIPTOMIC | PolyA | PAIRED | ILLUMINA | NextSeq 550 | SRP241074 | imb_ketting_2018_02_redl_SmartSeq_05_22_2dpf_PGCs_rep2_S5.R1.fastq.gz imb_ketting_2018_02_redl_SmartSeq_05_22_2dpf_PGCs_rep2_S5.R2.fastq.gz | fastq fastq | 3241530370.0 | 20516015.0 | imb ketting 2018 02 redl SmartSeq 05 22 2dpf PGCs rep2 S5.R1.fastq.gz | 0:79 1:79 | A:861911078;C:762577918;G:730686512;T:886132359;N:222503 | 79 | 79 | 861911078 | 762577918 | 730686512 | 886132359 | 222503 | SRX7533049 | SRS5972244 | SRA1023320 | Rene Ketting group|Ketting Lab | Rene Ketting group | 2 | 0.93797 | 0.93734 | 0.06416 | 0.06415 | 0.67004 | 0.67251 | 0.50367 | 0.50353 | 79 | 79 | B | B | biological fallback assumption | illumina | nextseq | unknown | poly_a | unknown | sc | single_cell_plate | smartseq | Germany | 2020-01-10 | Hatching | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 55879 | 55879 | SRR10863021 | SRX7533048 | SRS5972269 | SRP241074 | PRJNA597223 | Danio rerio primordial germ cell expression pofiling | PRJNA597223 | Whole Genome Sequencing | Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation. | The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done. | wt PGCs 2dpf rep1 | strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:2dpf|dev stage:Long pec stage|sex:not applicable|tissue:germline|biological replicate:replicate 1|BioSampleModel:Model organism or animal | mRNA of Zebrafish: PGCs 2dpf | imb ketting 2018 02 redl SmartSeq 04 07 2dpf PGCs rep1 S4 | imb ketting 2018 02 redl SmartSeq 04 07 2dpf PGCs rep1 S4 | Library prep was performed with SmartSeq2 RNA Seq System following NuGen`s standard protocol M01406v2. Libraries were prepared with a starting amount of 1 ng and amplified in 12 PCR cycles. | RNA-Seq | TRANSCRIPTOMIC | PolyA | PAIRED | ILLUMINA | NextSeq 550 | SRP241074 | imb_ketting_2018_02_redl_SmartSeq_04_07_2dpf_PGCs_rep1_S4.R1.fastq.gz imb_ketting_2018_02_redl_SmartSeq_04_07_2dpf_PGCs_rep1_S4.R2.fastq.gz | fastq fastq | 3363342524.0 | 21286978.0 | imb ketting 2018 02 redl SmartSeq 04 07 2dpf PGCs rep1 S4.R1.fastq.gz | 0:79 1:79 | A:906938869;C:772810568;G:756589497;T:926768184;N:235406 | 79 | 79 | 906938869 | 772810568 | 756589497 | 926768184 | 235406 | SRX7533048 | SRS5972269 | SRA1023320 | Rene Ketting group|Ketting Lab | Rene Ketting group | 2 | 0.93588 | 0.93667 | 0.11457 | 0.11483 | 0.66663 | 0.66799 | 0.4795 | 0.4762 | 79 | 79 | B | B | biological fallback assumption | illumina | nextseq | unknown | poly_a | unknown | sc | single_cell_plate | smartseq | Germany | 2020-01-10 | Hatching | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 55880 | 55880 | SRR10863022 | SRX7533047 | SRS5972268 | SRP241074 | PRJNA597223 | Danio rerio primordial germ cell expression pofiling | PRJNA597223 | Whole Genome Sequencing | Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation. | The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done. | wt PGCs 1dpf rep3 | strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:1dpf|dev stage:Pharyngula period|sex:not applicable|tissue:germline|biological replicate:replicate 3|BioSampleModel:Model organism or animal | mRNA of Zebrafish: PGCs 1dpf | imb ketting 2018 02 redl SmartSeq 03 20 1dpf PGCs rep3 S3 | imb ketting 2018 02 redl SmartSeq 03 20 1dpf PGCs rep3 S3 | Library prep was performed with SmartSeq2 RNA Seq System following NuGen`s standard protocol M01406v2. Libraries were prepared with a starting amount of 1 ng and amplified in 12 PCR cycles. | RNA-Seq | TRANSCRIPTOMIC | PolyA | PAIRED | ILLUMINA | NextSeq 550 | SRP241074 | imb_ketting_2018_02_redl_SmartSeq_03_20_1dpf_PGCs_rep3_S3.R1.fastq.gz imb_ketting_2018_02_redl_SmartSeq_03_20_1dpf_PGCs_rep3_S3.R2.fastq.gz | fastq fastq | 3406105382.0 | 21557629.0 | imb ketting 2018 02 redl SmartSeq 03 20 1dpf PGCs rep3 S3.R1.fastq.gz | 0:79 1:79 | A:914561772;C:790081165;G:768217890;T:933018206;N:226349 | 79 | 79 | 914561772 | 790081165 | 768217890 | 933018206 | 226349 | SRX7533047 | SRS5972268 | SRA1023320 | Rene Ketting group|Ketting Lab | Rene Ketting group | 2 | 0.93859 | 0.93927 | 0.06346 | 0.06362 | 0.68467 | 0.68665 | 0.51016 | 0.44765 | 79 | 79 | B | B | biological fallback assumption | illumina | nextseq | unknown | poly_a | unknown | sc | single_cell_plate | smartseq | Germany | 2020-01-10 | Pharyngula | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 55881 | 55881 | SRR10863023 | SRX7533046 | SRS5972267 | SRP241074 | PRJNA597223 | Danio rerio primordial germ cell expression pofiling | PRJNA597223 | Whole Genome Sequencing | Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation. | The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done. | wt PGCs 1dpf rep2 | strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:1dpf|dev stage:Pharyngula period|sex:not applicable|tissue:germline|biological replicate:replicate 2|BioSampleModel:Model organism or animal | mRNA of Zebrafish: PGCs 1dpf | imb ketting 2018 02 redl SmartSeq 02 30 1dpf PGCs rep2 S2 | imb ketting 2018 02 redl SmartSeq 02 30 1dpf PGCs rep2 S2 | Library prep was performed with SmartSeq2 RNA Seq System following NuGen`s standard protocol M01406v2. Libraries were prepared with a starting amount of 1 ng and amplified in 12 PCR cycles. | RNA-Seq | TRANSCRIPTOMIC | PolyA | PAIRED | ILLUMINA | NextSeq 550 | SRP241074 | imb_ketting_2018_02_redl_SmartSeq_02_30_1dpf_PGCs_rep2_S2.R1.fastq.gz imb_ketting_2018_02_redl_SmartSeq_02_30_1dpf_PGCs_rep2_S2.R2.fastq.gz | fastq fastq | 3126220074.0 | 19786203.0 | imb ketting 2018 02 redl SmartSeq 02 30 1dpf PGCs rep2 S2.R1.fastq.gz | 0:79 1:79 | A:835660285;C:727271703;G:711392935;T:851683391;N:211760 | 79 | 79 | 835660285 | 727271703 | 711392935 | 851683391 | 211760 | SRX7533046 | SRS5972267 | SRA1023320 | Rene Ketting group|Ketting Lab | Rene Ketting group | 2 | 0.93836 | 0.93845 | 0.05796 | 0.0579 | 0.67805 | 0.68002 | 0.49555 | 0.49733 | 79 | 79 | B | B | biological fallback assumption | illumina | nextseq | unknown | poly_a | unknown | sc | single_cell_plate | smartseq | Germany | 2020-01-10 | Pharyngula | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 55885 | 55885 | SRR10863024 | SRX7533042 | SRS5972265 | SRP241074 | PRJNA597223 | Danio rerio primordial germ cell expression pofiling | PRJNA597223 | Whole Genome Sequencing | Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation. | The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done. | wt PGCs 1dpf rep1 | strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:1dpf|dev stage:Pharyngula period|sex:not applicable|tissue:germline|biological replicate:replicate 1|BioSampleModel:Model organism or animal | mRNA of Zebrafish: PGCs 1dpf | imb ketting 2018 02 redl SmartSeq 01 24 1dpf PGCs rep1 S1 | imb ketting 2018 02 redl SmartSeq 01 24 1dpf PGCs rep1 S1 | Library prep was performed with SmartSeq2 RNA Seq System following NuGen`s standard protocol M01406v2. Libraries were prepared with a starting amount of 1 ng and amplified in 12 PCR cycles. | RNA-Seq | TRANSCRIPTOMIC | PolyA | PAIRED | ILLUMINA | NextSeq 550 | SRP241074 | imb_ketting_2018_02_redl_SmartSeq_01_24_1dpf_PGCs_rep1_S1.R1.fastq.gz imb_ketting_2018_02_redl_SmartSeq_01_24_1dpf_PGCs_rep1_S1.R2.fastq.gz | fastq fastq | 3512354852.0 | 22230094.0 | imb ketting 2018 02 redl SmartSeq 01 24 1dpf PGCs rep1 S1.R1.fastq.gz | 0:79 1:79 | A:937439392;C:820724988;G:797835842;T:956108725;N:245905 | 79 | 79 | 937439392 | 820724988 | 797835842 | 956108725 | 245905 | SRX7533042 | SRS5972265 | SRA1023320 | Rene Ketting group|Ketting Lab | Rene Ketting group | 2 | 0.94053 | 0.94062 | 0.05733 | 0.05792 | 0.6801 | 0.68174 | 0.49423 | 0.49408 | 79 | 79 | B | B | biological fallback assumption | illumina | nextseq | unknown | poly_a | unknown | sc | single_cell_plate | smartseq | Germany | 2020-01-10 | Pharyngula | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 55886 | 55886 | SRR10863027 | SRX7533041 | SRS5972266 | SRP241074 | PRJNA597223 | Danio rerio primordial germ cell expression pofiling | PRJNA597223 | Whole Genome Sequencing | Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation. | The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done. | wt Fish 10dpf rep2 | strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:10dpf|dev stage:larval|sex:not applicable|tissue:whole embryo|biological replicate:replicate 2|BioSampleModel:Model organism or animal | mRNA of Zebrafish: Fish 10dpf | imb ketting 2018 18 redl SmartSeq2 02 10dpf fish rep2 S19 | imb ketting 2018 18 redl SmartSeq2 02 10dpf fish rep2 S19 | Library prep was performed with SmartSeq2 RNA Seq System following NuGen`s standard protocol M01406v2. Libraries were prepared with a starting amount of 1 ng and amplified in 12 PCR cycles. | RNA-Seq | TRANSCRIPTOMIC | PolyA | PAIRED | ILLUMINA | NextSeq 550 | SRP241074 | imb_ketting_2018_18_redl_SmartSeq2-02_10dpf_fish_rep2_S19.R1.fastq.gz imb_ketting_2018_18_redl_SmartSeq2-02_10dpf_fish_rep2_S19.R2.fastq.gz | fastq fastq | 2625890700.0 | 17505938.0 | imb ketting 2018 18 redl SmartSeq2 02 10dpf fish rep2 S19.R1.fastq.gz | 0:75 1:75 | A:702642659;C:603804487;G:604515055;T:714904148;N:24351 | 75 | 75 | 702642659 | 603804487 | 604515055 | 714904148 | 24351 | SRX7533041 | SRS5972266 | SRA1023320 | Rene Ketting group|Ketting Lab | Rene Ketting group | 2 | 0.93546 | 0.93678 | 0.11349 | 0.11316 | 0.67829 | 0.68217 | 0.45966 | 0.46585 | 75 | 75 | B | B | biological fallback assumption | illumina | nextseq | unknown | poly_a | unknown | sc | single_cell_plate | smartseq | Germany | 2020-01-10 | Larval | Larval | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 55888 | 55888 | SRR10863029 | SRX7533039 | SRS5972264 | SRP241074 | PRJNA597223 | Danio rerio primordial germ cell expression pofiling | PRJNA597223 | Whole Genome Sequencing | Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation. | The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done. | wt Fish 10dpf rep1 | strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:10dpf|dev stage:larval|sex:not applicable|tissue:whole embryo|biological replicate:replicate 1|BioSampleModel:Model organism or animal | mRNA of Zebrafish: Fish 10dpf | imb ketting 2018 18 redl SmartSeq2 01 10dpf fish rep1 S18 | imb ketting 2018 18 redl SmartSeq2 01 10dpf fish rep1 S18 | Library prep was performed with SmartSeq2 RNA Seq System following NuGen`s standard protocol M01406v2. Libraries were prepared with a starting amount of 1 ng and amplified in 12 PCR cycles. | RNA-Seq | TRANSCRIPTOMIC | PolyA | PAIRED | ILLUMINA | NextSeq 550 | SRP241074 | imb_ketting_2018_18_redl_SmartSeq2-01_10dpf_fish_rep1_S18.R1.fastq.gz imb_ketting_2018_18_redl_SmartSeq2-01_10dpf_fish_rep1_S18.R2.fastq.gz | fastq fastq | 2317008450.0 | 15446723.0 | imb ketting 2018 18 redl SmartSeq2 01 10dpf fish rep1 S18.R1.fastq.gz | 0:75 1:75 | A:616522892;C:537227364;G:538867346;T:624369327;N:21521 | 75 | 75 | 616522892 | 537227364 | 538867346 | 624369327 | 21521 | SRX7533039 | SRS5972264 | SRA1023320 | Rene Ketting group|Ketting Lab | Rene Ketting group | 2 | 0.94141 | 0.94282 | 0.09767 | 0.09803 | 0.67771 | 0.68081 | 0.46229 | 0.46273 | 75 | 75 | B | B | biological fallback assumption | illumina | nextseq | unknown | poly_a | unknown | sc | single_cell_plate | smartseq | Germany | 2020-01-10 | Larval | Larval | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 55889 | 55889 | SRR10863030 | SRX7533038 | SRS5972263 | SRP241074 | PRJNA597223 | Danio rerio primordial germ cell expression pofiling | PRJNA597223 | Whole Genome Sequencing | Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation. | The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done. | wt Fish 6dpf rep2 | strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:6dpf|dev stage:larval|sex:not applicable|tissue:whole embryo|biological replicate:replicate 2|BioSampleModel:Model organism or animal | mRNA of Zebrafish: Fish 6dpf | imb ketting 2018 02 redl SmartSeq 20 67 6dpf Fish rep2 S20 | imb ketting 2018 02 redl SmartSeq 20 67 6dpf Fish rep2 S20 | Library prep was performed with SmartSeq2 RNA Seq System following NuGen`s standard protocol M01406v2. Libraries were prepared with a starting amount of 1 ng and amplified in 12 PCR cycles. | RNA-Seq | TRANSCRIPTOMIC | PolyA | PAIRED | ILLUMINA | NextSeq 550 | SRP241074 | imb_ketting_2018_02_redl_SmartSeq_20_67_6dpf_Fish_rep2_S20.R1.fastq.gz imb_ketting_2018_02_redl_SmartSeq_20_67_6dpf_Fish_rep2_S20.R2.fastq.gz | fastq fastq | 3141146018.0 | 19880671.0 | imb ketting 2018 02 redl SmartSeq 20 67 6dpf Fish rep2 S20.R1.fastq.gz | 0:79 1:79 | A:838842352;C:731410784;G:716864447;T:853811876;N:216559 | 79 | 79 | 838842352 | 731410784 | 716864447 | 853811876 | 216559 | SRX7533038 | SRS5972263 | SRA1023320 | Rene Ketting group|Ketting Lab | Rene Ketting group | 2 | 0.94189 | 0.94199 | 0.11104 | 0.11083 | 0.68787 | 0.68976 | 0.4417 | 0.44175 | 79 | 79 | B | B | biological fallback assumption | illumina | nextseq | unknown | poly_a | unknown | sc | single_cell_plate | smartseq | Germany | 2020-01-10 | Larval | Larval | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 55890 | 55890 | SRR10863031 | SRX7533037 | SRS5972262 | SRP241074 | PRJNA597223 | Danio rerio primordial germ cell expression pofiling | PRJNA597223 | Whole Genome Sequencing | Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation. | The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done. | wt Fish 6dpf rep1 | strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:6dpf|dev stage:larval|sex:not applicable|tissue:whole embryo|biological replicate:replicate 1|BioSampleModel:Model organism or animal | mRNA of Zebrafish: Fish 6dpf | imb ketting 2018 02 redl SmartSeq 19 66 6dpf Fish rep1 S19 | imb ketting 2018 02 redl SmartSeq 19 66 6dpf Fish rep1 S19 | Library prep was performed with SmartSeq2 RNA Seq System following NuGen`s standard protocol M01406v2. Libraries were prepared with a starting amount of 1 ng and amplified in 12 PCR cycles. | RNA-Seq | TRANSCRIPTOMIC | PolyA | PAIRED | ILLUMINA | NextSeq 550 | SRP241074 | imb_ketting_2018_02_redl_SmartSeq_19_66_6dpf_Fish_rep1_S19.R1.fastq.gz imb_ketting_2018_02_redl_SmartSeq_19_66_6dpf_Fish_rep1_S19.R2.fastq.gz | fastq fastq | 3208247986.0 | 20305367.0 | imb ketting 2018 02 redl SmartSeq 19 66 6dpf Fish rep1 S19.R1.fastq.gz | 0:79 1:79 | A:854547229;C:748854314;G:732176934;T:872455301;N:214208 | 79 | 79 | 854547229 | 748854314 | 732176934 | 872455301 | 214208 | SRX7533037 | SRS5972262 | SRA1023320 | Rene Ketting group|Ketting Lab | Rene Ketting group | 2 | 0.9405 | 0.94167 | 0.1138 | 0.1145 | 0.67858 | 0.683 | 0.46082 | 0.42095 | 79 | 79 | B | B | biological fallback assumption | illumina | nextseq | unknown | poly_a | unknown | sc | single_cell_plate | smartseq | Germany | 2020-01-10 | Larval | Larval | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 55891 | 55891 | SRR10863032 | SRX7533036 | SRS5972261 | SRP241074 | PRJNA597223 | Danio rerio primordial germ cell expression pofiling | PRJNA597223 | Whole Genome Sequencing | Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation. | The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done. | wt Fish 3dpf rep2 | strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:3dpf|dev stage:protruding mouth|sex:not applicable|tissue:whole embryo|biological replicate:replicate 2|BioSampleModel:Model organism or animal | mRNA of Zebrafish: Fish 3dpf | imb ketting 2018 02 redl SmartSeq 18 68 3dpf Fish rep2 S18 | imb ketting 2018 02 redl SmartSeq 18 68 3dpf Fish rep2 S18 | Library prep was performed with SmartSeq2 RNA Seq System following NuGen`s standard protocol M01406v2. Libraries were prepared with a starting amount of 1 ng and amplified in 12 PCR cycles. | RNA-Seq | TRANSCRIPTOMIC | PolyA | PAIRED | ILLUMINA | NextSeq 550 | SRP241074 | imb_ketting_2018_02_redl_SmartSeq_18_68_3dpf_Fish_rep2_S18.R1.fastq.gz imb_ketting_2018_02_redl_SmartSeq_18_68_3dpf_Fish_rep2_S18.R2.fastq.gz | fastq fastq | 3473912978.0 | 21986791.0 | imb ketting 2018 02 redl SmartSeq 18 68 3dpf Fish rep2 S18.R1.fastq.gz | 0:79 1:79 | A:926028590;C:808989307;G:800996495;T:937660664;N:237922 | 79 | 79 | 926028590 | 808989307 | 800996495 | 937660664 | 237922 | SRX7533036 | SRS5972261 | SRA1023320 | Rene Ketting group|Ketting Lab | Rene Ketting group | 2 | 0.94661 | 0.94606 | 0.09208 | 0.09205 | 0.67896 | 0.68105 | 0.43418 | 0.44149 | 79 | 79 | B | B | biological fallback assumption | illumina | nextseq | unknown | poly_a | unknown | sc | single_cell_plate | smartseq | Germany | 2020-01-10 | Larval | Larval | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 55892 | 55892 | SRR10863033 | SRX7533035 | SRS5972260 | SRP241074 | PRJNA597223 | Danio rerio primordial germ cell expression pofiling | PRJNA597223 | Whole Genome Sequencing | Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation. | The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done. | wt Fish 3dpf rep1 | strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:3dpf|dev stage:protruding mouth|sex:not applicable|tissue:whole embryo|biological replicate:replicate 1|BioSampleModel:Model organism or animal | mRNA of Zebrafish: Fish 3dpf | imb ketting 2018 02 redl SmartSeq 17 03 3dpf Fish rep1 S17 | imb ketting 2018 02 redl SmartSeq 17 03 3dpf Fish rep1 S17 | Library prep was performed with SmartSeq2 RNA Seq System following NuGen`s standard protocol M01406v2. Libraries were prepared with a starting amount of 1 ng and amplified in 12 PCR cycles. | RNA-Seq | TRANSCRIPTOMIC | PolyA | PAIRED | ILLUMINA | NextSeq 550 | SRP241074 | imb_ketting_2018_02_redl_SmartSeq_17_03_3dpf_Fish_rep1_S17.R1.fastq.gz imb_ketting_2018_02_redl_SmartSeq_17_03_3dpf_Fish_rep1_S17.R2.fastq.gz | fastq fastq | 3383193960.0 | 21412620.0 | imb ketting 2018 02 redl SmartSeq 17 03 3dpf Fish rep1 S17.R1.fastq.gz | 0:79 1:79 | A:903658559;C:789740630;G:763902271;T:925656543;N:235957 | 79 | 79 | 903658559 | 789740630 | 763902271 | 925656543 | 235957 | SRX7533035 | SRS5972260 | SRA1023320 | Rene Ketting group|Ketting Lab | Rene Ketting group | 2 | 0.94068 | 0.94162 | 0.11921 | 0.11989 | 0.67377 | 0.67572 | 0.45353 | 0.44698 | 79 | 79 | B | B | biological fallback assumption | illumina | nextseq | unknown | poly_a | unknown | sc | single_cell_plate | smartseq | Germany | 2020-01-10 | Larval | Larval | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 55893 | 55893 | SRR10863034 | SRX7533034 | SRS5972259 | SRP241074 | PRJNA597223 | Danio rerio primordial germ cell expression pofiling | PRJNA597223 | Whole Genome Sequencing | Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation. | The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done. | wt Fish 2dpf rep2 | strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:2dpf|dev stage:Long pec stage|sex:not applicable|tissue:whole embryo|biological replicate:replicate 2|BioSampleModel:Model organism or animal | mRNA of Zebrafish: Fish 2dpf | imb ketting 2018 02 redl SmartSeq 16 63 2dpf Fish rep2 S16 | imb ketting 2018 02 redl SmartSeq 16 63 2dpf Fish rep2 S16 | Library prep was performed with SmartSeq2 RNA Seq System following NuGen`s standard protocol M01406v2. Libraries were prepared with a starting amount of 1 ng and amplified in 12 PCR cycles. | RNA-Seq | TRANSCRIPTOMIC | PolyA | PAIRED | ILLUMINA | NextSeq 550 | SRP241074 | imb_ketting_2018_02_redl_SmartSeq_16_63_2dpf_Fish_rep2_S16.R1.fastq.gz imb_ketting_2018_02_redl_SmartSeq_16_63_2dpf_Fish_rep2_S16.R2.fastq.gz | fastq fastq | 3091658206.0 | 19567457.0 | imb ketting 2018 02 redl SmartSeq 16 63 2dpf Fish rep2 S16.R1.fastq.gz | 0:79 1:79 | A:818837054;C:727836511;G:707557580;T:837216941;N:210120 | 79 | 79 | 818837054 | 727836511 | 707557580 | 837216941 | 210120 | SRX7533034 | SRS5972259 | SRA1023320 | Rene Ketting group|Ketting Lab | Rene Ketting group | 2 | 0.94667 | 0.94646 | 0.08702 | 0.08692 | 0.69804 | 0.70138 | 0.43628 | 0.43409 | 79 | 79 | B | B | biological fallback assumption | illumina | nextseq | unknown | poly_a | unknown | sc | single_cell_plate | smartseq | Germany | 2020-01-10 | Hatching | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 55894 | 55894 | SRR10863035 | SRX7533033 | SRS5972258 | SRP241074 | PRJNA597223 | Danio rerio primordial germ cell expression pofiling | PRJNA597223 | Whole Genome Sequencing | Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation. | The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done. | wt Fish 2dpf rep1 | strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:2dpf|dev stage:Long pec stage|sex:not applicable|tissue:whole embryo|biological replicate:replicate 1|BioSampleModel:Model organism or animal | mRNA of Zebrafish: Fish 2dpf | imb ketting 2018 02 redl SmartSeq 15 02 2dpf Fish rep1 S15 | imb ketting 2018 02 redl SmartSeq 15 02 2dpf Fish rep1 S15 | Library prep was performed with SmartSeq2 RNA Seq System following NuGen`s standard protocol M01406v2. Libraries were prepared with a starting amount of 1 ng and amplified in 12 PCR cycles. | RNA-Seq | TRANSCRIPTOMIC | PolyA | PAIRED | ILLUMINA | NextSeq 550 | SRP241074 | imb_ketting_2018_02_redl_SmartSeq_15_02_2dpf_Fish_rep1_S15.R1.fastq.gz imb_ketting_2018_02_redl_SmartSeq_15_02_2dpf_Fish_rep1_S15.R2.fastq.gz | fastq fastq | 3499876328.0 | 22151116.0 | imb ketting 2018 02 redl SmartSeq 15 02 2dpf Fish rep1 S15.R1.fastq.gz | 0:79 1:79 | A:931187812;C:820606968;G:796104654;T:951733888;N:243006 | 79 | 79 | 931187812 | 820606968 | 796104654 | 951733888 | 243006 | SRX7533033 | SRS5972258 | SRA1023320 | Rene Ketting group|Ketting Lab | Rene Ketting group | 2 | 0.94532 | 0.94537 | 0.10394 | 0.10459 | 0.69489 | 0.69727 | 0.4345 | 0.43676 | 79 | 79 | B | B | biological fallback assumption | illumina | nextseq | unknown | poly_a | unknown | sc | single_cell_plate | smartseq | Germany | 2020-01-10 | Hatching | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 55895 | 55895 | SRR10863036 | SRX7533032 | SRS5972257 | SRP241074 | PRJNA597223 | Danio rerio primordial germ cell expression pofiling | PRJNA597223 | Whole Genome Sequencing | Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation. | The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done. | wt Fish 1dpf rep2 | strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:1dpf|dev stage:Pharyngula period|sex:not applicable|tissue:whole embryo|biological replicate:replicate 2|BioSampleModel:Model organism or animal | mRNA of Zebrafish: Fish 1dpf | imb ketting 2018 02 redl SmartSeq 14 69 1dpf Fish rep2 S14 | imb ketting 2018 02 redl SmartSeq 14 69 1dpf Fish rep2 S14 | Library prep was performed with SmartSeq2 RNA Seq System following NuGen`s standard protocol M01406v2. Libraries were prepared with a starting amount of 1 ng and amplified in 12 PCR cycles. | RNA-Seq | TRANSCRIPTOMIC | PolyA | PAIRED | ILLUMINA | NextSeq 550 | SRP241074 | imb_ketting_2018_02_redl_SmartSeq_14_69_1dpf_Fish_rep2_S14.R1.fastq.gz imb_ketting_2018_02_redl_SmartSeq_14_69_1dpf_Fish_rep2_S14.R2.fastq.gz | fastq fastq | 3173577572.0 | 20085934.0 | imb ketting 2018 02 redl SmartSeq 14 69 1dpf Fish rep2 S14.R1.fastq.gz | 0:79 1:79 | A:851665093;C:736131084;G:718748661;T:866816699;N:216035 | 79 | 79 | 851665093 | 736131084 | 718748661 | 866816699 | 216035 | SRX7533032 | SRS5972257 | SRA1023320 | Rene Ketting group|Ketting Lab | Rene Ketting group | 2 | 0.94469 | 0.9439 | 0.08631 | 0.08612 | 0.71062 | 0.71204 | 0.46629 | 0.46237 | 79 | 79 | B | B | biological fallback assumption | illumina | nextseq | unknown | poly_a | unknown | sc | single_cell_plate | smartseq | Germany | 2020-01-10 | Pharyngula | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 55896 | 55896 | SRR10863037 | SRX7533031 | SRS5972256 | SRP241074 | PRJNA597223 | Danio rerio primordial germ cell expression pofiling | PRJNA597223 | Whole Genome Sequencing | Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation. | The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done. | wt Fish 1dpf rep1 | strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:1dpf|dev stage:Pharyngula period|sex:not applicable|tissue:whole embryo|biological replicate:replicate 1|BioSampleModel:Model organism or animal | mRNA of Zebrafish: Fish 1dpf | imb ketting 2018 02 redl SmartSeq 13 01 1dpf Fish rep1 S13 | imb ketting 2018 02 redl SmartSeq 13 01 1dpf Fish rep1 S13 | Library prep was performed with SmartSeq2 RNA Seq System following NuGen`s standard protocol M01406v2. Libraries were prepared with a starting amount of 1 ng and amplified in 12 PCR cycles. | RNA-Seq | TRANSCRIPTOMIC | PolyA | PAIRED | ILLUMINA | NextSeq 550 | SRP241074 | imb_ketting_2018_02_redl_SmartSeq_13_01_1dpf_Fish_rep1_S13.R1.fastq.gz imb_ketting_2018_02_redl_SmartSeq_13_01_1dpf_Fish_rep1_S13.R2.fastq.gz | fastq fastq | 3241792492.0 | 20517674.0 | imb ketting 2018 02 redl SmartSeq 13 01 1dpf Fish rep1 S13.R1.fastq.gz | 0:79 1:79 | A:865936682;C:756362974;G:735614291;T:883655547;N:222998 | 79 | 79 | 865936682 | 756362974 | 735614291 | 883655547 | 222998 | SRX7533031 | SRS5972256 | SRA1023320 | Rene Ketting group|Ketting Lab | Rene Ketting group | 2 | 0.94544 | 0.94715 | 0.08154 | 0.0819 | 0.70928 | 0.71011 | 0.45932 | 0.46165 | 79 | 79 | B | B | biological fallback assumption | illumina | nextseq | unknown | poly_a | unknown | sc | single_cell_plate | smartseq | Germany | 2020-01-10 | Pharyngula | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 55897 | 55897 | SRR10863038 | SRX7533030 | SRS5972255 | SRP241074 | PRJNA597223 | Danio rerio primordial germ cell expression pofiling | PRJNA597223 | Whole Genome Sequencing | Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation. | The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done. | wt zygote 0hpf rep3 | strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:0hpf|dev stage:zygote|sex:not applicable|tissue:whole embryo|biological replicate:replicate 3|BioSampleModel:Model organism or animal | mRNA of Zebrafish: zygotes 0hpf | imb ketting 2018 18 redl SmartSeq2 08 0hpf zygotes rep3 S25 | imb ketting 2018 18 redl SmartSeq2 08 0hpf zygotes rep3 S25 | Library prep was performed with SmartSeq2 RNA Seq System following NuGen`s standard protocol M01406v2. Libraries were prepared with a starting amount of 1 ng and amplified in 12 PCR cycles. | RNA-Seq | TRANSCRIPTOMIC | PolyA | PAIRED | ILLUMINA | NextSeq 550 | SRP241074 | imb_ketting_2018_18_redl_SmartSeq2-08_0hpf_zygotes_rep3_S25.R1.fastq.gz imb_ketting_2018_18_redl_SmartSeq2-08_0hpf_zygotes_rep3_S25.R2.fastq.gz | fastq fastq | 2254742850.0 | 15031619.0 | imb ketting 2018 18 redl SmartSeq2 08 0hpf zygotes rep3 S25.R1.fastq.gz | 0:75 1:75 | A:601169757;C:521134633;G:522514682;T:609902670;N:21108 | 75 | 75 | 601169757 | 521134633 | 522514682 | 609902670 | 21108 | SRX7533030 | SRS5972255 | SRA1023320 | Rene Ketting group|Ketting Lab | Rene Ketting group | 2 | 0.94461 | 0.94575 | 0.01803 | 0.01807 | 0.76751 | 0.76883 | 0.49585 | 0.49808 | 75 | 75 | B | B | biological fallback assumption | illumina | nextseq | unknown | poly_a | unknown | sc | single_cell_plate | smartseq | Germany | 2020-01-10 | Zygote | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 55899 | 55899 | SRR10863040 | SRX7533028 | SRS5972254 | SRP241074 | PRJNA597223 | Danio rerio primordial germ cell expression pofiling | PRJNA597223 | Whole Genome Sequencing | Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation. | The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done. | wt zygote 0hpf rep2 | strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:0hpf|dev stage:zygote|sex:not applicable|tissue:whole embryo|biological replicate:replicate 2|BioSampleModel:Model organism or animal | mRNA of Zebrafish: zygotes 0hpf | imb ketting 2018 18 redl SmartSeq2 07 0hpf zygotes rep2 S24 | imb ketting 2018 18 redl SmartSeq2 07 0hpf zygotes rep2 S24 | Library prep was performed with SmartSeq2 RNA Seq System following NuGen`s standard protocol M01406v2. Libraries were prepared with a starting amount of 1 ng and amplified in 12 PCR cycles. | RNA-Seq | TRANSCRIPTOMIC | PolyA | PAIRED | ILLUMINA | NextSeq 550 | SRP241074 | imb_ketting_2018_18_redl_SmartSeq2-07_0hpf_zygotes_rep2_S24.R1.fastq.gz imb_ketting_2018_18_redl_SmartSeq2-07_0hpf_zygotes_rep2_S24.R2.fastq.gz | fastq fastq | 2415051600.0 | 16100344.0 | imb ketting 2018 18 redl SmartSeq2 07 0hpf zygotes rep2 S24.R1.fastq.gz | 0:75 1:75 | A:644001016;C:558385744;G:560491907;T:652150600;N:22333 | 75 | 75 | 644001016 | 558385744 | 560491907 | 652150600 | 22333 | SRX7533028 | SRS5972254 | SRA1023320 | Rene Ketting group|Ketting Lab | Rene Ketting group | 2 | 0.9462 | 0.94755 | 0.02097 | 0.02075 | 0.76694 | 0.76909 | 0.4948 | 0.49938 | 75 | 75 | B | B | biological fallback assumption | illumina | nextseq | unknown | poly_a | unknown | sc | single_cell_plate | smartseq | Germany | 2020-01-10 | Zygote | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||
| 55900 | 55900 | SRR10863041 | SRX7533027 | SRS5972253 | SRP241074 | PRJNA597223 | Danio rerio primordial germ cell expression pofiling | PRJNA597223 | Whole Genome Sequencing | Primordial germ cells PGCs are the precursors of germ cells which migrate to the genital ridge during early development. Relatively little is known about PGCs post their migration. We studied this post migratory stage using microscopy and sequencing techniques. We found that many PGC specific genes including genes known to induce PGC fate in the mouse are only activated several days post migration. At this same timepoint PGC nuclei become extremely gyrated displaying general opening of chromatin and high levels of transcription. This is accompanied by changes in nuage morphology and expression of large loci named PERLs enriched for retro transposons and piRNAs. piRNA biogenesis signatures rise in this same period. Interestingly no nuclear Piwi protein could be detected indicating that the zebrafish piRNA pathway is fully cytoplasmic. Our data show that the post migratory stage of zebrafish PGCs holds many cues to both germ cell fate establishment and piRNA pathway activation. | The vasa:eGFP line Krøvel and Olsen 2002 was used to FACS sort PGCs at different timepoints. Embryos were collected and incubated with TrypLETM Express for 40 to 70 minutes killed on ice and gently pippeted up and down with a glass pipet and/or a 200µl low retention pipet tip. post visual inspection cell suspension was separated from trunks using a 100 µm siev. Following another 5 15 minutes of digestion FCS was added to 10% of total volume. Cells were spun down at 500g for 5min at RT washed with PBS resuspended in PBS with 2% FCS put on Ice and immediately subjected to FACS using a 85µm nozzle on a BD FACSAria III SORP Becton Dickinson. 1000 to 2500 cells were sorted directly into Trizol. RNA from sorted PGCs and whole embryos was extracted with Trizol and stored in MQ at 80°C until library preparation was done. | wt zygote 0hpf rep1 | strain:vasa:eGFP|isolate:not applicable|breed:TUE|cultivar:not applicable|ecotype:not applicable|age:0hpf|dev stage:zygote|sex:not applicable|tissue:whole embryo|biological replicate:replicate 1|BioSampleModel:Model organism or animal | mRNA of Zebrafish: zygotes 0hpf | imb ketting 2018 18 redl SmartSeq2 06 0hpf zygotes rep1 S23 | imb ketting 2018 18 redl SmartSeq2 06 0hpf zygotes rep1 S23 | Library prep was performed with SmartSeq2 RNA Seq System following NuGen`s standard protocol M01406v2. Libraries were prepared with a starting amount of 1 ng and amplified in 12 PCR cycles. | RNA-Seq | TRANSCRIPTOMIC | PolyA | PAIRED | ILLUMINA | NextSeq 550 | SRP241074 | imb_ketting_2018_18_redl_SmartSeq2-06_0hpf_zygotes_rep1_S23.R1.fastq.gz imb_ketting_2018_18_redl_SmartSeq2-06_0hpf_zygotes_rep1_S23.R2.fastq.gz | fastq fastq | 2621759100.0 | 17478394.0 | imb ketting 2018 18 redl SmartSeq2 06 0hpf zygotes rep1 S23.R1.fastq.gz | 0:75 1:75 | A:697302326;C:607756156;G:612217195;T:704460378;N:23045 | 75 | 75 | 697302326 | 607756156 | 612217195 | 704460378 | 23045 | SRX7533027 | SRS5972253 | SRA1023320 | Rene Ketting group|Ketting Lab | Rene Ketting group | 2 | 0.94882 | 0.95052 | 0.02124 | 0.02139 | 0.77082 | 0.7724 | 0.49237 | 0.49259 | 75 | 75 | B | B | biological fallback assumption | illumina | nextseq | unknown | poly_a | unknown | sc | single_cell_plate | smartseq | Germany | 2020-01-10 | Zygote | Embryo | Whole Organism | All anatomical structures |
Advanced export
JSON shape: default, array, newline-delimited
CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;