RNAquarium Metadata Server
Institute Website Terms of Use Privacy Policy

run_metadata

65 rows where experiment.library_selection = "PCR", experiment.library_source = "TRANSCRIPTOMIC" and technology = 454

✎ View and edit SQL

This data as json, CSV (advanced)

devstage_curation_coarse 4

devstage_curation 4

tissue_curation_coarse 1

tissue_curation 1

technology 1

  • 454 · 65 ✖

experiment.platform 1

experiment.library_strategy 1

experiment.library_source 1

  • TRANSCRIPTOMIC · 65 ✖

experiment.library_selection 1

  • PCR · 65 ✖

experiment.library_layout 1

Link rowid ▼ run.accession experiment.accession sample.accession study.accession bioproject study.title study.alias study.type study.abstract study.attributes study.PMIDs sample.description sample.title sample.alias sample.centername sample.attributes GEOsample.title GEOsample.dataprocessing GEOsample.source GEOsample.treatmentprotocol GEOsample.extractprotocol GEOsample.growthprotocol GEOsample.characteristics GEOsample.accession experiment.title experiment.alias experiment.library_name experiment.design_description experiment.library_construction_protocol experiment.attributes experiment.library_strategy experiment.library_source experiment.library_selection experiment.library_layout experiment.platform experiment.instrument_model experiment.spot_descriptor experiment.study_ref run.title run.attributes run.filename run.semantic_name run.total_bases run.total_spots run.alias run.read_lengths run.base_counts run.r1_length run.r2_length run.r3_length run.r4_length run.Acount run.Ccount run.Gcount run.Tcount run.Ncount run.experiment run.pool_member submission.accession submission.srasource submission.bioprojectsource seqdetective.n_mates seqdetective.mapping_rate.mate1 seqdetective.mapping_rate.mate2 seqdetective.nofeature_rate.mate1 seqdetective.nofeature_rate.mate2 seqdetective.sparsity.mate1 seqdetective.sparsity.mate2 seqdetective.pos_strand_rate.mate1 seqdetective.pos_strand_rate.mate2 seqdetective.readlen.mate1 seqdetective.readlen.mate2 seqdetective.judgement.mate1 seqdetective.judgement.mate2 seqdetective.judgement.reason platform_family instrument_generation read_bias selection_class prep_kit sc_or_bulk tech_class technology tech_variant submission.bioprojectsource.country earliest_date devstage_curation devstage_curation_coarse tissue_curation tissue_curation_coarse
67908 67908 SRR017341 SRX003632 SRS002067 SRP000652 PRJNA79415 Zebrafish IgH Sequencing Zebrafish IgH Other 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.   pubmed:19423829   Generic sample from Danio rerio Fish N                     Zebrafish IgH cDNA preparation Zebrafish IgH cDNA FishN Zebrafish IgH 454 About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.   IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP000652   NonStandardReadNameUsed:true N_fish.tar fastq 40231384.0 173756.0 Zebrafish IgH cDNA FishN 0:4 1:227.54 A:10436935;C:8800020;G:9512025;T:11471941;N:10463 4 227     10436935 8800020 9512025 11471941 10463 SRX003632 SRS002067 SRA008134 Stanford University|Quake Stanford University 1 0.26487   0.0663   0.99304   0.01389   229   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-03-31 Undetermined Undetermined BCR TCR repertoire Hematopoietic System
67909 67909 SRR017340 SRX003631 SRS002066 SRP000652 PRJNA79415 Zebrafish IgH Sequencing Zebrafish IgH Other 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.   pubmed:19423829   Generic sample from Danio rerio Fish M                     Zebrafish IgH cDNA preparation Zebrafish IgH cDNA FishM Zebrafish IgH 454 About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.   IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP000652   NonStandardReadNameUsed:true M_fish.tar fastq 37492198.0 161639.0 Zebrafish IgH cDNA FishM 0:4 1:227.95 A:9527141;C:8129088;G:9025760;T:10804127;N:6082 4 227     9527141 8129088 9025760 10804127 6082 SRX003631 SRS002066 SRA008134 Stanford University|Quake Stanford University 1 0.31521   0.11394   0.99823   0.00291   208   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-03-31 Undetermined Undetermined BCR TCR repertoire Hematopoietic System
67910 67910 SRR017339 SRX003630 SRS002065 SRP000652 PRJNA79415 Zebrafish IgH Sequencing Zebrafish IgH Other 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.   pubmed:19423829   Generic sample from Danio rerio Fish L                     Zebrafish IgH cDNA preparation Zebrafish IgH cDNA FishL Zebrafish IgH 454 About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.   IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP000652   NonStandardReadNameUsed:true L_fish.tar fastq 37971443.0 163701.0 Zebrafish IgH cDNA FishL 0:4 1:227.96 A:9544875;C:8363123;G:9094601;T:10963684;N:5160 4 227     9544875 8363123 9094601 10963684 5160 SRX003630 SRS002065 SRA008134 Stanford University|Quake Stanford University 1 0.29057   0.07862   0.99636   0.00534   245   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-03-31 Undetermined Undetermined BCR TCR repertoire Hematopoietic System
67911 67911 SRR017338 SRX003629 SRS002064 SRP000652 PRJNA79415 Zebrafish IgH Sequencing Zebrafish IgH Other 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.   pubmed:19423829   Generic sample from Danio rerio Fish K                     Zebrafish IgH cDNA preparation Zebrafish IgH cDNA FishK Zebrafish IgH 454 About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.   IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP000652   NonStandardReadNameUsed:true K_fish.tar fastq 54201403.0 234266.0 Zebrafish IgH cDNA FishK 0:4 1:227.37 A:13608677;C:11652239;G:12945164;T:15975205;N:20118 4 227     13608677 11652239 12945164 15975205 20118 SRX003629 SRS002064 SRA008134 Stanford University|Quake Stanford University 1 0.27218   0.07987   0.99275   0.01242   244   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-03-31 Undetermined Undetermined BCR TCR repertoire Hematopoietic System
67912 67912 SRR017337 SRX003628 SRS002063 SRP000652 PRJNA79415 Zebrafish IgH Sequencing Zebrafish IgH Other 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.   pubmed:19423829   Generic sample from Danio rerio Fish J                     Zebrafish IgH cDNA preparation Zebrafish IgH cDNA FishJ Zebrafish IgH 454 About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.   IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP000652   NonStandardReadNameUsed:true J_fish.tar fastq 51915342.0 224027.0 Zebrafish IgH cDNA FishJ 0:4 1:227.74 A:12664582;C:12040983;G:12609762;T:14589770;N:10245 4 227     12664582 12040983 12609762 14589770 10245 SRX003628 SRS002063 SRA008134 Stanford University|Quake Stanford University 1 0.29028   0.10039   0.9964   0.00625   97   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-03-31 Undetermined Undetermined BCR TCR repertoire Hematopoietic System
67913 67913 SRR017336 SRX003627 SRS002062 SRP000652 PRJNA79415 Zebrafish IgH Sequencing Zebrafish IgH Other 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.   pubmed:19423829   Generic sample from Danio rerio Fish I                     Zebrafish IgH cDNA preparation Zebrafish IgH cDNA FishI Zebrafish IgH 454 About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.   IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP000652   NonStandardReadNameUsed:true I_fish.tar fastq 23436268.0 100120.0 Zebrafish IgH cDNA FishI 0:4 1:230.08 A:5801823;C:5246438;G:5587169;T:6797624;N:3214 4 230     5801823 5246438 5587169 6797624 3214 SRX003627 SRS002062 SRA008134 Stanford University|Quake Stanford University 1 0.34362   0.0757   0.99241   0.02647   232   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-03-31 Undetermined Undetermined BCR TCR repertoire Hematopoietic System
67914 67914 SRR017335 SRX003626 SRS002061 SRP000652 PRJNA79415 Zebrafish IgH Sequencing Zebrafish IgH Other 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.   pubmed:19423829   Generic sample from Danio rerio Fish H                     Zebrafish IgH cDNA preparation Zebrafish IgH cDNA FishH Zebrafish IgH 454 About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.   IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP000652   NonStandardReadNameUsed:true H_fish.tar fastq 48443452.0 213531.0 Zebrafish IgH cDNA FishH 0:4 1:222.87 A:12720681;C:10490855;G:11923926;T:13303989;N:4001 4 222     12720681 10490855 11923926 13303989 4001 SRX003626 SRS002061 SRA008134 Stanford University|Quake Stanford University 1 0.45847   0.04709   0.98754   0.0161   56   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-03-31 Undetermined Undetermined BCR TCR repertoire Hematopoietic System
67915 67915 SRR017334 SRX003625 SRS002060 SRP000652 PRJNA79415 Zebrafish IgH Sequencing Zebrafish IgH Other 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.   pubmed:19423829   Generic sample from Danio rerio Fish G                     Zebrafish IgH cDNA preparation Zebrafish IgH cDNA FishG Zebrafish IgH 454 About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.   IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP000652   NonStandardReadNameUsed:true G_fish.tar fastq 50095821.0 217866.0 Zebrafish IgH cDNA FishG 0:4 1:225.94 A:13182103;C:11299206;G:11909574;T:13700817;N:4121 4 225     13182103 11299206 11909574 13700817 4121 SRX003625 SRS002060 SRA008134 Stanford University|Quake Stanford University 1 0.37294   0.09947   0.99034   0.02245   230   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-03-31 Undetermined Undetermined BCR TCR repertoire Hematopoietic System
67916 67916 SRR017333 SRX003624 SRS002059 SRP000652 PRJNA79415 Zebrafish IgH Sequencing Zebrafish IgH Other 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.   pubmed:19423829   Generic sample from Danio rerio Fish F                     Zebrafish IgH cDNA preparation Zebrafish IgH cDNA FishF Zebrafish IgH 454 About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.   IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP000652   NonStandardReadNameUsed:true F_fish.tar fastq 16577798.0 83387.0 Zebrafish IgH cDNA FishF 0:4 1:194.81 A:4215316;C:3618457;G:4002690;T:4736893;N:4442 4 194     4215316 3618457 4002690 4736893 4442 SRX003624 SRS002059 SRA008134 Stanford University|Quake Stanford University 1 0.57361   0.0727   0.99965   0.00026   62   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-03-31 Undetermined Undetermined BCR TCR repertoire Hematopoietic System
67917 67917 SRR017332 SRX003623 SRS002058 SRP000652 PRJNA79415 Zebrafish IgH Sequencing Zebrafish IgH Other 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.   pubmed:19423829   Generic sample from Danio rerio Fish E                     Zebrafish IgH cDNA preparation Zebrafish IgH cDNA FishE Zebrafish IgH 454 About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.   IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP000652   NonStandardReadNameUsed:true E_fish.tar fastq 29705006.0 131553.0 Zebrafish IgH cDNA FishE 0:4 1:221.80 A:7474430;C:6417563;G:7115572;T:8693543;N:3898 4 221     7474430 6417563 7115572 8693543 3898 SRX003623 SRS002058 SRA008134 Stanford University|Quake Stanford University 1 0.3099   0.09802   0.99904   0.00099   45   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-03-31 Undetermined Undetermined BCR TCR repertoire Hematopoietic System
67918 67918 SRR017331 SRX003622 SRS002057 SRP000652 PRJNA79415 Zebrafish IgH Sequencing Zebrafish IgH Other 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.   pubmed:19423829   Generic sample from Danio rerio Fish D                     Zebrafish IgH cDNA preparation Zebrafish IgH cDNA FishD Zebrafish IgH 454 About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.   IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP000652   NonStandardReadNameUsed:true D_fish.tar fastq 27611909.0 123468.0 Zebrafish IgH cDNA FishD 0:4 1:219.64 A:6809564;C:6219469;G:6636933;T:7943112;N:2831 4 219     6809564 6219469 6636933 7943112 2831 SRX003622 SRS002057 SRA008134 Stanford University|Quake Stanford University 1 0.45962   0.09396   0.99941   0.00026   218   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-03-31 Undetermined Undetermined BCR TCR repertoire Hematopoietic System
67919 67919 SRR017330 SRX003621 SRS002056 SRP000652 PRJNA79415 Zebrafish IgH Sequencing Zebrafish IgH Other 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.   pubmed:19423829   Generic sample from Danio rerio Fish C                     Zebrafish IgH cDNA preparation Zebrafish IgH cDNA FishC Zebrafish IgH 454 About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.   IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP000652   NonStandardReadNameUsed:true C_fish.tar fastq 21845405.0 95733.0 Zebrafish IgH cDNA FishC 0:4 1:224.19 A:5735195;C:4746747;G:5266352;T:6095066;N:2045 4 224     5735195 4746747 5266352 6095066 2045 SRX003621 SRS002056 SRA008134 Stanford University|Quake Stanford University 1 0.38908   0.20497   0.99967   0.00047   145   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-03-31 Undetermined Undetermined BCR TCR repertoire Hematopoietic System
67920 67920 SRR017329 SRX003620 SRS002055 SRP000652 PRJNA79415 Zebrafish IgH Sequencing Zebrafish IgH Other 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.   pubmed:19423829   Generic sample from Danio rerio Fish B                     Zebrafish IgH cDNA preparation Zebrafish IgH cDNA FishB Zebrafish IgH 454 About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.   IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP000652   NonStandardReadNameUsed:true B_fish.tar fastq 26680294.0 118385.0 Zebrafish IgH cDNA FishB 0:4 1:221.37 A:6380496;C:6168810;G:6541530;T:7587018;N:2440 4 221     6380496 6168810 6541530 7587018 2440 SRX003620 SRS002055 SRA008134 Stanford University|Quake Stanford University 1 0.35498   0.14675   0.99906   0.00098   228   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-03-31 Undetermined Undetermined BCR TCR repertoire Hematopoietic System
67921 67921 SRR017328 SRX003619 SRS002054 SRP000652 PRJNA79415 Zebrafish IgH Sequencing Zebrafish IgH Other 14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence 10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.   pubmed:19423829   Generic sample from Danio rerio Fish A                     Zebrafish IgH cDNA preparation Zebrafish IgH cDNA FishA Zebrafish IgH 454 About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt Beverly MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. "Digital PCR provides sensitive and absolute calibration for high throughput sequencing" BMC Genomics 2009 which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.   IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP000652   NonStandardReadNameUsed:true A_fish.tar fastq 13497752.0 61111.0 Zebrafish IgH cDNA FishA 0:4 1:216.87 A:3287411;C:3078068;G:3224467;T:3906026;N:1780 4 216     3287411 3078068 3224467 3906026 1780 SRX003619 SRS002054 SRA008134 Stanford University|Quake Stanford University 1 0.32333   0.14098   0.99937   0.00169   52   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-03-31 Undetermined Undetermined BCR TCR repertoire Hematopoietic System
68262 68262 SRR099333 SRX041597 SRS172447 SRP005640 PRJNA79973 Zebrafish Development 4432-2WA Other Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.   pubmed:21393572 Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio leading with MID barcode TAGTATCAGC 4432 1Y D 4432 1Y D                     1 4432 1Y D Zebrafish WIK Standard Roche 454 GS Titanium shotgun library protocol was followed.     AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX Titanium <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP005640         72592827.0 232367.0 4432 1Y D 0:4 1:308.41   4 308               SRX041597 SRS172447 SRA029829 Stanford University|Quake Stanford University 1 0.13098   0.04666   0.99943   0.00078   195   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-04-07 Adult Adult BCR TCR repertoire Hematopoietic System
68263 68263 SRR099332 SRX041596 SRS172446 SRP005640 PRJNA79973 Zebrafish Development 4432-2WA Other Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.   pubmed:21393572 Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio leading with MID barcode TAGTATCAGC 4432 1Y C9 4432 1Y C9                     1 4432 1Y C9 Zebrafish WIK Standard Roche 454 GS Titanium shotgun library protocol was followed.     AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX Titanium <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP005640         78320127.0 261806.0 4432 1Y C9 0:4 1:295.15   4 295               SRX041596 SRS172446 SRA029829 Stanford University|Quake Stanford University 1 0.20079   0.01319   0.99971   0.0004   37   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-04-07 Adult Adult BCR TCR repertoire Hematopoietic System
68264 68264 SRR099331 SRX041595 SRS172445 SRP005640 PRJNA79973 Zebrafish Development 4432-2WA Other Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.   pubmed:21393572 Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio leading with MID barcode CTCGCGTGTC 4432 1Y B8 4432 1Y B8                     1 4432 1Y B8 Zebrafish WIK Standard Roche 454 GS Titanium shotgun library protocol was followed.     AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX Titanium <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP005640         46900878.0 156154.0 4432 1Y B8 0:4 1:296.35   4 296               SRX041595 SRS172445 SRA029829 Stanford University|Quake Stanford University 1 0.21827   0.01485   0.99961   0.00018   37   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-04-07 Adult Adult BCR TCR repertoire Hematopoietic System
68265 68265 SRR099330 SRX041594 SRS172444 SRP005640 PRJNA79973 Zebrafish Development 4432-2WA Other Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.   pubmed:21393572 Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio leading with MID barcode CGTGTCTCTA 4432 1Y A7 4432 1Y A7                     1 4432 1Y A7 Zebrafish WIK Standard Roche 454 GS Titanium shotgun library protocol was followed.     AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX Titanium <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP005640         22543768.0 73425.0 4432 1Y A7 0:4 1:303.03   4 303               SRX041594 SRS172444 SRA029829 Stanford University|Quake Stanford University 1 0.16879   0.02006   0.99973   0.00063   89   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-04-07 Adult Adult BCR TCR repertoire Hematopoietic System
68266 68266 SRR099325 SRX041593 SRS172443 SRP005640 PRJNA79973 Zebrafish Development 4432-2WA Other Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.   pubmed:21393572 Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio leading with MID barcode ATATCGCGAG 4430 1Y C6 4430 1Y C6                     1 4430 1Y C6 Zebrafish WIK Standard Roche 454 GS Titanium shotgun library protocol was followed.     AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX Titanium <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP005640         38479526.0 134024.0 4430 1Y C6 0:4 1:283.11   4 283               SRX041593 SRS172443 SRA029829 Stanford University|Quake Stanford University 1 0.11658   0.00464   0.99928   0.00323   37   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-04-07 Adult Adult BCR TCR repertoire Hematopoietic System
68267 68267 SRR099324 SRX041592 SRS172442 SRP005640 PRJNA79973 Zebrafish Development 4432-2WA Other Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.   pubmed:21393572 Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio leading with MID barcode ATCAGACACG 4430 1Y B5 4430 1Y B5                     1 4430 1Y B5 Zebrafish WIK Standard Roche 454 GS Titanium shotgun library protocol was followed.     AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX Titanium <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP005640         83990641.0 290583.0 4430 1Y B5 0:4 1:285.04   4 285               SRX041592 SRS172442 SRA029829 Stanford University|Quake Stanford University 1 0.20603   0.01554   0.99967   0.00038   37   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-04-07 Adult Adult BCR TCR repertoire Hematopoietic System
68268 68268 SRR099323 SRX041591 SRS172441 SRP005640 PRJNA79973 Zebrafish Development 4432-2WA Other Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.   pubmed:21393572 Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio leading with MID barcode AGCACTGTAG 4430 1Y A4 4430 1Y A4                     1 4430 1Y A4 Zebrafish WIK Standard Roche 454 GS Titanium shotgun library protocol was followed.     AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX Titanium <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP005640         27578630.0 90031.0 4430 1Y A4 0:4 1:302.32   4 302               SRX041591 SRS172441 SRA029829 Stanford University|Quake Stanford University 1 0.12444   0.0197   0.99975   0.00096   37   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-04-07 Adult Adult BCR TCR repertoire Hematopoietic System
68269 68269 SRR099322 SRX041590 SRS172440 SRP005640 PRJNA79973 Zebrafish Development 4432-2WA Other Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.   pubmed:21393572 Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio leading with MID barcode AGACGCACTC 4428 1Y C3 4428 1Y C3                     1 4428 1Y C3 Zebrafish WIK Standard Roche 454 GS Titanium shotgun library protocol was followed.     AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX Titanium <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP005640         62333740.0 194228.0 4428 1Y C3 0:4 1:316.93   4 316               SRX041590 SRS172440 SRA029829 Stanford University|Quake Stanford University 1 0.1865   0.02265   0.99947   0.00049   37   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-04-07 Adult Adult BCR TCR repertoire Hematopoietic System
68270 68270 SRR099321 SRX041589 SRS172439 SRP005640 PRJNA79973 Zebrafish Development 4432-2WA Other Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.   pubmed:21393572 Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio leading with MID barcode ACGCTCGACA 4428 1Y B2 4428 1Y B2                     1 4428 1Y B2 Zebrafish WIK Standard Roche 454 GS Titanium shotgun library protocol was followed.     AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX Titanium <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP005640         104263503.0 333602.0 4428 1Y B2 0:4 1:308.54   4 308               SRX041589 SRS172439 SRA029829 Stanford University|Quake Stanford University 1 0.15679   0.02871   0.99953   0.00044   37   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-04-07 Adult Adult BCR TCR repertoire Hematopoietic System
68271 68271 SRR099320 SRX041588 SRS172438 SRP005640 PRJNA79973 Zebrafish Development 4432-2WA Other Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.   pubmed:21393572 Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio leading with MID barcode ACGAGTGCGT 4428 1Y A1 4428 1Y A1                     1 4428 1Y A1 Zebrafish WIK Standard Roche 454 GS Titanium shotgun library protocol was followed.     AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX Titanium <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP005640         18763476.0 59560.0 4428 1Y A1 0:4 1:311.03   4 311               SRX041588 SRS172438 SRA029829 Stanford University|Quake Stanford University 1 0.13922   0.01452   0.99971   0.00094   160   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-04-07 Adult Adult BCR TCR repertoire Hematopoietic System
68272 68272 SRR099364 SRX041587 SRS172437 SRP005640 PRJNA79973 Zebrafish Development 4432-2WA Other Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.   pubmed:21393572 Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio leading with MID barcode TGATACGTCT 4433 6M D 4433 6M D                     1 4433 6M D Zebrafish WIK Standard Roche 454 GS Titanium shotgun library protocol was followed.     AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX Titanium <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP005640         101345153.0 290438.0 4433 6M D 0:4 1:344.94   4 344               SRX041587 SRS172437 SRA029829 Stanford University|Quake Stanford University 1 0.14815   0.01925   0.99908   0.00202   155   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-04-07 Adult Adult BCR TCR repertoire Hematopoietic System
68273 68273 SRR099363 SRX041586 SRS172436 SRP005640 PRJNA79973 Zebrafish Development 4432-2WA Other Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.   pubmed:21393572 Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio leading with MID barcode TCTCTATGCG 4433 6M C 4433 6M C                     1 4433 6M C Zebrafish WIK Standard Roche 454 GS Titanium shotgun library protocol was followed.     AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX Titanium <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP005640         75770901.0 213529.0 4433 6M C 0:4 1:350.85   4 350               SRX041586 SRS172436 SRA029829 Stanford University|Quake Stanford University 1 0.14445   0.01047   0.99878   0.00299   57   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-04-07 Adult Adult BCR TCR repertoire Hematopoietic System
68274 68274 SRR099362 SRX041585 SRS172435 SRP005640 PRJNA79973 Zebrafish Development 4432-2WA Other Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.   pubmed:21393572 Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio leading with MID barcode TAGTATCAGC 4433 6M B 4433 6M B                     1 4433 6M B Zebrafish WIK Standard Roche 454 GS Titanium shotgun library protocol was followed.     AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX Titanium <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP005640         67192817.0 194503.0 4433 6M B 0:4 1:341.46   4 341               SRX041585 SRS172435 SRA029829 Stanford University|Quake Stanford University 1 0.13467   0.01249   0.99914   0.00222   37   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-04-07 Adult Adult BCR TCR repertoire Hematopoietic System
68275 68275 SRR099361 SRX041584 SRS172434 SRP005640 PRJNA79973 Zebrafish Development 4432-2WA Other Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.   pubmed:21393572 Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio leading with MID barcode CTCGCGTGTC 4433 6M A 4433 6M A                     1 4433 6M A Zebrafish WIK Standard Roche 454 GS Titanium shotgun library protocol was followed.     AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX Titanium <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP005640         72299403.0 207618.0 4433 6M A 0:4 1:344.23   4 344               SRX041584 SRS172434 SRA029829 Stanford University|Quake Stanford University 1 0.1041   0.01046   0.99764   0.00892   64   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-04-07 Adult Adult BCR TCR repertoire Hematopoietic System
68276 68276 SRR099348 SRX041583 SRS172433 SRP005640 PRJNA79973 Zebrafish Development 4432-2WA Other Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.   pubmed:21393572 Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio leading with MID barcode CGTGTCTCTA 4432 6M G 4432 6M G                     1 4432 6M G Zebrafish WIK Standard Roche 454 GS Titanium shotgun library protocol was followed.     AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX Titanium <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP005640         79715586.0 227631.0 4432 6M G 0:4 1:346.20   4 346               SRX041583 SRS172433 SRA029829 Stanford University|Quake Stanford University 1 0.11472   0.01795   0.99898   0.00298   103   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-04-07 Adult Adult BCR TCR repertoire Hematopoietic System
68277 68277 SRR099347 SRX041582 SRS172432 SRP005640 PRJNA79973 Zebrafish Development 4432-2WA Other Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.   pubmed:21393572 Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio leading with MID barcode ATATCGCGAG 4432 6M F 4432 6M F                     1 4432 6M F Zebrafish WIK Standard Roche 454 GS Titanium shotgun library protocol was followed.     AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX Titanium <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP005640         72024740.0 203769.0 4432 6M F 0:4 1:349.46   4 349               SRX041582 SRS172432 SRA029829 Stanford University|Quake Stanford University 1 0.11535   0.01205   0.99855   0.00395   40   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-04-07 Adult Adult BCR TCR repertoire Hematopoietic System
68278 68278 SRR099346 SRX041581 SRS172431 SRP005640 PRJNA79973 Zebrafish Development 4432-2WA Other Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.   pubmed:21393572 Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio leading with MID barcode ATCAGACACG 4432 6M E 4432 6M E                     1 4432 6M E Zebrafish WIK Standard Roche 454 GS Titanium shotgun library protocol was followed.     AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX Titanium <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP005640         65072237.0 190441.0 4432 6M E 0:4 1:337.69   4 337               SRX041581 SRS172431 SRA029829 Stanford University|Quake Stanford University 1 0.11698   0.01584   0.99823   0.00583   65   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-04-07 Adult Adult BCR TCR repertoire Hematopoietic System
68279 68279 SRR099345 SRX041580 SRS172430 SRP005640 PRJNA79973 Zebrafish Development 4432-2WA Other Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.   pubmed:21393572 Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio leading with MID barcode AGCACTGTAG 4432 6M D 4432 6M D                     1 4432 6M D Zebrafish WIK Standard Roche 454 GS Titanium shotgun library protocol was followed.     AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX Titanium <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP005640         74122161.0 211816.0 4432 6M D 0:4 1:345.94   4 345               SRX041580 SRS172430 SRA029829 Stanford University|Quake Stanford University 1 0.10275   0.01376   0.99912   0.00377   57   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-04-07 Adult Adult BCR TCR repertoire Hematopoietic System
68280 68280 SRR099344 SRX041579 SRS172429 SRP005640 PRJNA79973 Zebrafish Development 4432-2WA Other Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.   pubmed:21393572 Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio leading with MID barcode AGACGCACTC 4432 6M C 4432 6M C                     1 4432 6M C Zebrafish WIK Standard Roche 454 GS Titanium shotgun library protocol was followed.     AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX Titanium <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP005640         78171765.0 220585.0 4432 6M C 0:4 1:350.38   4 350               SRX041579 SRS172429 SRA029829 Stanford University|Quake Stanford University 1 0.13401   0.0146   0.99711   0.01012   222   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-04-07 Adult Adult BCR TCR repertoire Hematopoietic System
68281 68281 SRR099343 SRX041578 SRS172428 SRP005640 PRJNA79973 Zebrafish Development 4432-2WA Other Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.   pubmed:21393572 Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio leading with MID barcode ACGCTCGACA 4432 6M B 4432 6M B                     1 4432 6M B Zebrafish WIK Standard Roche 454 GS Titanium shotgun library protocol was followed.     AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX Titanium <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP005640         75262808.0 217309.0 4432 6M B 0:4 1:342.34   4 342               SRX041578 SRS172428 SRA029829 Stanford University|Quake Stanford University 1 0.16193   0.00604   0.99685   0.00701   452   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-04-07 Adult Adult BCR TCR repertoire Hematopoietic System
68282 68282 SRR099342 SRX041577 SRS172427 SRP005640 PRJNA79973 Zebrafish Development 4432-2WA Other Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.   pubmed:21393572 Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio leading with MID barcode ACGAGTGCGT 4432 6M A 4432 6M A                     1 4432 6M A Zebrafish WIK Standard Roche 454 GS Titanium shotgun library protocol was followed.     AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX Titanium <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP005640         66235952.0 184208.0 4432 6M A 0:4 1:355.57   4 355               SRX041577 SRS172427 SRA029829 Stanford University|Quake Stanford University 1 0.10428   0.01655   0.99661   0.01505   183   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-04-07 Adult Adult BCR TCR repertoire Hematopoietic System
68283 68283 SRR099370 SRX041576 SRS172426 SRP005640 PRJNA79973 Zebrafish Development 4432-2WA Other Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.   pubmed:21393572 Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio leading with MID barcode TACTGAGCTA F2 2 F2 2                     1 F2 2 Zebrafish WIK Standard Roche 454 GS Titanium shotgun library protocol was followed.     AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX Titanium <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP005640         64641127.0 184383.0 F2 2 0:4 1:346.58   4 346               SRX041576 SRS172426 SRA029829 Stanford University|Quake Stanford University 1 0.23604   0.01003   0.99959   0.00028   37   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-04-07 Adult Adult BCR TCR repertoire Hematopoietic System
68284 68284 SRR099369 SRX041575 SRS172425 SRP005640 PRJNA79973 Zebrafish Development 4432-2WA Other Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.   pubmed:21393572 Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio leading with MID barcode TGATACGTCT E2 2 E2 2                     1 E2 2 Zebrafish WIK Standard Roche 454 GS Titanium shotgun library protocol was followed.     AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX Titanium <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP005640         66206147.0 181029.0 E2 2 0:4 1:361.72   4 361               SRX041575 SRS172425 SRA029829 Stanford University|Quake Stanford University 1 0.13216   0.00596   0.99949   0.00054   101   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-04-07 Adult Adult BCR TCR repertoire Hematopoietic System
68285 68285 SRR099368 SRX041574 SRS172424 SRP005640 PRJNA79973 Zebrafish Development 4432-2WA Other Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.   pubmed:21393572 Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio leading with MID barcode TGATACGTCT D2 2 D2 2                     1 D2 2 Zebrafish WIK Standard Roche 454 GS Titanium shotgun library protocol was followed.     AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX Titanium <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP005640         190136862.0 562067.0 D2 2 0:4 1:334.28   4 334               SRX041574 SRS172424 SRA029829 Stanford University|Quake Stanford University 1 0.25384   0.03443   0.99933   0.00056   416   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-04-07 Adult Adult BCR TCR repertoire Hematopoietic System
68286 68286 SRR099367 SRX041573 SRS172423 SRP005640 PRJNA79973 Zebrafish Development 4432-2WA Other Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.   pubmed:21393572 Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio leading with MID barcode TAGTATCAGC C2 2 C2 2                     1 C2 2 Zebrafish WIK Standard Roche 454 GS Titanium shotgun library protocol was followed.     AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX Titanium <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP005640         118356460.0 367001.0 C2 2 0:4 1:318.50   4 318               SRX041573 SRS172423 SRA029829 Stanford University|Quake Stanford University 1 0.18882   0.02167   0.99969   9e-05   40   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-04-07 Adult Adult BCR TCR repertoire Hematopoietic System
68287 68287 SRR099366 SRX041572 SRS172422 SRP005640 PRJNA79973 Zebrafish Development 4432-2WA Other Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.   pubmed:21393572 Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio leading with MID barcode CTCGCGTGTC B2 2 B2 2                     1 B2 2 Zebrafish WIK Standard Roche 454 GS Titanium shotgun library protocol was followed.     AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX Titanium <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP005640         24757877.0 69408.0 B2 2 0:4 1:352.70   4 352               SRX041572 SRS172422 SRA029829 Stanford University|Quake Stanford University 1 0.12537   0.01076   0.99975   0.00029   37   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-04-07 Adult Adult BCR TCR repertoire Hematopoietic System
68288 68288 SRR099365 SRX041571 SRS172421 SRP005640 PRJNA79973 Zebrafish Development 4432-2WA Other Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.   pubmed:21393572 Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio leading with MID barcode CGTGTCTCTA A2 2 A2 2                     1 A2 2 Zebrafish WIK Standard Roche 454 GS Titanium shotgun library protocol was followed.     AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX Titanium <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP005640         765824405.0 2575264.0 A2 2 0:4 1:293.38   4 293               SRX041571 SRS172421 SRA029829 Stanford University|Quake Stanford University 1 0.18359   0.017   0.99892   0.00154   152   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-04-07 Adult Adult BCR TCR repertoire Hematopoietic System
68289 68289 SRR099360 SRX041570 SRS172420 SRP005640 PRJNA79973 Zebrafish Development 4432-2WA Other Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.   pubmed:21393572 Immunoglobulin heavy chain cDNA from 3 mpf WIK zebrafish Danio rerio leading with MID barcode CTCGCGTGTC or with no barcode leading with either IgM reverse primer TGCACTGAGACAAACCGAAG or IgZ reverse primer TCAGAGGCCAGACATCCAAT 4433 3MA DT 4433 3MA DT                     1 4433 3MA DT Zebrafish WIK Standard Roche 454 GS Titanium shotgun library protocol was followed.     AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX Titanium <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP005640         56064850.0 187695.0 4433 3MA DT 0:4 1:294.70   4 294               SRX041570 SRS172420 SRA029829 Stanford University|Quake Stanford University 1 0.3144   0.00306   0.99987   0.0   106   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-04-07 Adult Adult BCR TCR repertoire Hematopoietic System
68290 68290 SRR099359 SRX041569 SRS172419 SRP005640 PRJNA79973 Zebrafish Development 4432-2WA Other Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.   pubmed:21393572 Immunoglobulin heavy chain cDNA from 3 mpf WIK zebrafish Danio rerio leading with MID barcode CGTGTCTCTA 4433 3MA C7 4433 3MA C7                     1 4433 3MA C7 Zebrafish WIK Standard Roche 454 GS Titanium shotgun library protocol was followed.     AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX Titanium <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP005640         96179902.0 300329.0 4433 3MA C7 0:4 1:316.25   4 316               SRX041569 SRS172419 SRA029829 Stanford University|Quake Stanford University 1 0.1804   0.01829   0.99953   0.00028   468   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-04-07 Adult Adult BCR TCR repertoire Hematopoietic System
68291 68291 SRR099358 SRX041568 SRS172418 SRP005640 PRJNA79973 Zebrafish Development 4432-2WA Other Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.   pubmed:21393572 Immunoglobulin heavy chain cDNA from 3 mpf WIK zebrafish Danio rerio leading with MID barcode ATATCGCGAG 4433 3MA B6 4433 3MA B6                     1 4433 3MA B6 Zebrafish WIK Standard Roche 454 GS Titanium shotgun library protocol was followed.     AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX Titanium <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP005640         50421822.0 147276.0 4433 3MA B6 0:4 1:338.36   4 338               SRX041568 SRS172418 SRA029829 Stanford University|Quake Stanford University 1 0.19259   0.00589   0.99955   0.00065   99   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-04-07 Adult Adult BCR TCR repertoire Hematopoietic System
68292 68292 SRR099357 SRX041567 SRS172417 SRP005640 PRJNA79973 Zebrafish Development 4432-2WA Other Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.   pubmed:21393572 Immunoglobulin heavy chain cDNA from 3 mpf WIK zebrafish Danio rerio leading with MID barcode ATCAGACACG 4433 3MA A5 4433 3MA A5                     1 4433 3MA A5 Zebrafish WIK Standard Roche 454 GS Titanium shotgun library protocol was followed.     AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX Titanium <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP005640         156064156.0 515822.0 4433 3MA A5 0:4 1:298.55   4 298               SRX041567 SRS172417 SRA029829 Stanford University|Quake Stanford University 1 0.22633   0.01233   0.99971   0.00016   40   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-04-07 Adult Adult BCR TCR repertoire Hematopoietic System
68293 68293 SRR099341 SRX041566 SRS172416 SRP005640 PRJNA79973 Zebrafish Development 4432-2WA Other Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.   pubmed:21393572 Immunoglobulin heavy chain cDNA from 3 mpf WIK zebrafish Danio rerio leading with MID barcode AGCACTGTAG 4432 3MA D4 4432 3MA D4                     1 4432 3MA D4 Zebrafish WIK Standard Roche 454 GS Titanium shotgun library protocol was followed.     AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX Titanium <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP005640         61903651.0 206769.0 4432 3MA D4 0:4 1:295.39   4 295               SRX041566 SRS172416 SRA029829 Stanford University|Quake Stanford University 1 0.23888   0.01136   0.99953   0.00047   58   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-04-07 Adult Adult BCR TCR repertoire Hematopoietic System
68294 68294 SRR099340 SRX041565 SRS172415 SRP005640 PRJNA79973 Zebrafish Development 4432-2WA Other Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.   pubmed:21393572 Immunoglobulin heavy chain cDNA from 3 mpf WIK zebrafish Danio rerio leading with MID barcode AGACGCACTC 4432 3MA C3 4432 3MA C3                     1 4432 3MA C3 Zebrafish WIK Standard Roche 454 GS Titanium shotgun library protocol was followed.     AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX Titanium <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP005640         37914122.0 116980.0 4432 3MA C3 0:4 1:320.11   4 320               SRX041565 SRS172415 SRA029829 Stanford University|Quake Stanford University 1 0.19288   0.0142   0.99955   0.00034   125   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-04-07 Adult Adult BCR TCR repertoire Hematopoietic System
68295 68295 SRR099339 SRX041564 SRS172414 SRP005640 PRJNA79973 Zebrafish Development 4432-2WA Other Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.   pubmed:21393572 Immunoglobulin heavy chain cDNA from 3 mpf WIK zebrafish Danio rerio leading with MID barcode ACGCTCGACA 4432 3MA B2 4432 3MA B2                     1 4432 3MA B2 Zebrafish WIK Standard Roche 454 GS Titanium shotgun library protocol was followed.     AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX Titanium <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP005640         89178437.0 298194.0 4432 3MA B2 0:4 1:295.06   4 295               SRX041564 SRS172414 SRA029829 Stanford University|Quake Stanford University 1 0.21059   0.00985   0.99969   0.00012   107   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-04-07 Adult Adult BCR TCR repertoire Hematopoietic System
68296 68296 SRR099338 SRX041563 SRS172413 SRP005640 PRJNA79973 Zebrafish Development 4432-2WA Other Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.   pubmed:21393572 Immunoglobulin heavy chain cDNA from 3 mpf WIK zebrafish Danio rerio leading with MID barcode ACGAGTGCGT 4432 3MA A1 4432 3MA A1                     1 4432 3MA A1 Zebrafish WIK Standard Roche 454 GS Titanium shotgun library protocol was followed.     AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX Titanium <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP005640         59101536.0 194332.0 4432 3MA A1 0:4 1:300.13   4 300               SRX041563 SRS172413 SRA029829 Stanford University|Quake Stanford University 1 0.26977   0.00958   0.99971   0.00015   69   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-04-07 Adult Adult BCR TCR repertoire Hematopoietic System
68297 68297 SRR099352 SRX041562 SRS172412 SRP005640 PRJNA79973 Zebrafish Development 4432-2WA Other Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.   pubmed:21393572 Immunoglobulin heavy chain cDNA from 1 mpf WIK zebrafish Danio rerio leading with MID barcode CTCGCGTGTC 4433 1MA D8 4433 1MA D8                     1 4433 1MA D8 Zebrafish WIK Standard Roche 454 GS Titanium shotgun library protocol was followed.     AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX Titanium <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP005640         70233197.0 233302.0 4433 1MA D8 0:4 1:297.04   4 297               SRX041562 SRS172412 SRA029829 Stanford University|Quake Stanford University 1 0.14812   0.01088   0.99969   0.10799   36   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-04-07 Juvenile Juvenile BCR TCR repertoire Hematopoietic System
68298 68298 SRR099351 SRX041561 SRS172411 SRP005640 PRJNA79973 Zebrafish Development 4432-2WA Other Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.   pubmed:21393572 Immunoglobulin heavy chain cDNA from 1 mpf WIK zebrafish Danio rerio leading with MID barcode CGTGTCTCTA 4433 1MA C7 4433 1MA C7                     1 4433 1MA C7 Zebrafish WIK Standard Roche 454 GS Titanium shotgun library protocol was followed.     AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX Titanium <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP005640         109094731.0 316792.0 4433 1MA C7 0:4 1:340.37   4 340               SRX041561 SRS172411 SRA029829 Stanford University|Quake Stanford University 1 0.13409   0.01258   0.99955   0.01535   37   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-04-07 Juvenile Juvenile BCR TCR repertoire Hematopoietic System
68299 68299 SRR099350 SRX041560 SRS172410 SRP005640 PRJNA79973 Zebrafish Development 4432-2WA Other Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.   pubmed:21393572 Immunoglobulin heavy chain cDNA from 1 mpf WIK zebrafish Danio rerio leading with MID barcode ATATCGCGAG 4433 1MA B6 4433 1MA B6                     1 4433 1MA B6 Zebrafish WIK Standard Roche 454 GS Titanium shotgun library protocol was followed.     AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX Titanium <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP005640         110436791.0 353780.0 4433 1MA B6 0:4 1:308.16   4 308               SRX041560 SRS172410 SRA029829 Stanford University|Quake Stanford University 1 0.28629   0.01104   0.99945   0.0273   107   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-04-07 Juvenile Juvenile BCR TCR repertoire Hematopoietic System
68300 68300 SRR099349 SRX041559 SRS172409 SRP005640 PRJNA79973 Zebrafish Development 4432-2WA Other Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.   pubmed:21393572 Immunoglobulin heavy chain cDNA from 1 mpf WIK zebrafish Danio rerio leading with MID barcode ATCAGACACG 4433 1MA A5 4433 1MA A5                     1 4433 1MA A5 Zebrafish WIK Standard Roche 454 GS Titanium shotgun library protocol was followed.     AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX Titanium <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP005640         107336405.0 335816.0 4433 1MA A5 0:4 1:315.63   4 315               SRX041559 SRS172409 SRA029829 Stanford University|Quake Stanford University 1 0.16203   0.01649   0.99935   0.00111   37   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-04-07 Juvenile Juvenile BCR TCR repertoire Hematopoietic System
68301 68301 SRR099329 SRX041558 SRS172408 SRP005640 PRJNA79973 Zebrafish Development 4432-2WA Other Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.   pubmed:21393572 Immunoglobulin heavy chain cDNA from 1 mpf WIK zebrafish Danio rerio leading with MID barcode AGCACTGTAG 4432 1MA D4 4432 1MA D4                     1 4432 1MA D4 Zebrafish WIK Standard Roche 454 GS Titanium shotgun library protocol was followed.     AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX Titanium <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP005640         94113837.0 297721.0 4432 1MA D4 0:4 1:312.11   4 312               SRX041558 SRS172408 SRA029829 Stanford University|Quake Stanford University 1 0.16753   0.02013   0.99979   3e-05   37   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-04-07 Juvenile Juvenile BCR TCR repertoire Hematopoietic System
68302 68302 SRR099328 SRX041557 SRS172407 SRP005640 PRJNA79973 Zebrafish Development 4432-2WA Other Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.   pubmed:21393572 Immunoglobulin heavy chain cDNA from 1 mpf WIK zebrafish Danio rerio leading with MID barcode AGACGCACTC 4432 1MA C3 4432 1MA C3                     1 4432 1MA C3 Zebrafish WIK Standard Roche 454 GS Titanium shotgun library protocol was followed.     AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX Titanium <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP005640         77768777.0 243405.0 4432 1MA C3 0:4 1:315.50   4 315               SRX041557 SRS172407 SRA029829 Stanford University|Quake Stanford University 1 0.16711   0.01816   0.99979   0.0   37   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-04-07 Juvenile Juvenile BCR TCR repertoire Hematopoietic System
68303 68303 SRR099327 SRX041556 SRS172406 SRP005640 PRJNA79973 Zebrafish Development 4432-2WA Other Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.   pubmed:21393572 Immunoglobulin heavy chain cDNA from 1 mpf WIK zebrafish Danio rerio leading with MID barcode ACGCTCGACA 4432 1MA B2 4432 1MA B2                     1 4432 1MA B2 Zebrafish WIK Standard Roche 454 GS Titanium shotgun library protocol was followed.     AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX Titanium <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP005640         120450312.0 390504.0 4432 1MA B2 0:4 1:304.45   4 304               SRX041556 SRS172406 SRA029829 Stanford University|Quake Stanford University 1 0.18757   0.01811   0.99977   0.00024   59   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-04-07 Juvenile Juvenile BCR TCR repertoire Hematopoietic System
68304 68304 SRR099326 SRX041555 SRS172405 SRP005640 PRJNA79973 Zebrafish Development 4432-2WA Other Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.   pubmed:21393572 Immunoglobulin heavy chain cDNA from 1 mpf WIK zebrafish Danio rerio leading with MID barcode ACGAGTGCGT 4432 1MA A1 4432 1MA A1                     1 4432 1MA A1 Zebrafish WIK Standard Roche 454 GS Titanium shotgun library protocol was followed.     AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX Titanium <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP005640         145945736.0 457354.0 4432 1MA A1 0:4 1:315.11   4 315               SRX041555 SRS172405 SRA029829 Stanford University|Quake Stanford University 1 0.17607   0.02473   0.99957   0.00036   40   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-04-07 Juvenile Juvenile BCR TCR repertoire Hematopoietic System
68305 68305 SRR099356 SRX041554 SRS172404 SRP005640 PRJNA79973 Zebrafish Development 4432-2WA Other Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.   pubmed:21393572 Immunoglobulin heavy chain cDNA from 2 wpf WIK zebrafish Danio rerio leading with MID barcode CTCGCGTGTC 4433 2WD 4433 2WD                     1 4433 2WD Zebrafish WIK Standard Roche 454 GS Titanium shotgun library protocol was followed.     AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX Titanium <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP005640     4433-2WDqual.tar.gz fastq 52787937.0 159839.0 4433 2WD 0:4 1:326.26   4 326               SRX041554 SRS172404 SRA029829 Stanford University|Quake Stanford University 1 0.11986   0.01724   0.99805   0.01122   313   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-04-08 Larval Larval BCR TCR repertoire Hematopoietic System
68306 68306 SRR099355 SRX041553 SRS172403 SRP005640 PRJNA79973 Zebrafish Development 4432-2WA Other Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.   pubmed:21393572 Immunoglobulin heavy chain cDNA from 2 wpf WIK zebrafish Danio rerio leading with MID barcode CGTGTCTCTA 4433 2WC 4433 2WC                     1 4433 2WC Zebrafish WIK Standard Roche 454 GS Titanium shotgun library protocol was followed.     AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX Titanium <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP005640         65896148.0 208053.0 4433 2WC 0:4 1:312.73   4 312               SRX041553 SRS172403 SRA029829 Stanford University|Quake Stanford University 1 0.14138   0.02922   0.99855   0.00348   315   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-04-07 Larval Larval BCR TCR repertoire Hematopoietic System
68307 68307 SRR099354 SRX041552 SRS172402 SRP005640 PRJNA79973 Zebrafish Development 4432-2WA Other Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.   pubmed:21393572 Immunoglobulin heavy chain cDNA from 2 wpf WIK zebrafish Danio rerio leading with MID barcode ATATCGCGAG 4433 2WB 4433 2WB                     1 4433 2WB Zebrafish WIK Standard Roche 454 GS Titanium shotgun library protocol was followed.     AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX Titanium <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP005640         63865512.0 209572.0 4433 2WB 0:4 1:300.74   4 300               SRX041552 SRS172402 SRA029829 Stanford University|Quake Stanford University 1 0.16321   0.03058   0.99926   0.00107   226   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-04-07 Larval Larval BCR TCR repertoire Hematopoietic System
68308 68308 SRR099353 SRX041551 SRS172401 SRP005640 PRJNA79973 Zebrafish Development 4432-2WA Other Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.   pubmed:21393572 Immunoglobulin heavy chain cDNA from 2 wpf WIK zebrafish Danio rerio leading with MID barcode ATCAGACACG 4433 2WA 4433 2WA                     1 4433 2WA Zebrafish WIK Standard Roche 454 GS Titanium shotgun library protocol was followed.     AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX Titanium <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP005640         41165356.0 128188.0 4433 2WA 0:4 1:317.13   4 317               SRX041551 SRS172401 SRA029829 Stanford University|Quake Stanford University 1 0.16018   0.02829   0.99847   0.02343   452   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-04-07 Larval Larval BCR TCR repertoire Hematopoietic System
68309 68309 SRR099337 SRX041550 SRS172400 SRP005640 PRJNA79973 Zebrafish Development 4432-2WA Other Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.   pubmed:21393572 Immunoglobulin heavy chain cDNA from 2 wpf WIK zebrafish Danio rerio leading with MID barcode AGCACTGTAG 4432 2WD 4432 2WD                     1 4432 2WD Zebrafish WIK Standard Roche 454 GS Titanium shotgun library protocol was followed.     AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX Titanium <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP005640         34384017.0 109589.0 4432 2WD 0:4 1:309.75   4 309               SRX041550 SRS172400 SRA029829 Stanford University|Quake Stanford University 1 0.1533   0.02541   0.99896   0.00428   254   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-04-07 Larval Larval BCR TCR repertoire Hematopoietic System
68310 68310 SRR099336 SRX041549 SRS172399 SRP005640 PRJNA79973 Zebrafish Development 4432-2WA Other Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.   pubmed:21393572 Immunoglobulin heavy chain cDNA from 2 wpf WIK zebrafish Danio rerio leading with MID barcode AGACGCACTC 4432 2WC 4432 2WC                     1 4432 2WC Zebrafish WIK Standard Roche 454 GS Titanium shotgun library protocol was followed.     AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX Titanium <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP005640         71040021.0 233525.0 4432 2WC 0:4 1:300.21   4 300               SRX041549 SRS172399 SRA029829 Stanford University|Quake Stanford University 1 0.16787   0.03447   0.9978   0.01646   360   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-04-07 Larval Larval BCR TCR repertoire Hematopoietic System
68311 68311 SRR099335 SRX041548 SRS172345 SRP005640 PRJNA79973 Zebrafish Development 4432-2WA Other Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.   pubmed:21393572 Immunoglobulin heavy chain cDNA from 2 wpf WIK zebrafish Danio rerio leading with MID barcode ACGCTCGACA 4432 2WB 4432 2WB                     1 4432 2WB Zebrafish WIK Standard Roche 454 GS Titanium shotgun library protocol was followed.     AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX Titanium <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP005640         98153866.0 302470.0 4432 2WB 0:4 1:320.51   4 320               SRX041548 SRS172345 SRA029829 Stanford University|Quake Stanford University 1 0.15713   0.047   0.99774   0.02379   137   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-04-07 Larval Larval BCR TCR repertoire Hematopoietic System
68312 68312 SRR099334 SRX041547 SRS172117 SRP005640 PRJNA79973 Zebrafish Development 4432-2WA Other Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.   pubmed:21393572 Immunoglobulin heavy chain cDNA from 2 wpf WIK zebrafish Danio rerio leading with MID barcode ACGAGTGCGT 4432 2WA 4432 2WA                     1 4432 2WA Zebrafish WIK Standard Roche 454 GS Titanium shotgun library protocol was followed.     AMPLICON TRANSCRIPTOMIC PCR SINGLE LS454 454 GS FLX Titanium <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP005640         91079672.0 319475.0 4432 2WA 0:4 1:281.09   4 281               SRX041547 SRS172117 SRA029829 Stanford University|Quake Stanford University 1 0.25569   0.04646   0.99902   0.00137   88   B   usable mapping rate legacy early unknown random_priming unknown bulk other_seq 454   United States 2011-04-07 Larval Larval BCR TCR repertoire Hematopoietic System

Advanced export

JSON shape: default, array, newline-delimited

CSV options: 

CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;