RNAquarium Metadata Server
Institute Website Terms of Use Privacy Policy

run_metadata

104 rows where experiment.library_layout = "SINGLE" and tissue_curation_coarse = "Cancer or Tumor"

✎ View and edit SQL

This data as json, CSV (advanced)

devstage_curation_coarse 4

devstage_curation 4

technology 2

experiment.platform 2

experiment.library_strategy 2

experiment.library_selection 2

tissue_curation_coarse 1

  • Cancer or Tumor · 104 ✖

tissue_curation 1

experiment.library_source 1

experiment.library_layout 1

  • SINGLE · 104 ✖
Link rowid ▼ run.accession experiment.accession sample.accession study.accession bioproject study.title study.alias study.type study.abstract study.attributes study.PMIDs sample.description sample.title sample.alias sample.centername sample.attributes GEOsample.title GEOsample.dataprocessing GEOsample.source GEOsample.treatmentprotocol GEOsample.extractprotocol GEOsample.growthprotocol GEOsample.characteristics GEOsample.accession experiment.title experiment.alias experiment.library_name experiment.design_description experiment.library_construction_protocol experiment.attributes experiment.library_strategy experiment.library_source experiment.library_selection experiment.library_layout experiment.platform experiment.instrument_model experiment.spot_descriptor experiment.study_ref run.title run.attributes run.filename run.semantic_name run.total_bases run.total_spots run.alias run.read_lengths run.base_counts run.r1_length run.r2_length run.r3_length run.r4_length run.Acount run.Ccount run.Gcount run.Tcount run.Ncount run.experiment run.pool_member submission.accession submission.srasource submission.bioprojectsource seqdetective.n_mates seqdetective.mapping_rate.mate1 seqdetective.mapping_rate.mate2 seqdetective.nofeature_rate.mate1 seqdetective.nofeature_rate.mate2 seqdetective.sparsity.mate1 seqdetective.sparsity.mate2 seqdetective.pos_strand_rate.mate1 seqdetective.pos_strand_rate.mate2 seqdetective.readlen.mate1 seqdetective.readlen.mate2 seqdetective.judgement.mate1 seqdetective.judgement.mate2 seqdetective.judgement.reason platform_family instrument_generation read_bias selection_class prep_kit sc_or_bulk tech_class technology tech_variant submission.bioprojectsource.country earliest_date devstage_curation devstage_curation_coarse tissue_curation tissue_curation_coarse
41564 41564 SRR5044691 SRX2367699 SRS1813797 SRP093723 PRJNA354577 RNA seq of zebrafish melanoma cells post metastatic dissemination GSE90143 Transcriptome Analysis We report how the zebrafish melanoma cell line ZMEL1 changes post intravascular injection into 2dpf zebrafish embryos as compared to the cells growing in vitro. Overall design: Examination of ZMEL1 cells in vitro versus 21 days in vivo in the zebrafish   pubmed:28181494   ZMEL1 METASTATIC REP 4 GSM2399713   tissue:ZMEL1 cells in vivo|cell type:ZMEL1|tissue type:melanoma ZMEL1 METASTATIC REP 4 GSNAP alignment to Av9 zebrafish reference genome Read counts extracted with HTSeq Differential expression with DeSeq2 Zebrafish genes converted to human orthologs using DIOPT Genome build: Zv9 Supplementary files format and content: XLSX sheet with normalized read counts output from HTSeq ZMEL1 cells in vivo n/a Cells were FACS sorted and total RNA isolated with Zymo kits Illumina TruSeq in vitro: DMEM/10% FCS/1X glutamax/28.5C in vivo: growth in the zebrafish from 2 21dpf cell type:ZMEL1|tissue type:melanoma GSM2399713 GSM2399713: ZMEL1 METASTATIC REP 4; Danio rerio; RNA Seq GSM2399713   1 Cells were FACS sorted and total RNA isolated with Zymo kits Illumina TruSeq GEO Accession:GSM2399713 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2500   SRP093723     DISSEMINATED-A1-ISK-GFP-pos_CTTGTA_AHBENJADXX_L001_001.R1.fastq fastq 1021688450.0 20433769.0 GSM2399713 r1 0:50 A:263964434;C:226020906;G:246160135;T:285440788;N:102187 50       263964434 226020906 246160135 285440788 102187 SRX2367699 SRS1813797 SRA497524 GEO White Lab, Cancer Biology & Genetics, Memorial Sloan Kettering Cancer Center 1 0.86173   0.35054   0.78305   0.63081   50   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified trueseq bulk unknown unknown   United States 2016-11-22 Larval Larval Cancer or Tumor Cancer or Tumor
41565 41565 SRR5044692 SRX2367699 SRS1813797 SRP093723 PRJNA354577 RNA seq of zebrafish melanoma cells post metastatic dissemination GSE90143 Transcriptome Analysis We report how the zebrafish melanoma cell line ZMEL1 changes post intravascular injection into 2dpf zebrafish embryos as compared to the cells growing in vitro. Overall design: Examination of ZMEL1 cells in vitro versus 21 days in vivo in the zebrafish   pubmed:28181494   ZMEL1 METASTATIC REP 4 GSM2399713   tissue:ZMEL1 cells in vivo|cell type:ZMEL1|tissue type:melanoma ZMEL1 METASTATIC REP 4 GSNAP alignment to Av9 zebrafish reference genome Read counts extracted with HTSeq Differential expression with DeSeq2 Zebrafish genes converted to human orthologs using DIOPT Genome build: Zv9 Supplementary files format and content: XLSX sheet with normalized read counts output from HTSeq ZMEL1 cells in vivo n/a Cells were FACS sorted and total RNA isolated with Zymo kits Illumina TruSeq in vitro: DMEM/10% FCS/1X glutamax/28.5C in vivo: growth in the zebrafish from 2 21dpf cell type:ZMEL1|tissue type:melanoma GSM2399713 GSM2399713: ZMEL1 METASTATIC REP 4; Danio rerio; RNA Seq GSM2399713   1 Cells were FACS sorted and total RNA isolated with Zymo kits Illumina TruSeq GEO Accession:GSM2399713 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2500   SRP093723     DISSEMINATED-A1-ISK-GFP-pos_CTTGTA_AHBENJADXX_L002_001.R1.fastq fastq 948274550.0 18965491.0 GSM2399713 r2 0:50 A:244756056;C:209496504;G:228095978;T:264427260;N:1498752 50       244756056 209496504 228095978 264427260 1498752 SRX2367699 SRS1813797 SRA497524 GEO White Lab, Cancer Biology & Genetics, Memorial Sloan Kettering Cancer Center 1 0.86249   0.35012   0.78147   0.61412   50   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified trueseq bulk unknown unknown   United States 2016-11-22 Larval Larval Cancer or Tumor Cancer or Tumor
41566 41566 SRR5044689 SRX2367698 SRS1813796 SRP093723 PRJNA354577 RNA seq of zebrafish melanoma cells post metastatic dissemination GSE90143 Transcriptome Analysis We report how the zebrafish melanoma cell line ZMEL1 changes post intravascular injection into 2dpf zebrafish embryos as compared to the cells growing in vitro. Overall design: Examination of ZMEL1 cells in vitro versus 21 days in vivo in the zebrafish   pubmed:28181494   ZMEL1 METASTATIC REP 3 GSM2399712   tissue:ZMEL1 cells in vivo|cell type:ZMEL1|tissue type:melanoma ZMEL1 METASTATIC REP 3 GSNAP alignment to Av9 zebrafish reference genome Read counts extracted with HTSeq Differential expression with DeSeq2 Zebrafish genes converted to human orthologs using DIOPT Genome build: Zv9 Supplementary files format and content: XLSX sheet with normalized read counts output from HTSeq ZMEL1 cells in vivo n/a Cells were FACS sorted and total RNA isolated with Zymo kits Illumina TruSeq in vitro: DMEM/10% FCS/1X glutamax/28.5C in vivo: growth in the zebrafish from 2 21dpf cell type:ZMEL1|tissue type:melanoma GSM2399712 GSM2399712: ZMEL1 METASTATIC REP 3; Danio rerio; RNA Seq GSM2399712   1 Cells were FACS sorted and total RNA isolated with Zymo kits Illumina TruSeq GEO Accession:GSM2399712 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2500   SRP093723     DISSEMINATED-4-GFP-POS_AGTTCC_AHBENJADXX_L001_001.R1.fastq fastq 547347950.0 10946959.0 GSM2399712 r1 0:50 A:142532772;C:118021475;G:130457816;T:156280877;N:55010 50       142532772 118021475 130457816 156280877 55010 SRX2367698 SRS1813796 SRA497524 GEO White Lab, Cancer Biology & Genetics, Memorial Sloan Kettering Cancer Center 1 0.82238   0.37848   0.81511   0.68704   50   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified trueseq bulk unknown unknown   United States 2016-11-22 Larval Larval Cancer or Tumor Cancer or Tumor
41567 41567 SRR5044690 SRX2367698 SRS1813796 SRP093723 PRJNA354577 RNA seq of zebrafish melanoma cells post metastatic dissemination GSE90143 Transcriptome Analysis We report how the zebrafish melanoma cell line ZMEL1 changes post intravascular injection into 2dpf zebrafish embryos as compared to the cells growing in vitro. Overall design: Examination of ZMEL1 cells in vitro versus 21 days in vivo in the zebrafish   pubmed:28181494   ZMEL1 METASTATIC REP 3 GSM2399712   tissue:ZMEL1 cells in vivo|cell type:ZMEL1|tissue type:melanoma ZMEL1 METASTATIC REP 3 GSNAP alignment to Av9 zebrafish reference genome Read counts extracted with HTSeq Differential expression with DeSeq2 Zebrafish genes converted to human orthologs using DIOPT Genome build: Zv9 Supplementary files format and content: XLSX sheet with normalized read counts output from HTSeq ZMEL1 cells in vivo n/a Cells were FACS sorted and total RNA isolated with Zymo kits Illumina TruSeq in vitro: DMEM/10% FCS/1X glutamax/28.5C in vivo: growth in the zebrafish from 2 21dpf cell type:ZMEL1|tissue type:melanoma GSM2399712 GSM2399712: ZMEL1 METASTATIC REP 3; Danio rerio; RNA Seq GSM2399712   1 Cells were FACS sorted and total RNA isolated with Zymo kits Illumina TruSeq GEO Accession:GSM2399712 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2500   SRP093723     DISSEMINATED-4-GFP-POS_AGTTCC_AHBENJADXX_L002_001.R1.fastq fastq 507753450.0 10155069.0 GSM2399712 r2 0:50 A:132079203;C:109301536;G:120877231;T:144665731;N:829749 50       132079203 109301536 120877231 144665731 829749 SRX2367698 SRS1813796 SRA497524 GEO White Lab, Cancer Biology & Genetics, Memorial Sloan Kettering Cancer Center 1 0.8144   0.37493   0.81682   0.68224   50   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified trueseq bulk unknown unknown   United States 2016-11-22 Larval Larval Cancer or Tumor Cancer or Tumor
41568 41568 SRR5044687 SRX2367697 SRS1813798 SRP093723 PRJNA354577 RNA seq of zebrafish melanoma cells post metastatic dissemination GSE90143 Transcriptome Analysis We report how the zebrafish melanoma cell line ZMEL1 changes post intravascular injection into 2dpf zebrafish embryos as compared to the cells growing in vitro. Overall design: Examination of ZMEL1 cells in vitro versus 21 days in vivo in the zebrafish   pubmed:28181494   ZMEL1 METASTATIC REP 2 GSM2399711   tissue:ZMEL1 cells in vivo|cell type:ZMEL1|tissue type:melanoma ZMEL1 METASTATIC REP 2 GSNAP alignment to Av9 zebrafish reference genome Read counts extracted with HTSeq Differential expression with DeSeq2 Zebrafish genes converted to human orthologs using DIOPT Genome build: Zv9 Supplementary files format and content: XLSX sheet with normalized read counts output from HTSeq ZMEL1 cells in vivo n/a Cells were FACS sorted and total RNA isolated with Zymo kits Illumina TruSeq in vitro: DMEM/10% FCS/1X glutamax/28.5C in vivo: growth in the zebrafish from 2 21dpf cell type:ZMEL1|tissue type:melanoma GSM2399711 GSM2399711: ZMEL1 METASTATIC REP 2; Danio rerio; RNA Seq GSM2399711   1 Cells were FACS sorted and total RNA isolated with Zymo kits Illumina TruSeq GEO Accession:GSM2399711 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2500   SRP093723     DISSEMINATED-3-GFP-POS_AGTCAA_AHBENJADXX_L001_001.R1.fastq fastq 487099600.0 9741992.0 GSM2399711 r1 0:50 A:128774562;C:103935704;G:114312614;T:140027704;N:49016 50       128774562 103935704 114312614 140027704 49016 SRX2367697 SRS1813798 SRA497524 GEO White Lab, Cancer Biology & Genetics, Memorial Sloan Kettering Cancer Center 1 0.83241   0.38945   0.77759   0.63782   50   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified trueseq bulk unknown unknown   United States 2016-11-22 Larval Larval Cancer or Tumor Cancer or Tumor
41569 41569 SRR5044688 SRX2367697 SRS1813798 SRP093723 PRJNA354577 RNA seq of zebrafish melanoma cells post metastatic dissemination GSE90143 Transcriptome Analysis We report how the zebrafish melanoma cell line ZMEL1 changes post intravascular injection into 2dpf zebrafish embryos as compared to the cells growing in vitro. Overall design: Examination of ZMEL1 cells in vitro versus 21 days in vivo in the zebrafish   pubmed:28181494   ZMEL1 METASTATIC REP 2 GSM2399711   tissue:ZMEL1 cells in vivo|cell type:ZMEL1|tissue type:melanoma ZMEL1 METASTATIC REP 2 GSNAP alignment to Av9 zebrafish reference genome Read counts extracted with HTSeq Differential expression with DeSeq2 Zebrafish genes converted to human orthologs using DIOPT Genome build: Zv9 Supplementary files format and content: XLSX sheet with normalized read counts output from HTSeq ZMEL1 cells in vivo n/a Cells were FACS sorted and total RNA isolated with Zymo kits Illumina TruSeq in vitro: DMEM/10% FCS/1X glutamax/28.5C in vivo: growth in the zebrafish from 2 21dpf cell type:ZMEL1|tissue type:melanoma GSM2399711 GSM2399711: ZMEL1 METASTATIC REP 2; Danio rerio; RNA Seq GSM2399711   1 Cells were FACS sorted and total RNA isolated with Zymo kits Illumina TruSeq GEO Accession:GSM2399711 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2500   SRP093723     DISSEMINATED-3-GFP-POS_AGTCAA_AHBENJADXX_L002_001.R1.fastq fastq 452003900.0 9040078.0 GSM2399711 r2 0:50 A:119365829;C:96270497;G:105927958;T:129699772;N:739844 50       119365829 96270497 105927958 129699772 739844 SRX2367697 SRS1813798 SRA497524 GEO White Lab, Cancer Biology & Genetics, Memorial Sloan Kettering Cancer Center 1 0.8334   0.39284   0.78033   0.63687   50   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified trueseq bulk unknown unknown   United States 2016-11-22 Larval Larval Cancer or Tumor Cancer or Tumor
41571 41571 SRR5044684 SRX2367695 SRS1813794 SRP093723 PRJNA354577 RNA seq of zebrafish melanoma cells post metastatic dissemination GSE90143 Transcriptome Analysis We report how the zebrafish melanoma cell line ZMEL1 changes post intravascular injection into 2dpf zebrafish embryos as compared to the cells growing in vitro. Overall design: Examination of ZMEL1 cells in vitro versus 21 days in vivo in the zebrafish   pubmed:28181494   ZMEL1 IN VITRO REP 2 GSM2399709   tissue:ZMEL1 cells in vitro|cell type:ZMEL1|tissue type:melanoma ZMEL1 IN VITRO REP 2 GSNAP alignment to Av9 zebrafish reference genome Read counts extracted with HTSeq Differential expression with DeSeq2 Zebrafish genes converted to human orthologs using DIOPT Genome build: Zv9 Supplementary files format and content: XLSX sheet with normalized read counts output from HTSeq ZMEL1 cells in vitro n/a Cells were FACS sorted and total RNA isolated with Zymo kits Illumina TruSeq in vitro: DMEM/10% FCS/1X glutamax/28.5C in vivo: growth in the zebrafish from 2 21dpf cell type:ZMEL1|tissue type:melanoma GSM2399709 GSM2399709: ZMEL1 IN VITRO REP 2; Danio rerio; RNA Seq GSM2399709   1 Cells were FACS sorted and total RNA isolated with Zymo kits Illumina TruSeq GEO Accession:GSM2399709 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2500   SRP093723     ZMEL3-ISK_CGATGT_AHBENJADXX_L001_001.R1.fastq fastq 769908950.0 15398179.0 GSM2399709 r1 0:50 A:182817342;C:191713397;G:197387080;T:197914424;N:76707 50       182817342 191713397 197387080 197914424 76707 SRX2367695 SRS1813794 SRA497524 GEO White Lab, Cancer Biology & Genetics, Memorial Sloan Kettering Cancer Center 1 0.90333   0.27932   0.80894   0.6691   50   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified trueseq bulk unknown unknown   United States 2016-11-22 Larval Larval Cancer or Tumor Cancer or Tumor
41572 41572 SRR5044685 SRX2367695 SRS1813794 SRP093723 PRJNA354577 RNA seq of zebrafish melanoma cells post metastatic dissemination GSE90143 Transcriptome Analysis We report how the zebrafish melanoma cell line ZMEL1 changes post intravascular injection into 2dpf zebrafish embryos as compared to the cells growing in vitro. Overall design: Examination of ZMEL1 cells in vitro versus 21 days in vivo in the zebrafish   pubmed:28181494   ZMEL1 IN VITRO REP 2 GSM2399709   tissue:ZMEL1 cells in vitro|cell type:ZMEL1|tissue type:melanoma ZMEL1 IN VITRO REP 2 GSNAP alignment to Av9 zebrafish reference genome Read counts extracted with HTSeq Differential expression with DeSeq2 Zebrafish genes converted to human orthologs using DIOPT Genome build: Zv9 Supplementary files format and content: XLSX sheet with normalized read counts output from HTSeq ZMEL1 cells in vitro n/a Cells were FACS sorted and total RNA isolated with Zymo kits Illumina TruSeq in vitro: DMEM/10% FCS/1X glutamax/28.5C in vivo: growth in the zebrafish from 2 21dpf cell type:ZMEL1|tissue type:melanoma GSM2399709 GSM2399709: ZMEL1 IN VITRO REP 2; Danio rerio; RNA Seq GSM2399709   1 Cells were FACS sorted and total RNA isolated with Zymo kits Illumina TruSeq GEO Accession:GSM2399709 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2500   SRP093723     ZMEL3-ISK_CGATGT_AHBENJADXX_L002_001.R1.fastq fastq 713052900.0 14261058.0 GSM2399709 r2 0:50 A:169193359;C:177235371;G:182562897;T:182889589;N:1171684 50       169193359 177235371 182562897 182889589 1171684 SRX2367695 SRS1813794 SRA497524 GEO White Lab, Cancer Biology & Genetics, Memorial Sloan Kettering Cancer Center 1 0.90483   0.2787   0.80892   0.66955   50   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified trueseq bulk unknown unknown   United States 2016-11-22 Larval Larval Cancer or Tumor Cancer or Tumor
41573 41573 SRR5044682 SRX2367694 SRS1813793 SRP093723 PRJNA354577 RNA seq of zebrafish melanoma cells post metastatic dissemination GSE90143 Transcriptome Analysis We report how the zebrafish melanoma cell line ZMEL1 changes post intravascular injection into 2dpf zebrafish embryos as compared to the cells growing in vitro. Overall design: Examination of ZMEL1 cells in vitro versus 21 days in vivo in the zebrafish   pubmed:28181494   ZMEL1 IN VITRO REP 1 GSM2399708   tissue:ZMEL1 cells in vitro|cell type:ZMEL1|tissue type:melanoma ZMEL1 IN VITRO REP 1 GSNAP alignment to Av9 zebrafish reference genome Read counts extracted with HTSeq Differential expression with DeSeq2 Zebrafish genes converted to human orthologs using DIOPT Genome build: Zv9 Supplementary files format and content: XLSX sheet with normalized read counts output from HTSeq ZMEL1 cells in vitro n/a Cells were FACS sorted and total RNA isolated with Zymo kits Illumina TruSeq in vitro: DMEM/10% FCS/1X glutamax/28.5C in vivo: growth in the zebrafish from 2 21dpf cell type:ZMEL1|tissue type:melanoma GSM2399708 GSM2399708: ZMEL1 IN VITRO REP 1; Danio rerio; RNA Seq GSM2399708   1 Cells were FACS sorted and total RNA isolated with Zymo kits Illumina TruSeq GEO Accession:GSM2399708 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2500   SRP093723     ZMEL1_ATCACG_AHBENJADXX_L001_001.R1.fastq fastq 480071700.0 9601434.0 GSM2399708 r1 0:50 A:126381285;C:102596587;G:111718527;T:139327539;N:47762 50       126381285 102596587 111718527 139327539 47762 SRX2367694 SRS1813793 SRA497524 GEO White Lab, Cancer Biology & Genetics, Memorial Sloan Kettering Cancer Center 1 0.86224   0.32994   0.78106   0.62148   50   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified trueseq bulk unknown unknown   United States 2016-11-22 Larval Larval Cancer or Tumor Cancer or Tumor
41574 41574 SRR5044683 SRX2367694 SRS1813793 SRP093723 PRJNA354577 RNA seq of zebrafish melanoma cells post metastatic dissemination GSE90143 Transcriptome Analysis We report how the zebrafish melanoma cell line ZMEL1 changes post intravascular injection into 2dpf zebrafish embryos as compared to the cells growing in vitro. Overall design: Examination of ZMEL1 cells in vitro versus 21 days in vivo in the zebrafish   pubmed:28181494   ZMEL1 IN VITRO REP 1 GSM2399708   tissue:ZMEL1 cells in vitro|cell type:ZMEL1|tissue type:melanoma ZMEL1 IN VITRO REP 1 GSNAP alignment to Av9 zebrafish reference genome Read counts extracted with HTSeq Differential expression with DeSeq2 Zebrafish genes converted to human orthologs using DIOPT Genome build: Zv9 Supplementary files format and content: XLSX sheet with normalized read counts output from HTSeq ZMEL1 cells in vitro n/a Cells were FACS sorted and total RNA isolated with Zymo kits Illumina TruSeq in vitro: DMEM/10% FCS/1X glutamax/28.5C in vivo: growth in the zebrafish from 2 21dpf cell type:ZMEL1|tissue type:melanoma GSM2399708 GSM2399708: ZMEL1 IN VITRO REP 1; Danio rerio; RNA Seq GSM2399708   1 Cells were FACS sorted and total RNA isolated with Zymo kits Illumina TruSeq GEO Accession:GSM2399708 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2500   SRP093723     ZMEL1_ATCACG_AHBENJADXX_L002_001.R1.fastq fastq 444225800.0 8884516.0 GSM2399708 r2 0:50 A:116866564;C:94744486;G:103253213;T:128645533;N:716004 50       116866564 94744486 103253213 128645533 716004 SRX2367694 SRS1813793 SRA497524 GEO White Lab, Cancer Biology & Genetics, Memorial Sloan Kettering Cancer Center 1 0.86139   0.32876   0.78259   0.62694   50   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified trueseq bulk unknown unknown   United States 2016-11-22 Larval Larval Cancer or Tumor Cancer or Tumor
41616 41616 SRR5099113 SRX2415891 SRS1853479 SRP094947 PRJNA357051 Development of zebrafish medulloblastoma model by TALENs induced somatic gene inactivation methods GSE92260 Transcriptome Analysis we developed the zebrafish cancer models by TALENs mediated somatic inactivation of tumor suppressor genes rb1 induced brain tumors in tp53 mutation background. Using RNA sequencing analysis in addition to histopathology and immunohistochemistry we demonstrated that the brain tumors induced by rb1 gene somatic inactivation have a molecular feature of MB like PNETs Overall design: QuantSeq three prime mRNA sequencing with whole brain tissue wild type WT zebrafish and tumors induced by rb1 TALENs injected zebrafish at xxx mpf   pubmed:28903419   FFPE 2 GSM2424730   source name:tumor 2 induced by rb1 TALENs|strain:p53M214K|tissue:tumor tissues 2 induced by rb1 TALENs|developmental stage:5 mpf FFPE 2 Illumina Casava1.8 software used for basecalling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequenceusing fastx trimmer then mapped to danRer10 whole genome using Bowtie2 Read count extraction and nomalization were performed using edgeR. Genome build: danRer10 Supplementary files format and content: FFPE 1.txt and FFPE 2.txt report quantile normalized abundance measurements. Supplementary files format and content: WT.txt report quantile normalized abundance measurements. Column WT1 reports quantile normalized abundance measurements post quantile normalization had done between WT and FFPE 1. Column WT2 reports quantile normalized abundance measurements post quantile normalization had done between WT and FFPE 2. tumor 2 induced by rb1 TALENs   RNA was harvested using Trizol reagent Invitrogen. 500 ng of total RNA was used for the construction of sequencing libraries. RNA libraries were prepared for sequencing using LEXOGEN Quant Seq Library Prep Kit Cat#001.24 standard protocols.   strain:p53M214K|tissue:tumor tissues 2 induced by rb1 TALENs|developmental stage:5 mpf GSM2424730 GSM2424730: FFPE 2; Danio rerio; RNA Seq GSM2424730   1 RNA was harvested using Trizol reagent Invitrogen. 500 ng of total RNA was used for the construction of sequencing libraries. RNA libraries were prepared for sequencing using LEXOGEN Quant Seq Library Prep Kit Cat#001.24 standard protocols. GEO Accession:GSM2424730 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP094947     FFPE-2_fastq.gz fastq 900420050.0 8915050.0 GSM2424730 r1 0:101 A:404381931;C:201118712;G:149335807;T:145550067;N:33533 101       404381931 201118712 149335807 145550067 33533 SRX2415891 SRS1853479 SRA502460 GEO Research Institute, National Cancer Center 1 0.03639   0.02825   0.9978   0.55688   101   B   usable mapping rate illumina nextseq 3prime cdna_unspecified lexogen bulk unknown unknown   Unknown 2016-12-12 Adult Adult Cancer or Tumor Cancer or Tumor
41617 41617 SRR5099112 SRX2415890 SRS1853478 SRP094947 PRJNA357051 Development of zebrafish medulloblastoma model by TALENs induced somatic gene inactivation methods GSE92260 Transcriptome Analysis we developed the zebrafish cancer models by TALENs mediated somatic inactivation of tumor suppressor genes rb1 induced brain tumors in tp53 mutation background. Using RNA sequencing analysis in addition to histopathology and immunohistochemistry we demonstrated that the brain tumors induced by rb1 gene somatic inactivation have a molecular feature of MB like PNETs Overall design: QuantSeq three prime mRNA sequencing with whole brain tissue wild type WT zebrafish and tumors induced by rb1 TALENs injected zebrafish at xxx mpf   pubmed:28903419   FFPE 1 GSM2424729   source name:tumor 1 induced by rb1 TALENs|strain:p53M214K|tissue:tumor tissues 1 induced by rb1 TALENs|developmental stage:5 mpf FFPE 1 Illumina Casava1.8 software used for basecalling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequenceusing fastx trimmer then mapped to danRer10 whole genome using Bowtie2 Read count extraction and nomalization were performed using edgeR. Genome build: danRer10 Supplementary files format and content: FFPE 1.txt and FFPE 2.txt report quantile normalized abundance measurements. Supplementary files format and content: WT.txt report quantile normalized abundance measurements. Column WT1 reports quantile normalized abundance measurements post quantile normalization had done between WT and FFPE 1. Column WT2 reports quantile normalized abundance measurements post quantile normalization had done between WT and FFPE 2. tumor 1 induced by rb1 TALENs   RNA was harvested using Trizol reagent Invitrogen. 500 ng of total RNA was used for the construction of sequencing libraries. RNA libraries were prepared for sequencing using LEXOGEN Quant Seq Library Prep Kit Cat#001.24 standard protocols.   strain:p53M214K|tissue:tumor tissues 1 induced by rb1 TALENs|developmental stage:5 mpf GSM2424729 GSM2424729: FFPE 1; Danio rerio; RNA Seq GSM2424729   1 RNA was harvested using Trizol reagent Invitrogen. 500 ng of total RNA was used for the construction of sequencing libraries. RNA libraries were prepared for sequencing using LEXOGEN Quant Seq Library Prep Kit Cat#001.24 standard protocols. GEO Accession:GSM2424729 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP094947     FFPE-1_fastq.gz fastq 985654556.0 9758956.0 GSM2424729 r1 0:101 A:642158389;C:109642019;G:103170689;T:130633868;N:49591 101       642158389 109642019 103170689 130633868 49591 SRX2415890 SRS1853478 SRA502460 GEO Research Institute, National Cancer Center 1 0.71847   0.59813   0.9376   0.57167   101   B   usable mapping rate illumina nextseq 3prime cdna_unspecified lexogen bulk unknown unknown   Unknown 2016-12-12 Adult Adult Cancer or Tumor Cancer or Tumor
41811 41811 SRR5196075 SRX2511746 SRS1935439 SRP097636 PRJNA362941 Transcriptomic analyses of Kras induced zebrafish liver cancer GSE93965 Transcriptome Analysis The krasV12 induced tumor progression was conducted on 100 transgenic fishes maintained in water containing 2µM mifepristone. Gross morphological and histological analyses were weekly performed on 15 randomly selected fishes to monitor tumor development. These analyses showed robust development of hepatocellular adenoma within 4 weeks of induction. Observation of tumor development and staging of tumorigenesis was conducted as described. For tumor regression the group of 15 fishes with HCC was transferred to mifepristone free water. Histological examination revealed tumor shrinkage showing extensive scarring at the peripheral and focal tumor regions. Notably complete tumor regression with scarred fibrosis of the former tumor tissue was observed post 4 weeks of mifepristone withdrawal. Overall design: Liver tumors from mifipristone induced transgenic fishes with hepatocellular adenoma and carcinoma livers of transgenic fishes post mifepristone withdrawal and normal livers from non induced and induced transgenic fishes were pooled separately and collected for RNA isolation and sequencing.   pubmed:31827597   CarcinomaM GSM2465779   source name:Hepatocellular carcinoma of transgenic fishes post mifeprist1 withdrawal|tissue:Hepatocellular carcinoma|genotype:Tgfabp10:LexPR LexA:EGFP; cryB:mCherry NLS Cre; fabp10:loxP mCherry loxP EGFP krasV12 line CarcinomaM The SOLiD generated RNA Seq reads was in 27 bp length and an initial filtering process was taken to remove any non desirable contamination sequences. The reads were mapped to the zebrafish NCBI RefSeq Reference Sequence mRNA database with a criterion of maximum 2 nucleotide mismatches. The expression levels of mapped transcripts were normalized into transcript per whole amount of mapped transcript. Genome build: danRer7 Supplementary files format and content: tab delimited text files include TPM values for each Sample Hepatocellular carcinoma of transgenic fishes post mifepristone withdrawal One mpf transgenic fish was treated at 2uM mifepriston to induce liver tumorigenesis. For tumor regression the group of 15 fishes with HCC was transferred to mifepristone free water. mRNA was purified using Dynabeads OligodT EcoP Invitrogen Resultant cDNA was digested by NlaIII and EcoP15I to result in a 27 nucleotides cDNA tag between the two sequencing adapters. 3′ RNA SAGE serial analysis of gene expression sequencing was performed on ABI SOLiD platform by Mission Biotech Taiwan according to manufacturer’s protocol and 10–23 million reads were generated from each sample   tissue:Hepatocellular carcinoma|genotype:Tgfabp10:LexPR LexA:EGFP; cryB:mCherry NLS Cre; fabp10:loxP mCherry loxP EGFP krasV12 line GSM2465779 GSM2465779: CarcinomaM; Danio rerio; RNA Seq GSM2465779   1 mRNA was purified using Dynabeads OligodT EcoP Invitrogen Resultant cDNA was digested by NlaIII and EcoP15I to result in a 27 nucleotides cDNA tag between the two sequencing adapters. 3′ RNA SAGE serial analysis of gene expression sequencing was performed on ABI SOLiD platform by Mission Biotech Taiwan according to manufacturer’s protocol and 10–23 million reads were generated from each sample GEO Accession:GSM2465779 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ABI_SOLID AB SOLiD System 3.0   SRP097636     solid_SAGE_6T2_F3.csfasta.gz solid_SAGE_6T2_F3_QV.qual.gz SOLiD_native SOLiD_native 818910190.0 23397434.0 GSM2465779 r1 0:35 0:347259734;1:164743259;2:162029194;3:130508344;.:14369659 35                 SRX2511746 SRS1935439 SRA530985 GEO The Biomedical Center 1 0.03756   0.00615   0.99928   0.91338   35   B   usable mapping rate legacy early unknown poly_a unknown bulk unknown unknown   Unknown 2017-01-23 Undetermined Adult Cancer or Tumor Cancer or Tumor
41812 41812 SRR5196074 SRX2511745 SRS1935438 SRP097636 PRJNA362941 Transcriptomic analyses of Kras induced zebrafish liver cancer GSE93965 Transcriptome Analysis The krasV12 induced tumor progression was conducted on 100 transgenic fishes maintained in water containing 2µM mifepristone. Gross morphological and histological analyses were weekly performed on 15 randomly selected fishes to monitor tumor development. These analyses showed robust development of hepatocellular adenoma within 4 weeks of induction. Observation of tumor development and staging of tumorigenesis was conducted as described. For tumor regression the group of 15 fishes with HCC was transferred to mifepristone free water. Histological examination revealed tumor shrinkage showing extensive scarring at the peripheral and focal tumor regions. Notably complete tumor regression with scarred fibrosis of the former tumor tissue was observed post 4 weeks of mifepristone withdrawal. Overall design: Liver tumors from mifipristone induced transgenic fishes with hepatocellular adenoma and carcinoma livers of transgenic fishes post mifepristone withdrawal and normal livers from non induced and induced transgenic fishes were pooled separately and collected for RNA isolation and sequencing.   pubmed:31827597   Carcinoma GSM2465778   source name:Hepatocellular carcinoma of transgenic fishes|tissue:Hepatocellular carcinoma|genotype:Tgfabp10:LexPR LexA:EGFP; cryB:mCherry NLS Cre; fabp10:loxP mCherry loxP EGFP krasV12 line Carcinoma The SOLiD generated RNA Seq reads was in 27 bp length and an initial filtering process was taken to remove any non desirable contamination sequences. The reads were mapped to the zebrafish NCBI RefSeq Reference Sequence mRNA database with a criterion of maximum 2 nucleotide mismatches. The expression levels of mapped transcripts were normalized into transcript per whole amount of mapped transcript. Genome build: danRer7 Supplementary files format and content: tab delimited text files include TPM values for each Sample Hepatocellular carcinoma of transgenic fishes One mpf transgenic fish was treated at 2uM mifepriston to induce liver tumorigenesis. For tumor regression the group of 15 fishes with HCC was transferred to mifepristone free water. mRNA was purified using Dynabeads OligodT EcoP Invitrogen Resultant cDNA was digested by NlaIII and EcoP15I to result in a 27 nucleotides cDNA tag between the two sequencing adapters. 3′ RNA SAGE serial analysis of gene expression sequencing was performed on ABI SOLiD platform by Mission Biotech Taiwan according to manufacturer’s protocol and 10–23 million reads were generated from each sample   tissue:Hepatocellular carcinoma|genotype:Tgfabp10:LexPR LexA:EGFP; cryB:mCherry NLS Cre; fabp10:loxP mCherry loxP EGFP krasV12 line GSM2465778 GSM2465778: Carcinoma; Danio rerio; RNA Seq GSM2465778   1 mRNA was purified using Dynabeads OligodT EcoP Invitrogen Resultant cDNA was digested by NlaIII and EcoP15I to result in a 27 nucleotides cDNA tag between the two sequencing adapters. 3′ RNA SAGE serial analysis of gene expression sequencing was performed on ABI SOLiD platform by Mission Biotech Taiwan according to manufacturer’s protocol and 10–23 million reads were generated from each sample GEO Accession:GSM2465778 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ABI_SOLID AB SOLiD System 3.0   SRP097636     solid_SAGE_6T1_F3.csfasta.gz solid_SAGE_6T1_F3_QV.qual.gz SOLiD_native SOLiD_native 761241005.0 21749743.0 GSM2465778 r1 0:35 0:306840116;1:164725874;2:160786359;3:126370697;.:2517959 35                 SRX2511745 SRS1935438 SRA530985 GEO The Biomedical Center 1 0.0543   0.00668   0.9988   0.95092   35   B   usable mapping rate legacy early unknown poly_a unknown bulk unknown unknown   Unknown 2017-01-23 Undetermined Adult Cancer or Tumor Cancer or Tumor
50848 50848 SRR8312803 SRX5126180 SRS4139302 SRP173302 PRJNA509471 The side population enriches for leukemia propagating cell activity and Wnt pathway expression in zebrafish acute lymphoblastic leukemia. GSE123665 Transcriptome Analysis Cancer stem cells have been strongly linked to resistance and relapse in many malignancies. However purifying them from within the bulk tumor has been challenging so their precise genetic and functional characteristics are not well defined. The side population assay exploits the ability of some cells to efflux Hoechst dye via ABC transporters. Stem cells have increased expression of these transporters and this assay has been shown to enrich for stem cells in various tissues and cancers. This study identifies the side population within a zebrafish model of acute lymphoblastic leukemia and correlates the frequency of side population cells with the frequency of leukemia stem cells more precisely referred to as leukemia propagating cells within our transplantation model. In addition the side population within the leukemia evolves with serial transplantation increasing in tandem with leukemia propagating cell frequency over subsequent generations. Sorted side population cells from these tumors are enriched for leukemia propagating cells and have enhanced engraftment compared to sorted non side population cells when transplanted into syngeneic recipients. RNA sequencing analysis of sorted side population cells compared to non side population cells identified a shared expression profile within the side population and pathway analysis yielded Wnt signaling as the most overrepresented. Gene set enrichment analysis showed that stem cell differentiation and canonical Wnt signaling were significantly upregulated in the side population. Overall these results demonstrate that the side population in zebrafish acute lymphoblastic leukemia significantly enriches for leukemia propagating cells and identifies the Wnt pathway as a likely genetic driver of leukemia stem cell fate. Overall design: mRNA expression comparison between sorted side population and non side population in 3 zebrafish ALL tumors   pubmed:30630989   nonSP 1314 GSM3509262   source name:ALL tumor|strain:CG2|tissue:ALL nonSP 1314 Illumina Casava1.7 software used for basecalling. All RNA seq reads were used to align to the genome assembly GRCz10 using STAR v2.5.1b with default configurations. Transcripts were assembled from the aligned reads using Cufflinks v2.2.1 with the default configurations to generate FPKM Fragments Per Kilobase Million tables. Using 4 as the fold change cutoff DEGs Differentially expressed genes were detected using both Tuxedo suite FPKM based method and featureCounts DESeq v1.30.0 edgeR v3.20.7 read count based method with default configurations. Genes detected by at least more than one method were collected to create a high confidence DEG lists. Genome build: GRCz10 Supplementary files format and content: Count tables were generated using featureCount v1.28.1 based on Ensembl annotation GRCz10. ALL tumor None Tumors were removed sorted by FACS and RNA was harvested using Trizol reagent. RNA libraries were prepared for sequencing using standard Illumina protocols None strain:CG2|tissue:ALL GSM3509262 GSM3509262: nonSP 1314; Danio rerio; RNA Seq GSM3509262   1 Tumors were removed sorted by FACS and RNA was harvested using Trizol reagent. RNA libraries were prepared for sequencing using standard Illumina protocols GEO Accession:GSM3509262 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 4000   SRP173302         1102240750.0 22044815.0 GSM3509262 r1 0:50 1:0 A:238366338;C:290902481;G:270336209;T:302466123;N:169599 50 0     238366338 290902481 270336209 302466123 169599 SRX5126180 SRS4139302 SRA822847 GEO Bioinformatics Core, Biological Sciences Division, The University of Chicago 1 0.95733   0.05326   0.82195   0.45391   50   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United States 2018-12-11 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
50849 50849 SRR8312804 SRX5126180 SRS4139302 SRP173302 PRJNA509471 The side population enriches for leukemia propagating cell activity and Wnt pathway expression in zebrafish acute lymphoblastic leukemia. GSE123665 Transcriptome Analysis Cancer stem cells have been strongly linked to resistance and relapse in many malignancies. However purifying them from within the bulk tumor has been challenging so their precise genetic and functional characteristics are not well defined. The side population assay exploits the ability of some cells to efflux Hoechst dye via ABC transporters. Stem cells have increased expression of these transporters and this assay has been shown to enrich for stem cells in various tissues and cancers. This study identifies the side population within a zebrafish model of acute lymphoblastic leukemia and correlates the frequency of side population cells with the frequency of leukemia stem cells more precisely referred to as leukemia propagating cells within our transplantation model. In addition the side population within the leukemia evolves with serial transplantation increasing in tandem with leukemia propagating cell frequency over subsequent generations. Sorted side population cells from these tumors are enriched for leukemia propagating cells and have enhanced engraftment compared to sorted non side population cells when transplanted into syngeneic recipients. RNA sequencing analysis of sorted side population cells compared to non side population cells identified a shared expression profile within the side population and pathway analysis yielded Wnt signaling as the most overrepresented. Gene set enrichment analysis showed that stem cell differentiation and canonical Wnt signaling were significantly upregulated in the side population. Overall these results demonstrate that the side population in zebrafish acute lymphoblastic leukemia significantly enriches for leukemia propagating cells and identifies the Wnt pathway as a likely genetic driver of leukemia stem cell fate. Overall design: mRNA expression comparison between sorted side population and non side population in 3 zebrafish ALL tumors   pubmed:30630989   nonSP 1314 GSM3509262   source name:ALL tumor|strain:CG2|tissue:ALL nonSP 1314 Illumina Casava1.7 software used for basecalling. All RNA seq reads were used to align to the genome assembly GRCz10 using STAR v2.5.1b with default configurations. Transcripts were assembled from the aligned reads using Cufflinks v2.2.1 with the default configurations to generate FPKM Fragments Per Kilobase Million tables. Using 4 as the fold change cutoff DEGs Differentially expressed genes were detected using both Tuxedo suite FPKM based method and featureCounts DESeq v1.30.0 edgeR v3.20.7 read count based method with default configurations. Genes detected by at least more than one method were collected to create a high confidence DEG lists. Genome build: GRCz10 Supplementary files format and content: Count tables were generated using featureCount v1.28.1 based on Ensembl annotation GRCz10. ALL tumor None Tumors were removed sorted by FACS and RNA was harvested using Trizol reagent. RNA libraries were prepared for sequencing using standard Illumina protocols None strain:CG2|tissue:ALL GSM3509262 GSM3509262: nonSP 1314; Danio rerio; RNA Seq GSM3509262   1 Tumors were removed sorted by FACS and RNA was harvested using Trizol reagent. RNA libraries were prepared for sequencing using standard Illumina protocols GEO Accession:GSM3509262 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 4000   SRP173302         2100323600.0 42006472.0 GSM3509262 r2 0:50 1:0 A:454665602;C:553824333;G:514968464;T:576182722;N:682479 50 0     454665602 553824333 514968464 576182722 682479 SRX5126180 SRS4139302 SRA822847 GEO Bioinformatics Core, Biological Sciences Division, The University of Chicago 1 0.95581   0.05304   0.82246   0.44598   50   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United States 2018-12-11 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
50850 50850 SRR8312801 SRX5126179 SRS4139301 SRP173302 PRJNA509471 The side population enriches for leukemia propagating cell activity and Wnt pathway expression in zebrafish acute lymphoblastic leukemia. GSE123665 Transcriptome Analysis Cancer stem cells have been strongly linked to resistance and relapse in many malignancies. However purifying them from within the bulk tumor has been challenging so their precise genetic and functional characteristics are not well defined. The side population assay exploits the ability of some cells to efflux Hoechst dye via ABC transporters. Stem cells have increased expression of these transporters and this assay has been shown to enrich for stem cells in various tissues and cancers. This study identifies the side population within a zebrafish model of acute lymphoblastic leukemia and correlates the frequency of side population cells with the frequency of leukemia stem cells more precisely referred to as leukemia propagating cells within our transplantation model. In addition the side population within the leukemia evolves with serial transplantation increasing in tandem with leukemia propagating cell frequency over subsequent generations. Sorted side population cells from these tumors are enriched for leukemia propagating cells and have enhanced engraftment compared to sorted non side population cells when transplanted into syngeneic recipients. RNA sequencing analysis of sorted side population cells compared to non side population cells identified a shared expression profile within the side population and pathway analysis yielded Wnt signaling as the most overrepresented. Gene set enrichment analysis showed that stem cell differentiation and canonical Wnt signaling were significantly upregulated in the side population. Overall these results demonstrate that the side population in zebrafish acute lymphoblastic leukemia significantly enriches for leukemia propagating cells and identifies the Wnt pathway as a likely genetic driver of leukemia stem cell fate. Overall design: mRNA expression comparison between sorted side population and non side population in 3 zebrafish ALL tumors   pubmed:30630989   SP 1314 GSM3509261   source name:ALL tumor|strain:CG2|tissue:ALL SP 1314 Illumina Casava1.7 software used for basecalling. All RNA seq reads were used to align to the genome assembly GRCz10 using STAR v2.5.1b with default configurations. Transcripts were assembled from the aligned reads using Cufflinks v2.2.1 with the default configurations to generate FPKM Fragments Per Kilobase Million tables. Using 4 as the fold change cutoff DEGs Differentially expressed genes were detected using both Tuxedo suite FPKM based method and featureCounts DESeq v1.30.0 edgeR v3.20.7 read count based method with default configurations. Genes detected by at least more than one method were collected to create a high confidence DEG lists. Genome build: GRCz10 Supplementary files format and content: Count tables were generated using featureCount v1.28.1 based on Ensembl annotation GRCz10. ALL tumor None Tumors were removed sorted by FACS and RNA was harvested using Trizol reagent. RNA libraries were prepared for sequencing using standard Illumina protocols None strain:CG2|tissue:ALL GSM3509261 GSM3509261: SP 1314; Danio rerio; RNA Seq GSM3509261   1 Tumors were removed sorted by FACS and RNA was harvested using Trizol reagent. RNA libraries were prepared for sequencing using standard Illumina protocols GEO Accession:GSM3509261 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 4000   SRP173302         1795016300.0 35900326.0 GSM3509261 r1 0:50 1:0 A:414364764;C:453952517;G:425127792;T:501295946;N:275281 50 0     414364764 453952517 425127792 501295946 275281 SRX5126179 SRS4139301 SRA822847 GEO Bioinformatics Core, Biological Sciences Division, The University of Chicago 1 0.94054   0.1034   0.77199   0.50665   50   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United States 2018-12-11 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
50851 50851 SRR8312802 SRX5126179 SRS4139301 SRP173302 PRJNA509471 The side population enriches for leukemia propagating cell activity and Wnt pathway expression in zebrafish acute lymphoblastic leukemia. GSE123665 Transcriptome Analysis Cancer stem cells have been strongly linked to resistance and relapse in many malignancies. However purifying them from within the bulk tumor has been challenging so their precise genetic and functional characteristics are not well defined. The side population assay exploits the ability of some cells to efflux Hoechst dye via ABC transporters. Stem cells have increased expression of these transporters and this assay has been shown to enrich for stem cells in various tissues and cancers. This study identifies the side population within a zebrafish model of acute lymphoblastic leukemia and correlates the frequency of side population cells with the frequency of leukemia stem cells more precisely referred to as leukemia propagating cells within our transplantation model. In addition the side population within the leukemia evolves with serial transplantation increasing in tandem with leukemia propagating cell frequency over subsequent generations. Sorted side population cells from these tumors are enriched for leukemia propagating cells and have enhanced engraftment compared to sorted non side population cells when transplanted into syngeneic recipients. RNA sequencing analysis of sorted side population cells compared to non side population cells identified a shared expression profile within the side population and pathway analysis yielded Wnt signaling as the most overrepresented. Gene set enrichment analysis showed that stem cell differentiation and canonical Wnt signaling were significantly upregulated in the side population. Overall these results demonstrate that the side population in zebrafish acute lymphoblastic leukemia significantly enriches for leukemia propagating cells and identifies the Wnt pathway as a likely genetic driver of leukemia stem cell fate. Overall design: mRNA expression comparison between sorted side population and non side population in 3 zebrafish ALL tumors   pubmed:30630989   SP 1314 GSM3509261   source name:ALL tumor|strain:CG2|tissue:ALL SP 1314 Illumina Casava1.7 software used for basecalling. All RNA seq reads were used to align to the genome assembly GRCz10 using STAR v2.5.1b with default configurations. Transcripts were assembled from the aligned reads using Cufflinks v2.2.1 with the default configurations to generate FPKM Fragments Per Kilobase Million tables. Using 4 as the fold change cutoff DEGs Differentially expressed genes were detected using both Tuxedo suite FPKM based method and featureCounts DESeq v1.30.0 edgeR v3.20.7 read count based method with default configurations. Genes detected by at least more than one method were collected to create a high confidence DEG lists. Genome build: GRCz10 Supplementary files format and content: Count tables were generated using featureCount v1.28.1 based on Ensembl annotation GRCz10. ALL tumor None Tumors were removed sorted by FACS and RNA was harvested using Trizol reagent. RNA libraries were prepared for sequencing using standard Illumina protocols None strain:CG2|tissue:ALL GSM3509261 GSM3509261: SP 1314; Danio rerio; RNA Seq GSM3509261   1 Tumors were removed sorted by FACS and RNA was harvested using Trizol reagent. RNA libraries were prepared for sequencing using standard Illumina protocols GEO Accession:GSM3509261 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 4000   SRP173302         1643807200.0 32876144.0 GSM3509261 r2 0:50 1:0 A:379875320;C:415331594;G:389155351;T:458912143;N:532792 50 0     379875320 415331594 389155351 458912143 532792 SRX5126179 SRS4139301 SRA822847 GEO Bioinformatics Core, Biological Sciences Division, The University of Chicago 1 0.93812   0.1016   0.77281   0.50853   50   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United States 2018-12-11 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
50852 50852 SRR8312799 SRX5126178 SRS4139300 SRP173302 PRJNA509471 The side population enriches for leukemia propagating cell activity and Wnt pathway expression in zebrafish acute lymphoblastic leukemia. GSE123665 Transcriptome Analysis Cancer stem cells have been strongly linked to resistance and relapse in many malignancies. However purifying them from within the bulk tumor has been challenging so their precise genetic and functional characteristics are not well defined. The side population assay exploits the ability of some cells to efflux Hoechst dye via ABC transporters. Stem cells have increased expression of these transporters and this assay has been shown to enrich for stem cells in various tissues and cancers. This study identifies the side population within a zebrafish model of acute lymphoblastic leukemia and correlates the frequency of side population cells with the frequency of leukemia stem cells more precisely referred to as leukemia propagating cells within our transplantation model. In addition the side population within the leukemia evolves with serial transplantation increasing in tandem with leukemia propagating cell frequency over subsequent generations. Sorted side population cells from these tumors are enriched for leukemia propagating cells and have enhanced engraftment compared to sorted non side population cells when transplanted into syngeneic recipients. RNA sequencing analysis of sorted side population cells compared to non side population cells identified a shared expression profile within the side population and pathway analysis yielded Wnt signaling as the most overrepresented. Gene set enrichment analysis showed that stem cell differentiation and canonical Wnt signaling were significantly upregulated in the side population. Overall these results demonstrate that the side population in zebrafish acute lymphoblastic leukemia significantly enriches for leukemia propagating cells and identifies the Wnt pathway as a likely genetic driver of leukemia stem cell fate. Overall design: mRNA expression comparison between sorted side population and non side population in 3 zebrafish ALL tumors   pubmed:30630989   nonSP 1279 GSM3509260   source name:ALL tumor|strain:CG2|tissue:ALL nonSP 1279 Illumina Casava1.7 software used for basecalling. All RNA seq reads were used to align to the genome assembly GRCz10 using STAR v2.5.1b with default configurations. Transcripts were assembled from the aligned reads using Cufflinks v2.2.1 with the default configurations to generate FPKM Fragments Per Kilobase Million tables. Using 4 as the fold change cutoff DEGs Differentially expressed genes were detected using both Tuxedo suite FPKM based method and featureCounts DESeq v1.30.0 edgeR v3.20.7 read count based method with default configurations. Genes detected by at least more than one method were collected to create a high confidence DEG lists. Genome build: GRCz10 Supplementary files format and content: Count tables were generated using featureCount v1.28.1 based on Ensembl annotation GRCz10. ALL tumor None Tumors were removed sorted by FACS and RNA was harvested using Trizol reagent. RNA libraries were prepared for sequencing using standard Illumina protocols None strain:CG2|tissue:ALL GSM3509260 GSM3509260: nonSP 1279; Danio rerio; RNA Seq GSM3509260   1 Tumors were removed sorted by FACS and RNA was harvested using Trizol reagent. RNA libraries were prepared for sequencing using standard Illumina protocols GEO Accession:GSM3509260 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 4000   SRP173302         971515350.0 19430307.0 GSM3509260 r1 0:50 1:0 A:209882045;C:255304153;G:238689373;T:267489989;N:149790 50 0     209882045 255304153 238689373 267489989 149790 SRX5126178 SRS4139300 SRA822847 GEO Bioinformatics Core, Biological Sciences Division, The University of Chicago 1 0.96223   0.08865   0.85437   0.45664   50   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United States 2018-12-11 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
50853 50853 SRR8312800 SRX5126178 SRS4139300 SRP173302 PRJNA509471 The side population enriches for leukemia propagating cell activity and Wnt pathway expression in zebrafish acute lymphoblastic leukemia. GSE123665 Transcriptome Analysis Cancer stem cells have been strongly linked to resistance and relapse in many malignancies. However purifying them from within the bulk tumor has been challenging so their precise genetic and functional characteristics are not well defined. The side population assay exploits the ability of some cells to efflux Hoechst dye via ABC transporters. Stem cells have increased expression of these transporters and this assay has been shown to enrich for stem cells in various tissues and cancers. This study identifies the side population within a zebrafish model of acute lymphoblastic leukemia and correlates the frequency of side population cells with the frequency of leukemia stem cells more precisely referred to as leukemia propagating cells within our transplantation model. In addition the side population within the leukemia evolves with serial transplantation increasing in tandem with leukemia propagating cell frequency over subsequent generations. Sorted side population cells from these tumors are enriched for leukemia propagating cells and have enhanced engraftment compared to sorted non side population cells when transplanted into syngeneic recipients. RNA sequencing analysis of sorted side population cells compared to non side population cells identified a shared expression profile within the side population and pathway analysis yielded Wnt signaling as the most overrepresented. Gene set enrichment analysis showed that stem cell differentiation and canonical Wnt signaling were significantly upregulated in the side population. Overall these results demonstrate that the side population in zebrafish acute lymphoblastic leukemia significantly enriches for leukemia propagating cells and identifies the Wnt pathway as a likely genetic driver of leukemia stem cell fate. Overall design: mRNA expression comparison between sorted side population and non side population in 3 zebrafish ALL tumors   pubmed:30630989   nonSP 1279 GSM3509260   source name:ALL tumor|strain:CG2|tissue:ALL nonSP 1279 Illumina Casava1.7 software used for basecalling. All RNA seq reads were used to align to the genome assembly GRCz10 using STAR v2.5.1b with default configurations. Transcripts were assembled from the aligned reads using Cufflinks v2.2.1 with the default configurations to generate FPKM Fragments Per Kilobase Million tables. Using 4 as the fold change cutoff DEGs Differentially expressed genes were detected using both Tuxedo suite FPKM based method and featureCounts DESeq v1.30.0 edgeR v3.20.7 read count based method with default configurations. Genes detected by at least more than one method were collected to create a high confidence DEG lists. Genome build: GRCz10 Supplementary files format and content: Count tables were generated using featureCount v1.28.1 based on Ensembl annotation GRCz10. ALL tumor None Tumors were removed sorted by FACS and RNA was harvested using Trizol reagent. RNA libraries were prepared for sequencing using standard Illumina protocols None strain:CG2|tissue:ALL GSM3509260 GSM3509260: nonSP 1279; Danio rerio; RNA Seq GSM3509260   1 Tumors were removed sorted by FACS and RNA was harvested using Trizol reagent. RNA libraries were prepared for sequencing using standard Illumina protocols GEO Accession:GSM3509260 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 4000   SRP173302         859048800.0 17180976.0 GSM3509260 r2 0:50 1:0 A:185797914;C:225529235;G:211061558;T:236378727;N:281366 50 0     185797914 225529235 211061558 236378727 281366 SRX5126178 SRS4139300 SRA822847 GEO Bioinformatics Core, Biological Sciences Division, The University of Chicago 1 0.96055   0.08804   0.85283   0.48896   50   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United States 2018-12-11 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
50854 50854 SRR8312797 SRX5126177 SRS4139299 SRP173302 PRJNA509471 The side population enriches for leukemia propagating cell activity and Wnt pathway expression in zebrafish acute lymphoblastic leukemia. GSE123665 Transcriptome Analysis Cancer stem cells have been strongly linked to resistance and relapse in many malignancies. However purifying them from within the bulk tumor has been challenging so their precise genetic and functional characteristics are not well defined. The side population assay exploits the ability of some cells to efflux Hoechst dye via ABC transporters. Stem cells have increased expression of these transporters and this assay has been shown to enrich for stem cells in various tissues and cancers. This study identifies the side population within a zebrafish model of acute lymphoblastic leukemia and correlates the frequency of side population cells with the frequency of leukemia stem cells more precisely referred to as leukemia propagating cells within our transplantation model. In addition the side population within the leukemia evolves with serial transplantation increasing in tandem with leukemia propagating cell frequency over subsequent generations. Sorted side population cells from these tumors are enriched for leukemia propagating cells and have enhanced engraftment compared to sorted non side population cells when transplanted into syngeneic recipients. RNA sequencing analysis of sorted side population cells compared to non side population cells identified a shared expression profile within the side population and pathway analysis yielded Wnt signaling as the most overrepresented. Gene set enrichment analysis showed that stem cell differentiation and canonical Wnt signaling were significantly upregulated in the side population. Overall these results demonstrate that the side population in zebrafish acute lymphoblastic leukemia significantly enriches for leukemia propagating cells and identifies the Wnt pathway as a likely genetic driver of leukemia stem cell fate. Overall design: mRNA expression comparison between sorted side population and non side population in 3 zebrafish ALL tumors   pubmed:30630989   SP 1279 GSM3509259   source name:ALL tumor|strain:CG2|tissue:ALL SP 1279 Illumina Casava1.7 software used for basecalling. All RNA seq reads were used to align to the genome assembly GRCz10 using STAR v2.5.1b with default configurations. Transcripts were assembled from the aligned reads using Cufflinks v2.2.1 with the default configurations to generate FPKM Fragments Per Kilobase Million tables. Using 4 as the fold change cutoff DEGs Differentially expressed genes were detected using both Tuxedo suite FPKM based method and featureCounts DESeq v1.30.0 edgeR v3.20.7 read count based method with default configurations. Genes detected by at least more than one method were collected to create a high confidence DEG lists. Genome build: GRCz10 Supplementary files format and content: Count tables were generated using featureCount v1.28.1 based on Ensembl annotation GRCz10. ALL tumor None Tumors were removed sorted by FACS and RNA was harvested using Trizol reagent. RNA libraries were prepared for sequencing using standard Illumina protocols None strain:CG2|tissue:ALL GSM3509259 GSM3509259: SP 1279; Danio rerio; RNA Seq GSM3509259   1 Tumors were removed sorted by FACS and RNA was harvested using Trizol reagent. RNA libraries were prepared for sequencing using standard Illumina protocols GEO Accession:GSM3509259 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 4000   SRP173302         843819050.0 16876381.0 GSM3509259 r1 0:50 1:0 A:199287616;C:210295815;G:195583208;T:238522867;N:129544 50 0     199287616 210295815 195583208 238522867 129544 SRX5126177 SRS4139299 SRA822847 GEO Bioinformatics Core, Biological Sciences Division, The University of Chicago 1 0.9391   0.1451   0.79683   0.50281   50   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United States 2018-12-11 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
50855 50855 SRR8312798 SRX5126177 SRS4139299 SRP173302 PRJNA509471 The side population enriches for leukemia propagating cell activity and Wnt pathway expression in zebrafish acute lymphoblastic leukemia. GSE123665 Transcriptome Analysis Cancer stem cells have been strongly linked to resistance and relapse in many malignancies. However purifying them from within the bulk tumor has been challenging so their precise genetic and functional characteristics are not well defined. The side population assay exploits the ability of some cells to efflux Hoechst dye via ABC transporters. Stem cells have increased expression of these transporters and this assay has been shown to enrich for stem cells in various tissues and cancers. This study identifies the side population within a zebrafish model of acute lymphoblastic leukemia and correlates the frequency of side population cells with the frequency of leukemia stem cells more precisely referred to as leukemia propagating cells within our transplantation model. In addition the side population within the leukemia evolves with serial transplantation increasing in tandem with leukemia propagating cell frequency over subsequent generations. Sorted side population cells from these tumors are enriched for leukemia propagating cells and have enhanced engraftment compared to sorted non side population cells when transplanted into syngeneic recipients. RNA sequencing analysis of sorted side population cells compared to non side population cells identified a shared expression profile within the side population and pathway analysis yielded Wnt signaling as the most overrepresented. Gene set enrichment analysis showed that stem cell differentiation and canonical Wnt signaling were significantly upregulated in the side population. Overall these results demonstrate that the side population in zebrafish acute lymphoblastic leukemia significantly enriches for leukemia propagating cells and identifies the Wnt pathway as a likely genetic driver of leukemia stem cell fate. Overall design: mRNA expression comparison between sorted side population and non side population in 3 zebrafish ALL tumors   pubmed:30630989   SP 1279 GSM3509259   source name:ALL tumor|strain:CG2|tissue:ALL SP 1279 Illumina Casava1.7 software used for basecalling. All RNA seq reads were used to align to the genome assembly GRCz10 using STAR v2.5.1b with default configurations. Transcripts were assembled from the aligned reads using Cufflinks v2.2.1 with the default configurations to generate FPKM Fragments Per Kilobase Million tables. Using 4 as the fold change cutoff DEGs Differentially expressed genes were detected using both Tuxedo suite FPKM based method and featureCounts DESeq v1.30.0 edgeR v3.20.7 read count based method with default configurations. Genes detected by at least more than one method were collected to create a high confidence DEG lists. Genome build: GRCz10 Supplementary files format and content: Count tables were generated using featureCount v1.28.1 based on Ensembl annotation GRCz10. ALL tumor None Tumors were removed sorted by FACS and RNA was harvested using Trizol reagent. RNA libraries were prepared for sequencing using standard Illumina protocols None strain:CG2|tissue:ALL GSM3509259 GSM3509259: SP 1279; Danio rerio; RNA Seq GSM3509259   1 Tumors were removed sorted by FACS and RNA was harvested using Trizol reagent. RNA libraries were prepared for sequencing using standard Illumina protocols GEO Accession:GSM3509259 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 4000   SRP173302         2285635100.0 45712702.0 GSM3509259 r2 0:50 1:0 A:540527368;C:568996224;G:529423615;T:645948448;N:739445 50 0     540527368 568996224 529423615 645948448 739445 SRX5126177 SRS4139299 SRA822847 GEO Bioinformatics Core, Biological Sciences Division, The University of Chicago 1 0.93725   0.14453   0.79746   0.4961   50   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United States 2018-12-11 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
50856 50856 SRR8312795 SRX5126176 SRS4139298 SRP173302 PRJNA509471 The side population enriches for leukemia propagating cell activity and Wnt pathway expression in zebrafish acute lymphoblastic leukemia. GSE123665 Transcriptome Analysis Cancer stem cells have been strongly linked to resistance and relapse in many malignancies. However purifying them from within the bulk tumor has been challenging so their precise genetic and functional characteristics are not well defined. The side population assay exploits the ability of some cells to efflux Hoechst dye via ABC transporters. Stem cells have increased expression of these transporters and this assay has been shown to enrich for stem cells in various tissues and cancers. This study identifies the side population within a zebrafish model of acute lymphoblastic leukemia and correlates the frequency of side population cells with the frequency of leukemia stem cells more precisely referred to as leukemia propagating cells within our transplantation model. In addition the side population within the leukemia evolves with serial transplantation increasing in tandem with leukemia propagating cell frequency over subsequent generations. Sorted side population cells from these tumors are enriched for leukemia propagating cells and have enhanced engraftment compared to sorted non side population cells when transplanted into syngeneic recipients. RNA sequencing analysis of sorted side population cells compared to non side population cells identified a shared expression profile within the side population and pathway analysis yielded Wnt signaling as the most overrepresented. Gene set enrichment analysis showed that stem cell differentiation and canonical Wnt signaling were significantly upregulated in the side population. Overall these results demonstrate that the side population in zebrafish acute lymphoblastic leukemia significantly enriches for leukemia propagating cells and identifies the Wnt pathway as a likely genetic driver of leukemia stem cell fate. Overall design: mRNA expression comparison between sorted side population and non side population in 3 zebrafish ALL tumors   pubmed:30630989   nonSP 1404 GSM3509258   source name:ALL tumor|strain:CG2|tissue:ALL nonSP 1404 Illumina Casava1.7 software used for basecalling. All RNA seq reads were used to align to the genome assembly GRCz10 using STAR v2.5.1b with default configurations. Transcripts were assembled from the aligned reads using Cufflinks v2.2.1 with the default configurations to generate FPKM Fragments Per Kilobase Million tables. Using 4 as the fold change cutoff DEGs Differentially expressed genes were detected using both Tuxedo suite FPKM based method and featureCounts DESeq v1.30.0 edgeR v3.20.7 read count based method with default configurations. Genes detected by at least more than one method were collected to create a high confidence DEG lists. Genome build: GRCz10 Supplementary files format and content: Count tables were generated using featureCount v1.28.1 based on Ensembl annotation GRCz10. ALL tumor None Tumors were removed sorted by FACS and RNA was harvested using Trizol reagent. RNA libraries were prepared for sequencing using standard Illumina protocols None strain:CG2|tissue:ALL GSM3509258 GSM3509258: nonSP 1404; Danio rerio; RNA Seq GSM3509258   1 Tumors were removed sorted by FACS and RNA was harvested using Trizol reagent. RNA libraries were prepared for sequencing using standard Illumina protocols GEO Accession:GSM3509258 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 4000   SRP173302         2069543600.0 41390872.0 GSM3509258 r1 0:50 1:0 A:459382162;C:532071054;G:508544948;T:569228380;N:317056 50 0     459382162 532071054 508544948 569228380 317056 SRX5126176 SRS4139298 SRA822847 GEO Bioinformatics Core, Biological Sciences Division, The University of Chicago 1 0.96095   0.06905   0.83412   0.4818   50   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United States 2018-12-11 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
50857 50857 SRR8312796 SRX5126176 SRS4139298 SRP173302 PRJNA509471 The side population enriches for leukemia propagating cell activity and Wnt pathway expression in zebrafish acute lymphoblastic leukemia. GSE123665 Transcriptome Analysis Cancer stem cells have been strongly linked to resistance and relapse in many malignancies. However purifying them from within the bulk tumor has been challenging so their precise genetic and functional characteristics are not well defined. The side population assay exploits the ability of some cells to efflux Hoechst dye via ABC transporters. Stem cells have increased expression of these transporters and this assay has been shown to enrich for stem cells in various tissues and cancers. This study identifies the side population within a zebrafish model of acute lymphoblastic leukemia and correlates the frequency of side population cells with the frequency of leukemia stem cells more precisely referred to as leukemia propagating cells within our transplantation model. In addition the side population within the leukemia evolves with serial transplantation increasing in tandem with leukemia propagating cell frequency over subsequent generations. Sorted side population cells from these tumors are enriched for leukemia propagating cells and have enhanced engraftment compared to sorted non side population cells when transplanted into syngeneic recipients. RNA sequencing analysis of sorted side population cells compared to non side population cells identified a shared expression profile within the side population and pathway analysis yielded Wnt signaling as the most overrepresented. Gene set enrichment analysis showed that stem cell differentiation and canonical Wnt signaling were significantly upregulated in the side population. Overall these results demonstrate that the side population in zebrafish acute lymphoblastic leukemia significantly enriches for leukemia propagating cells and identifies the Wnt pathway as a likely genetic driver of leukemia stem cell fate. Overall design: mRNA expression comparison between sorted side population and non side population in 3 zebrafish ALL tumors   pubmed:30630989   nonSP 1404 GSM3509258   source name:ALL tumor|strain:CG2|tissue:ALL nonSP 1404 Illumina Casava1.7 software used for basecalling. All RNA seq reads were used to align to the genome assembly GRCz10 using STAR v2.5.1b with default configurations. Transcripts were assembled from the aligned reads using Cufflinks v2.2.1 with the default configurations to generate FPKM Fragments Per Kilobase Million tables. Using 4 as the fold change cutoff DEGs Differentially expressed genes were detected using both Tuxedo suite FPKM based method and featureCounts DESeq v1.30.0 edgeR v3.20.7 read count based method with default configurations. Genes detected by at least more than one method were collected to create a high confidence DEG lists. Genome build: GRCz10 Supplementary files format and content: Count tables were generated using featureCount v1.28.1 based on Ensembl annotation GRCz10. ALL tumor None Tumors were removed sorted by FACS and RNA was harvested using Trizol reagent. RNA libraries were prepared for sequencing using standard Illumina protocols None strain:CG2|tissue:ALL GSM3509258 GSM3509258: nonSP 1404; Danio rerio; RNA Seq GSM3509258   1 Tumors were removed sorted by FACS and RNA was harvested using Trizol reagent. RNA libraries were prepared for sequencing using standard Illumina protocols GEO Accession:GSM3509258 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 4000   SRP173302         1547447200.0 30948944.0 GSM3509258 r2 0:50 1:0 A:343821341;C:397523901;G:380174292;T:425426296;N:501370 50 0     343821341 397523901 380174292 425426296 501370 SRX5126176 SRS4139298 SRA822847 GEO Bioinformatics Core, Biological Sciences Division, The University of Chicago 1 0.95838   0.06884   0.83414   0.48727   50   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United States 2018-12-11 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
50858 50858 SRR8312793 SRX5126175 SRS4139297 SRP173302 PRJNA509471 The side population enriches for leukemia propagating cell activity and Wnt pathway expression in zebrafish acute lymphoblastic leukemia. GSE123665 Transcriptome Analysis Cancer stem cells have been strongly linked to resistance and relapse in many malignancies. However purifying them from within the bulk tumor has been challenging so their precise genetic and functional characteristics are not well defined. The side population assay exploits the ability of some cells to efflux Hoechst dye via ABC transporters. Stem cells have increased expression of these transporters and this assay has been shown to enrich for stem cells in various tissues and cancers. This study identifies the side population within a zebrafish model of acute lymphoblastic leukemia and correlates the frequency of side population cells with the frequency of leukemia stem cells more precisely referred to as leukemia propagating cells within our transplantation model. In addition the side population within the leukemia evolves with serial transplantation increasing in tandem with leukemia propagating cell frequency over subsequent generations. Sorted side population cells from these tumors are enriched for leukemia propagating cells and have enhanced engraftment compared to sorted non side population cells when transplanted into syngeneic recipients. RNA sequencing analysis of sorted side population cells compared to non side population cells identified a shared expression profile within the side population and pathway analysis yielded Wnt signaling as the most overrepresented. Gene set enrichment analysis showed that stem cell differentiation and canonical Wnt signaling were significantly upregulated in the side population. Overall these results demonstrate that the side population in zebrafish acute lymphoblastic leukemia significantly enriches for leukemia propagating cells and identifies the Wnt pathway as a likely genetic driver of leukemia stem cell fate. Overall design: mRNA expression comparison between sorted side population and non side population in 3 zebrafish ALL tumors   pubmed:30630989   SP 1404 GSM3509257   source name:ALL tumor|strain:CG2|tissue:ALL SP 1404 Illumina Casava1.7 software used for basecalling. All RNA seq reads were used to align to the genome assembly GRCz10 using STAR v2.5.1b with default configurations. Transcripts were assembled from the aligned reads using Cufflinks v2.2.1 with the default configurations to generate FPKM Fragments Per Kilobase Million tables. Using 4 as the fold change cutoff DEGs Differentially expressed genes were detected using both Tuxedo suite FPKM based method and featureCounts DESeq v1.30.0 edgeR v3.20.7 read count based method with default configurations. Genes detected by at least more than one method were collected to create a high confidence DEG lists. Genome build: GRCz10 Supplementary files format and content: Count tables were generated using featureCount v1.28.1 based on Ensembl annotation GRCz10. ALL tumor None Tumors were removed sorted by FACS and RNA was harvested using Trizol reagent. RNA libraries were prepared for sequencing using standard Illumina protocols None strain:CG2|tissue:ALL GSM3509257 GSM3509257: SP 1404; Danio rerio; RNA Seq GSM3509257   1 Tumors were removed sorted by FACS and RNA was harvested using Trizol reagent. RNA libraries were prepared for sequencing using standard Illumina protocols GEO Accession:GSM3509257 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 4000   SRP173302         2020346850.0 40406937.0 GSM3509257 r1 0:50 1:0 A:476259938;C:502400578;G:476364320;T:565010528;N:311486 50 0     476259938 502400578 476364320 565010528 311486 SRX5126175 SRS4139297 SRA822847 GEO Bioinformatics Core, Biological Sciences Division, The University of Chicago 1 0.94163   0.11567   0.79287   0.52008   50   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United States 2018-12-11 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
50859 50859 SRR8312794 SRX5126175 SRS4139297 SRP173302 PRJNA509471 The side population enriches for leukemia propagating cell activity and Wnt pathway expression in zebrafish acute lymphoblastic leukemia. GSE123665 Transcriptome Analysis Cancer stem cells have been strongly linked to resistance and relapse in many malignancies. However purifying them from within the bulk tumor has been challenging so their precise genetic and functional characteristics are not well defined. The side population assay exploits the ability of some cells to efflux Hoechst dye via ABC transporters. Stem cells have increased expression of these transporters and this assay has been shown to enrich for stem cells in various tissues and cancers. This study identifies the side population within a zebrafish model of acute lymphoblastic leukemia and correlates the frequency of side population cells with the frequency of leukemia stem cells more precisely referred to as leukemia propagating cells within our transplantation model. In addition the side population within the leukemia evolves with serial transplantation increasing in tandem with leukemia propagating cell frequency over subsequent generations. Sorted side population cells from these tumors are enriched for leukemia propagating cells and have enhanced engraftment compared to sorted non side population cells when transplanted into syngeneic recipients. RNA sequencing analysis of sorted side population cells compared to non side population cells identified a shared expression profile within the side population and pathway analysis yielded Wnt signaling as the most overrepresented. Gene set enrichment analysis showed that stem cell differentiation and canonical Wnt signaling were significantly upregulated in the side population. Overall these results demonstrate that the side population in zebrafish acute lymphoblastic leukemia significantly enriches for leukemia propagating cells and identifies the Wnt pathway as a likely genetic driver of leukemia stem cell fate. Overall design: mRNA expression comparison between sorted side population and non side population in 3 zebrafish ALL tumors   pubmed:30630989   SP 1404 GSM3509257   source name:ALL tumor|strain:CG2|tissue:ALL SP 1404 Illumina Casava1.7 software used for basecalling. All RNA seq reads were used to align to the genome assembly GRCz10 using STAR v2.5.1b with default configurations. Transcripts were assembled from the aligned reads using Cufflinks v2.2.1 with the default configurations to generate FPKM Fragments Per Kilobase Million tables. Using 4 as the fold change cutoff DEGs Differentially expressed genes were detected using both Tuxedo suite FPKM based method and featureCounts DESeq v1.30.0 edgeR v3.20.7 read count based method with default configurations. Genes detected by at least more than one method were collected to create a high confidence DEG lists. Genome build: GRCz10 Supplementary files format and content: Count tables were generated using featureCount v1.28.1 based on Ensembl annotation GRCz10. ALL tumor None Tumors were removed sorted by FACS and RNA was harvested using Trizol reagent. RNA libraries were prepared for sequencing using standard Illumina protocols None strain:CG2|tissue:ALL GSM3509257 GSM3509257: SP 1404; Danio rerio; RNA Seq GSM3509257   1 Tumors were removed sorted by FACS and RNA was harvested using Trizol reagent. RNA libraries were prepared for sequencing using standard Illumina protocols GEO Accession:GSM3509257 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 4000   SRP173302         1560387300.0 31207746.0 GSM3509257 r2 0:50 1:0 A:368229806;C:387650010;G:367757630;T:436243680;N:506174 50 0     368229806 387650010 367757630 436243680 506174 SRX5126175 SRS4139297 SRA822847 GEO Bioinformatics Core, Biological Sciences Division, The University of Chicago 1 0.93995   0.11774   0.79444   0.49697   50   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United States 2018-12-11 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
59561 59561 SRR11926643 SRX8472289 SRS6772890 SRP265974 PRJNA637328 A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models GSE151816 Transcriptome Analysis We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition RNA sequencing was performed on various additional zebrafish T ALL models shrek hulk otg hMYC sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1 shrek hulk otg T ALL samples wild type thymocytes sequenced in the Speleman lab wild type thymocytes sequenced in the Frazer lab. Shrek otg hulk hMYC preleukemic thymocytes   pubmed:32591643   T2 GSM4591324   tissue:T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.|cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP|tumor stg:Primary T ALL|lab of sample collection and sequencing:Speleman lab T2 First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.   Truseq stranded mRNA library prep illumina #20020594   cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP|tumor stg:Primary T ALL|lab of sample collection and sequencing:Speleman lab GSM4591324 GSM4591324: T2; Danio rerio; RNA Seq GSM4591324   1 Truseq stranded mRNA library prep illumina #20020594 GEO Accession:GSM4591324 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP265974     sample_24.fastq.gz fastq 3352396700.0 44370046.0 GSM4591324 r1 0:75.56 1:0 A:755348675;C:859386520;G:800067906;T:937329969;N:263630 75 0     755348675 859386520 800067906 937329969 263630 SRX8472289 SRS6772890 SRA1083220 GEO Center for Medical Genetics, Ghent University 1 0.96963   0.06719   0.81755   0.50255   76   B   usable mapping rate illumina nextseq unknown cdna_unspecified trueseq bulk unknown unknown   Belgium 2020-06-04 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
59562 59562 SRR11926642 SRX8472288 SRS6772889 SRP265974 PRJNA637328 A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models GSE151816 Transcriptome Analysis We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition RNA sequencing was performed on various additional zebrafish T ALL models shrek hulk otg hMYC sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1 shrek hulk otg T ALL samples wild type thymocytes sequenced in the Speleman lab wild type thymocytes sequenced in the Frazer lab. Shrek otg hulk hMYC preleukemic thymocytes   pubmed:32591643   T2 2 GSM4591323   tissue:T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.|cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP|tumor stg:Transplant T ALL|lab of sample collection and sequencing:Speleman lab T2 2 First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.   Truseq stranded mRNA library prep illumina #20020594   cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP|tumor stg:Transplant T ALL|lab of sample collection and sequencing:Speleman lab GSM4591323 GSM4591323: T2 2; Danio rerio; RNA Seq GSM4591323   1 Truseq stranded mRNA library prep illumina #20020594 GEO Accession:GSM4591323 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP265974     sample_23.fastq.gz fastq 3718498010.0 49228779.0 GSM4591323 r1 0:75.54 1:0 A:848213188;C:950067431;G:877745427;T:1042167763;N:304201 75 0     848213188 950067431 877745427 1042167763 304201 SRX8472288 SRS6772889 SRA1083220 GEO Center for Medical Genetics, Ghent University 1 0.96846   0.08566   0.80708   0.51642   76   B   usable mapping rate illumina nextseq unknown cdna_unspecified trueseq bulk unknown unknown   Belgium 2020-06-04 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
59563 59563 SRR11926641 SRX8472287 SRS6772888 SRP265974 PRJNA637328 A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models GSE151816 Transcriptome Analysis We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition RNA sequencing was performed on various additional zebrafish T ALL models shrek hulk otg hMYC sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1 shrek hulk otg T ALL samples wild type thymocytes sequenced in the Speleman lab wild type thymocytes sequenced in the Frazer lab. Shrek otg hulk hMYC preleukemic thymocytes   pubmed:32591643   T2 2 3 GSM4591322   tissue:T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.|cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP|tumor stg:Transplant T ALL|lab of sample collection and sequencing:Speleman lab T2 2 3 First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.   Truseq stranded mRNA library prep illumina #20020594   cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP|tumor stg:Transplant T ALL|lab of sample collection and sequencing:Speleman lab GSM4591322 GSM4591322: T2 2 3; Danio rerio; RNA Seq GSM4591322   1 Truseq stranded mRNA library prep illumina #20020594 GEO Accession:GSM4591322 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP265974     sample_22.fastq.gz fastq 3433698150.0 45471576.0 GSM4591322 r1 0:75.51 1:0 A:791522856;C:866434769;G:797134042;T:978335562;N:270921 75 0     791522856 866434769 797134042 978335562 270921 SRX8472287 SRS6772888 SRA1083220 GEO Center for Medical Genetics, Ghent University 1 0.96727   0.13235   0.80375   0.51948   76   B   usable mapping rate illumina nextseq unknown cdna_unspecified trueseq bulk unknown unknown   Belgium 2020-06-04 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
59564 59564 SRR11926640 SRX8472286 SRS6772887 SRP265974 PRJNA637328 A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models GSE151816 Transcriptome Analysis We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition RNA sequencing was performed on various additional zebrafish T ALL models shrek hulk otg hMYC sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1 shrek hulk otg T ALL samples wild type thymocytes sequenced in the Speleman lab wild type thymocytes sequenced in the Frazer lab. Shrek otg hulk hMYC preleukemic thymocytes   pubmed:32591643   T2 2 1 GSM4591321   tissue:T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.|cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP|tumor stg:Transplant T ALL|lab of sample collection and sequencing:Speleman lab T2 2 1 First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.   Truseq stranded mRNA library prep illumina #20020594   cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP|tumor stg:Transplant T ALL|lab of sample collection and sequencing:Speleman lab GSM4591321 GSM4591321: T2 2 1; Danio rerio; RNA Seq GSM4591321   1 Truseq stranded mRNA library prep illumina #20020594 GEO Accession:GSM4591321 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP265974     sample_21.fastq.gz fastq 3340319927.0 44222057.0 GSM4591321 r1 0:75.54 1:0 A:783394487;C:834577900;G:758192327;T:963889109;N:266104 75 0     783394487 834577900 758192327 963889109 266104 SRX8472286 SRS6772887 SRA1083220 GEO Center for Medical Genetics, Ghent University 1 0.95862   0.19113   0.80117   0.51412   76   B   usable mapping rate illumina nextseq unknown cdna_unspecified trueseq bulk unknown unknown   Belgium 2020-06-04 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
59565 59565 SRR11926639 SRX8472285 SRS6772885 SRP265974 PRJNA637328 A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models GSE151816 Transcriptome Analysis We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition RNA sequencing was performed on various additional zebrafish T ALL models shrek hulk otg hMYC sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1 shrek hulk otg T ALL samples wild type thymocytes sequenced in the Speleman lab wild type thymocytes sequenced in the Frazer lab. Shrek otg hulk hMYC preleukemic thymocytes   pubmed:32591643   T2 1 GSM4591320   tissue:T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.|cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP|tumor stg:Transplant T ALL|lab of sample collection and sequencing:Speleman lab T2 1 First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.   Truseq stranded mRNA library prep illumina #20020594   cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP|tumor stg:Transplant T ALL|lab of sample collection and sequencing:Speleman lab GSM4591320 GSM4591320: T2 1; Danio rerio; RNA Seq GSM4591320   1 Truseq stranded mRNA library prep illumina #20020594 GEO Accession:GSM4591320 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP265974     sample_20.fastq.gz fastq 3407895222.0 45108733.0 GSM4591320 r1 0:75.55 1:0 A:772284922;C:869002714;G:804588273;T:961751439;N:267874 75 0     772284922 869002714 804588273 961751439 267874 SRX8472285 SRS6772885 SRA1083220 GEO Center for Medical Genetics, Ghent University 1 0.96729   0.10404   0.80819   0.50282   76   B   usable mapping rate illumina nextseq unknown cdna_unspecified trueseq bulk unknown unknown   Belgium 2020-06-04 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
59566 59566 SRR11926638 SRX8472284 SRS6772886 SRP265974 PRJNA637328 A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models GSE151816 Transcriptome Analysis We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition RNA sequencing was performed on various additional zebrafish T ALL models shrek hulk otg hMYC sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1 shrek hulk otg T ALL samples wild type thymocytes sequenced in the Speleman lab wild type thymocytes sequenced in the Frazer lab. Shrek otg hulk hMYC preleukemic thymocytes   pubmed:32591643   T1 GSM4591319   tissue:T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.|cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP|tumor stg:Primary T ALL|lab of sample collection and sequencing:Speleman lab T1 First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.   Truseq stranded mRNA library prep illumina #20020594   cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP|tumor stg:Primary T ALL|lab of sample collection and sequencing:Speleman lab GSM4591319 GSM4591319: T1; Danio rerio; RNA Seq GSM4591319   1 Truseq stranded mRNA library prep illumina #20020594 GEO Accession:GSM4591319 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP265974     sample_19.fastq.gz fastq 3399960459.0 45000945.0 GSM4591319 r1 0:75.55 1:0 A:757716117;C:885849357;G:808221386;T:947866574;N:307025 75 0     757716117 885849357 808221386 947866574 307025 SRX8472284 SRS6772886 SRA1083220 GEO Center for Medical Genetics, Ghent University 1 0.96322   0.0579   0.80509   0.51314   76   B   usable mapping rate illumina nextseq unknown cdna_unspecified trueseq bulk unknown unknown   Belgium 2020-06-04 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
59567 59567 SRR11926637 SRX8472283 SRS6772884 SRP265974 PRJNA637328 A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models GSE151816 Transcriptome Analysis We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition RNA sequencing was performed on various additional zebrafish T ALL models shrek hulk otg hMYC sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1 shrek hulk otg T ALL samples wild type thymocytes sequenced in the Speleman lab wild type thymocytes sequenced in the Frazer lab. Shrek otg hulk hMYC preleukemic thymocytes   pubmed:32591643   T1 2 GSM4591318   tissue:T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.|cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP|tumor stg:Transplant T ALL|lab of sample collection and sequencing:Speleman lab T1 2 First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.   Truseq stranded mRNA library prep illumina #20020594   cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP|tumor stg:Transplant T ALL|lab of sample collection and sequencing:Speleman lab GSM4591318 GSM4591318: T1 2; Danio rerio; RNA Seq GSM4591318   1 Truseq stranded mRNA library prep illumina #20020594 GEO Accession:GSM4591318 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP265974     sample_18.fastq.gz fastq 3375335979.0 44692348.0 GSM4591318 r1 0:75.52 1:0 A:752811966;C:868444009;G:810580314;T:943232624;N:267066 75 0     752811966 868444009 810580314 943232624 267066 SRX8472283 SRS6772884 SRA1083220 GEO Center for Medical Genetics, Ghent University 1 0.96578   0.07571   0.82558   0.50359   76   B   usable mapping rate illumina nextseq unknown cdna_unspecified trueseq bulk unknown unknown   Belgium 2020-06-04 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
59568 59568 SRR11926636 SRX8472282 SRS6772883 SRP265974 PRJNA637328 A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models GSE151816 Transcriptome Analysis We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition RNA sequencing was performed on various additional zebrafish T ALL models shrek hulk otg hMYC sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1 shrek hulk otg T ALL samples wild type thymocytes sequenced in the Speleman lab wild type thymocytes sequenced in the Frazer lab. Shrek otg hulk hMYC preleukemic thymocytes   pubmed:32591643   T1 1 GSM4591317   tissue:T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.|cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP|tumor stg:Transplant T ALL|lab of sample collection and sequencing:Speleman lab T1 1 First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.   Truseq stranded mRNA library prep illumina #20020594   cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP|tumor stg:Transplant T ALL|lab of sample collection and sequencing:Speleman lab GSM4591317 GSM4591317: T1 1; Danio rerio; RNA Seq GSM4591317   1 Truseq stranded mRNA library prep illumina #20020594 GEO Accession:GSM4591317 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP265974     sample_17.fastq.gz fastq 3010940849.0 39848118.0 GSM4591317 r1 0:75.56 1:0 A:668391154;C:785449019;G:724383036;T:832480672;N:236968 75 0     668391154 785449019 724383036 832480672 236968 SRX8472282 SRS6772883 SRA1083220 GEO Center for Medical Genetics, Ghent University 1 0.96967   0.04925   0.84764   0.52577   76   B   usable mapping rate illumina nextseq unknown cdna_unspecified trueseq bulk unknown unknown   Belgium 2020-06-04 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
59569 59569 SRR11926635 SRX8472281 SRS6772882 SRP265974 PRJNA637328 A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models GSE151816 Transcriptome Analysis We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition RNA sequencing was performed on various additional zebrafish T ALL models shrek hulk otg hMYC sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1 shrek hulk otg T ALL samples wild type thymocytes sequenced in the Speleman lab wild type thymocytes sequenced in the Frazer lab. Shrek otg hulk hMYC preleukemic thymocytes   pubmed:32591643   PT4 GSM4591316   tissue:T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.|cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP;phf6+/ |tumor stg:Primary T ALL|lab of sample collection and sequencing:Speleman lab PT4 First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.   Truseq stranded mRNA library prep illumina #20020594   cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP;phf6+/ |tumor stg:Primary T ALL|lab of sample collection and sequencing:Speleman lab GSM4591316 GSM4591316: PT4; Danio rerio; RNA Seq GSM4591316   1 Truseq stranded mRNA library prep illumina #20020594 GEO Accession:GSM4591316 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP265974     sample_16.fastq.gz fastq 2704327748.0 35795276.0 GSM4591316 r1 0:75.55 1:0 A:606123714;C:696847421;G:651551202;T:749582467;N:222944 75 0     606123714 696847421 651551202 749582467 222944 SRX8472281 SRS6772882 SRA1083220 GEO Center for Medical Genetics, Ghent University 1 0.97216   0.06109   0.81832   0.49375   74   B   usable mapping rate illumina nextseq unknown cdna_unspecified trueseq bulk unknown unknown   Belgium 2020-06-04 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
59570 59570 SRR11926634 SRX8472280 SRS6772881 SRP265974 PRJNA637328 A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models GSE151816 Transcriptome Analysis We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition RNA sequencing was performed on various additional zebrafish T ALL models shrek hulk otg hMYC sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1 shrek hulk otg T ALL samples wild type thymocytes sequenced in the Speleman lab wild type thymocytes sequenced in the Frazer lab. Shrek otg hulk hMYC preleukemic thymocytes   pubmed:32591643   PT3 GSM4591315   tissue:T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.|cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP;phf6+/ |tumor stg:Primary T ALL|lab of sample collection and sequencing:Speleman lab PT3 First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.   Truseq stranded mRNA library prep illumina #20020594   cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP;phf6+/ |tumor stg:Primary T ALL|lab of sample collection and sequencing:Speleman lab GSM4591315 GSM4591315: PT3; Danio rerio; RNA Seq GSM4591315   1 Truseq stranded mRNA library prep illumina #20020594 GEO Accession:GSM4591315 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP265974     sample_15.fastq.gz fastq 2516254096.0 33304042.0 GSM4591315 r1 0:75.55 1:0 A:572120254;C:639148525;G:596715581;T:708079869;N:189867 75 0     572120254 639148525 596715581 708079869 189867 SRX8472280 SRS6772881 SRA1083220 GEO Center for Medical Genetics, Ghent University 1 0.96526   0.07769   0.80758   0.53064   76   B   usable mapping rate illumina nextseq unknown cdna_unspecified trueseq bulk unknown unknown   Belgium 2020-06-04 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
59571 59571 SRR11926633 SRX8472279 SRS6772880 SRP265974 PRJNA637328 A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models GSE151816 Transcriptome Analysis We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition RNA sequencing was performed on various additional zebrafish T ALL models shrek hulk otg hMYC sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1 shrek hulk otg T ALL samples wild type thymocytes sequenced in the Speleman lab wild type thymocytes sequenced in the Frazer lab. Shrek otg hulk hMYC preleukemic thymocytes   pubmed:32591643   PT2 GSM4591314   tissue:T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.|cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP;phf6+/ |tumor stg:Primary T ALL|lab of sample collection and sequencing:Speleman lab PT2 First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.   Truseq stranded mRNA library prep illumina #20020594   cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP;phf6+/ |tumor stg:Primary T ALL|lab of sample collection and sequencing:Speleman lab GSM4591314 GSM4591314: PT2; Danio rerio; RNA Seq GSM4591314   1 Truseq stranded mRNA library prep illumina #20020594 GEO Accession:GSM4591314 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP265974     sample_14.fastq.gz fastq 2805545977.0 37135357.0 GSM4591314 r1 0:75.55 1:0 A:632305395;C:719045953;G:676770065;T:777205477;N:219087 75 0     632305395 719045953 676770065 777205477 219087 SRX8472279 SRS6772880 SRA1083220 GEO Center for Medical Genetics, Ghent University 1 0.97087   0.01807   0.83364   0.54322   76   B   usable mapping rate illumina nextseq unknown cdna_unspecified trueseq bulk unknown unknown   Belgium 2020-06-04 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
59572 59572 SRR11926632 SRX8472278 SRS6772879 SRP265974 PRJNA637328 A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models GSE151816 Transcriptome Analysis We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition RNA sequencing was performed on various additional zebrafish T ALL models shrek hulk otg hMYC sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1 shrek hulk otg T ALL samples wild type thymocytes sequenced in the Speleman lab wild type thymocytes sequenced in the Frazer lab. Shrek otg hulk hMYC preleukemic thymocytes   pubmed:32591643   PT2 3 GSM4591313   tissue:T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.|cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP;phf6+/ |tumor stg:Transplant T ALL|lab of sample collection and sequencing:Speleman lab PT2 3 First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.   Truseq stranded mRNA library prep illumina #20020594   cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP;phf6+/ |tumor stg:Transplant T ALL|lab of sample collection and sequencing:Speleman lab GSM4591313 GSM4591313: PT2 3; Danio rerio; RNA Seq GSM4591313   1 Truseq stranded mRNA library prep illumina #20020594 GEO Accession:GSM4591313 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP265974     sample_13.fastq.gz fastq 3227070397.0 42713584.0 GSM4591313 r1 0:75.55 1:0 A:717490964;C:839799892;G:773804253;T:895714100;N:261188 75 0     717490964 839799892 773804253 895714100 261188 SRX8472278 SRS6772879 SRA1083220 GEO Center for Medical Genetics, Ghent University 1 0.97134   0.05713   0.81099   0.49228   76   B   usable mapping rate illumina nextseq unknown cdna_unspecified trueseq bulk unknown unknown   Belgium 2020-06-04 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
59573 59573 SRR11926631 SRX8472277 SRS6772878 SRP265974 PRJNA637328 A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models GSE151816 Transcriptome Analysis We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition RNA sequencing was performed on various additional zebrafish T ALL models shrek hulk otg hMYC sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1 shrek hulk otg T ALL samples wild type thymocytes sequenced in the Speleman lab wild type thymocytes sequenced in the Frazer lab. Shrek otg hulk hMYC preleukemic thymocytes   pubmed:32591643   PT2 2 GSM4591312   tissue:T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.|cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP;phf6+/ |tumor stg:Transplant T ALL|lab of sample collection and sequencing:Speleman lab PT2 2 First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.   Truseq stranded mRNA library prep illumina #20020594   cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP;phf6+/ |tumor stg:Transplant T ALL|lab of sample collection and sequencing:Speleman lab GSM4591312 GSM4591312: PT2 2; Danio rerio; RNA Seq GSM4591312   1 Truseq stranded mRNA library prep illumina #20020594 GEO Accession:GSM4591312 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP265974     sample_12.fastq.gz fastq 3212726304.0 42523190.0 GSM4591312 r1 0:75.55 1:0 A:719132496;C:829799997;G:771562071;T:891973714;N:258026 75 0     719132496 829799997 771562071 891973714 258026 SRX8472277 SRS6772878 SRA1083220 GEO Center for Medical Genetics, Ghent University 1 0.9721   0.04902   0.80902   0.52414   76   B   usable mapping rate illumina nextseq unknown cdna_unspecified trueseq bulk unknown unknown   Belgium 2020-06-04 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
59574 59574 SRR11926630 SRX8472276 SRS6772877 SRP265974 PRJNA637328 A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models GSE151816 Transcriptome Analysis We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition RNA sequencing was performed on various additional zebrafish T ALL models shrek hulk otg hMYC sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1 shrek hulk otg T ALL samples wild type thymocytes sequenced in the Speleman lab wild type thymocytes sequenced in the Frazer lab. Shrek otg hulk hMYC preleukemic thymocytes   pubmed:32591643   PT2 1 GSM4591311   tissue:T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.|cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP;phf6+/ |tumor stg:Transplant T ALL|lab of sample collection and sequencing:Speleman lab PT2 1 First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.   Truseq stranded mRNA library prep illumina #20020594   cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP;phf6+/ |tumor stg:Transplant T ALL|lab of sample collection and sequencing:Speleman lab GSM4591311 GSM4591311: PT2 1; Danio rerio; RNA Seq GSM4591311   1 Truseq stranded mRNA library prep illumina #20020594 GEO Accession:GSM4591311 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP265974     sample_11.fastq.gz fastq 3021393530.0 39988248.0 GSM4591311 r1 0:75.56 1:0 A:672620933;C:786720838;G:726121643;T:835686624;N:243492 75 0     672620933 786720838 726121643 835686624 243492 SRX8472276 SRS6772877 SRA1083220 GEO Center for Medical Genetics, Ghent University 1 0.97407   0.03891   0.81716   0.49217   76   B   usable mapping rate illumina nextseq unknown cdna_unspecified trueseq bulk unknown unknown   Belgium 2020-06-04 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
59575 59575 SRR11926629 SRX8472275 SRS6772876 SRP265974 PRJNA637328 A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models GSE151816 Transcriptome Analysis We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition RNA sequencing was performed on various additional zebrafish T ALL models shrek hulk otg hMYC sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1 shrek hulk otg T ALL samples wild type thymocytes sequenced in the Speleman lab wild type thymocytes sequenced in the Frazer lab. Shrek otg hulk hMYC preleukemic thymocytes   pubmed:32591643   PT1 GSM4591310   tissue:T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.|cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP;phf6+/ |tumor stg:Primary T ALL|lab of sample collection and sequencing:Speleman lab PT1 First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.   Truseq stranded mRNA library prep illumina #20020594   cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP;phf6+/ |tumor stg:Primary T ALL|lab of sample collection and sequencing:Speleman lab GSM4591310 GSM4591310: PT1; Danio rerio; RNA Seq GSM4591310   1 Truseq stranded mRNA library prep illumina #20020594 GEO Accession:GSM4591310 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP265974     sample_10.fastq.gz fastq 3216194683.0 42575567.0 GSM4591310 r1 0:75.54 1:0 A:754906399;C:800124470;G:747953707;T:912956321;N:253786 75 0     754906399 800124470 747953707 912956321 253786 SRX8472275 SRS6772876 SRA1083220 GEO Center for Medical Genetics, Ghent University 1 0.95808   0.13813   0.79782   0.5126   75   B   usable mapping rate illumina nextseq unknown cdna_unspecified trueseq bulk unknown unknown   Belgium 2020-06-04 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
59576 59576 SRR11926628 SRX8472274 SRS6772875 SRP265974 PRJNA637328 A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models GSE151816 Transcriptome Analysis We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition RNA sequencing was performed on various additional zebrafish T ALL models shrek hulk otg hMYC sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1 shrek hulk otg T ALL samples wild type thymocytes sequenced in the Speleman lab wild type thymocytes sequenced in the Frazer lab. Shrek otg hulk hMYC preleukemic thymocytes   pubmed:32591643   PT1 3 GSM4591309   tissue:T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.|cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP;phf6+/ |tumor stg:Transplant T ALL|lab of sample collection and sequencing:Speleman lab PT1 3 First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.   Truseq stranded mRNA library prep illumina #20020594   cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP;phf6+/ |tumor stg:Transplant T ALL|lab of sample collection and sequencing:Speleman lab GSM4591309 GSM4591309: PT1 3; Danio rerio; RNA Seq GSM4591309   1 Truseq stranded mRNA library prep illumina #20020594 GEO Accession:GSM4591309 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP265974     sample_9.fastq.gz fastq 3632705131.0 48084818.0 GSM4591309 r1 0:75.55 1:0 A:864204924;C:896630766;G:806140808;T:1065445772;N:282861 75 0     864204924 896630766 806140808 1065445772 282861 SRX8472274 SRS6772875 SRA1083220 GEO Center for Medical Genetics, Ghent University 1 0.94792   0.24728   0.78882   0.49754   75   B   usable mapping rate illumina nextseq unknown cdna_unspecified trueseq bulk unknown unknown   Belgium 2020-06-04 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
59577 59577 SRR11926627 SRX8472273 SRS6772874 SRP265974 PRJNA637328 A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models GSE151816 Transcriptome Analysis We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition RNA sequencing was performed on various additional zebrafish T ALL models shrek hulk otg hMYC sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1 shrek hulk otg T ALL samples wild type thymocytes sequenced in the Speleman lab wild type thymocytes sequenced in the Frazer lab. Shrek otg hulk hMYC preleukemic thymocytes   pubmed:32591643   PT1 2 GSM4591308   tissue:T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.|cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP;phf6+/ |tumor stg:Transplant T ALL|lab of sample collection and sequencing:Speleman lab PT1 2 First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.   Truseq stranded mRNA library prep illumina #20020594   cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP;phf6+/ |tumor stg:Transplant T ALL|lab of sample collection and sequencing:Speleman lab GSM4591308 GSM4591308: PT1 2; Danio rerio; RNA Seq GSM4591308   1 Truseq stranded mRNA library prep illumina #20020594 GEO Accession:GSM4591308 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP265974     sample_8.fastq.gz fastq 2694796792.0 35662689.0 GSM4591308 r1 0:75.56 1:0 A:647242858;C:662131043;G:597596390;T:787640018;N:186483 75 0     647242858 662131043 597596390 787640018 186483 SRX8472273 SRS6772874 SRA1083220 GEO Center for Medical Genetics, Ghent University 1 0.94581   0.21549   0.79064   0.50568   76   B   usable mapping rate illumina nextseq unknown cdna_unspecified trueseq bulk unknown unknown   Belgium 2020-06-04 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
59578 59578 SRR11926626 SRX8472272 SRS6772873 SRP265974 PRJNA637328 A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models GSE151816 Transcriptome Analysis We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition RNA sequencing was performed on various additional zebrafish T ALL models shrek hulk otg hMYC sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1 shrek hulk otg T ALL samples wild type thymocytes sequenced in the Speleman lab wild type thymocytes sequenced in the Frazer lab. Shrek otg hulk hMYC preleukemic thymocytes   pubmed:32591643   PT1 1 GSM4591307   tissue:T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.|cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP;phf6+/ |tumor stg:Transplant T ALL|lab of sample collection and sequencing:Speleman lab PT1 1 First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts T ALL colleted when 90% of zebrafish was taken over by GFP + T ALL cells.   Truseq stranded mRNA library prep illumina #20020594   cell type:T ALL|genotype:Tgrag2:hTLX1; rag2:GFP;phf6+/ |tumor stg:Transplant T ALL|lab of sample collection and sequencing:Speleman lab GSM4591307 GSM4591307: PT1 1; Danio rerio; RNA Seq GSM4591307   1 Truseq stranded mRNA library prep illumina #20020594 GEO Accession:GSM4591307 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP265974     sample_7.fastq.gz fastq 3283930508.0 43472772.0 GSM4591307 r1 0:75.54 1:0 A:777409453;C:814864928;G:740583382;T:950812702;N:260043 75 0     777409453 814864928 740583382 950812702 260043 SRX8472272 SRS6772873 SRA1083220 GEO Center for Medical Genetics, Ghent University 1 0.94952   0.17765   0.78108   0.50322   74   B   usable mapping rate illumina nextseq unknown cdna_unspecified trueseq bulk unknown unknown   Belgium 2020-06-04 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
65013 65013 SRR14902693 SRX11217415 SRS9271514 SRP325444 PRJNA741108 Transcriptional Profile in Zebrafish Melanocytes and Melanoma Tumors [RNA seq] GSE178801 Transcriptome Analysis With high genetic heterogeneity in melanoma understanding epigenetic and transcriptional differences between melanocytes and melanoma cells will enable further understanding of the genes pathways and epigenetic regions influencing melanoma development. We performed RNA seq and ATAC seq on fluorescently isolated melanocytes and melanoma cells from a zebrafish melanoma model. Overall design: RNA seq profiles of FACS isolated mitfa:mCherry reporter positive melanocytes and crestin:GFP positive melanoma cells from adult zebrafish D. rerio. parent bioproject:PRJNA741103 pubmed:34791221   MA3C RNAseq GSM5397960   source name:Sorted melanoma tumor|genotype:BRAFV600E/p53lf/lf/crestin:EGFP|tissue:Melanoma MA3C RNAseq Assess read quality with FastQC Align to GRCz11/danRer11 using STAR Quantify transcriptome using RSEM Normalize reads with DESeq2 Genome build: danRer11 Supplementary files format and content: tab delimited text files with CPM values for each sample Supplementary files format and content: tab delimited text files with RPKM values for each sample Supplementary files format and content: Excel spreadsheet summarizing log2FC values between melanocytes and melanoma cells as well as Sorted melanoma tumor   FACS for fluorescent tag: mCherry for melanocytes MC and GFP for melanoma cells MA then use Machery Nagel kit to extract total RNA cDNA generated using Clontech SMARTer cDNA amplification kit   genotype:BRAFV600E/p53lf/lf/crestin:EGFP|tissue:Melanoma|run #:1 GSM5397960 GSM5397960: MA3C RNAseq; Danio rerio; RNA Seq GSM5397960   1 FACS for fluorescent tag: mCherry for melanocytes MC and GFP for melanoma cells MA then use Machery Nagel kit to extract total RNA cDNA generated using Clontech SMARTer cDNA amplification kit GEO Accession:GSM5397960 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2500   SRP325444     MA3C.fq.gz fastq 1678480250.0 33569605.0 GSM5397960 r1 0:50 1:0 A:463941895;C:370163467;G:364477555;T:478705617;N:1191716 50 0     463941895 370163467 364477555 478705617 1191716 SRX11217415 SRS9271514 SRA1250059 GEO Kaufman, Oncology, Washington University in St. Louis 1 0.90303   0.16625   0.74696   0.55133   50   B   usable mapping rate illumina hiseq_era full_length cdna_unspecified smarter bulk unknown unknown   United States 2021-06-24 Undetermined Adult Cancer or Tumor Cancer or Tumor
65014 65014 SRR14902692 SRX11217414 SRS9271513 SRP325444 PRJNA741108 Transcriptional Profile in Zebrafish Melanocytes and Melanoma Tumors [RNA seq] GSE178801 Transcriptome Analysis With high genetic heterogeneity in melanoma understanding epigenetic and transcriptional differences between melanocytes and melanoma cells will enable further understanding of the genes pathways and epigenetic regions influencing melanoma development. We performed RNA seq and ATAC seq on fluorescently isolated melanocytes and melanoma cells from a zebrafish melanoma model. Overall design: RNA seq profiles of FACS isolated mitfa:mCherry reporter positive melanocytes and crestin:GFP positive melanoma cells from adult zebrafish D. rerio. parent bioproject:PRJNA741103 pubmed:34791221   MA3B RNAseq GSM5397959   source name:Sorted melanoma tumor|genotype:BRAFV600E/p53lf/lf/crestin:EGFP|tissue:Melanoma MA3B RNAseq Assess read quality with FastQC Align to GRCz11/danRer11 using STAR Quantify transcriptome using RSEM Normalize reads with DESeq2 Genome build: danRer11 Supplementary files format and content: tab delimited text files with CPM values for each sample Supplementary files format and content: tab delimited text files with RPKM values for each sample Supplementary files format and content: Excel spreadsheet summarizing log2FC values between melanocytes and melanoma cells as well as Sorted melanoma tumor   FACS for fluorescent tag: mCherry for melanocytes MC and GFP for melanoma cells MA then use Machery Nagel kit to extract total RNA cDNA generated using Clontech SMARTer cDNA amplification kit   genotype:BRAFV600E/p53lf/lf/crestin:EGFP|tissue:Melanoma|run #:1 GSM5397959 GSM5397959: MA3B RNAseq; Danio rerio; RNA Seq GSM5397959   1 FACS for fluorescent tag: mCherry for melanocytes MC and GFP for melanoma cells MA then use Machery Nagel kit to extract total RNA cDNA generated using Clontech SMARTer cDNA amplification kit GEO Accession:GSM5397959 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2500   SRP325444     MA3B.fq.gz fastq 1437189100.0 28743782.0 GSM5397959 r1 0:50 1:0 A:398259972;C:317724608;G:311519412;T:408662664;N:1022444 50 0     398259972 317724608 311519412 408662664 1022444 SRX11217414 SRS9271513 SRA1250059 GEO Kaufman, Oncology, Washington University in St. Louis 1 0.89689   0.14892   0.73959   0.52927   50   B   usable mapping rate illumina hiseq_era full_length cdna_unspecified smarter bulk unknown unknown   United States 2021-06-24 Undetermined Adult Cancer or Tumor Cancer or Tumor
65015 65015 SRR14902691 SRX11217413 SRS9271512 SRP325444 PRJNA741108 Transcriptional Profile in Zebrafish Melanocytes and Melanoma Tumors [RNA seq] GSE178801 Transcriptome Analysis With high genetic heterogeneity in melanoma understanding epigenetic and transcriptional differences between melanocytes and melanoma cells will enable further understanding of the genes pathways and epigenetic regions influencing melanoma development. We performed RNA seq and ATAC seq on fluorescently isolated melanocytes and melanoma cells from a zebrafish melanoma model. Overall design: RNA seq profiles of FACS isolated mitfa:mCherry reporter positive melanocytes and crestin:GFP positive melanoma cells from adult zebrafish D. rerio. parent bioproject:PRJNA741103 pubmed:34791221   MA3A RNAseq GSM5397958   source name:Sorted melanoma tumor|genotype:BRAFV600E/p53lf/lf/crestin:EGFP|tissue:Melanoma MA3A RNAseq Assess read quality with FastQC Align to GRCz11/danRer11 using STAR Quantify transcriptome using RSEM Normalize reads with DESeq2 Genome build: danRer11 Supplementary files format and content: tab delimited text files with CPM values for each sample Supplementary files format and content: tab delimited text files with RPKM values for each sample Supplementary files format and content: Excel spreadsheet summarizing log2FC values between melanocytes and melanoma cells as well as Sorted melanoma tumor   FACS for fluorescent tag: mCherry for melanocytes MC and GFP for melanoma cells MA then use Machery Nagel kit to extract total RNA cDNA generated using Clontech SMARTer cDNA amplification kit   genotype:BRAFV600E/p53lf/lf/crestin:EGFP|tissue:Melanoma|run #:1 GSM5397958 GSM5397958: MA3A RNAseq; Danio rerio; RNA Seq GSM5397958   1 FACS for fluorescent tag: mCherry for melanocytes MC and GFP for melanoma cells MA then use Machery Nagel kit to extract total RNA cDNA generated using Clontech SMARTer cDNA amplification kit GEO Accession:GSM5397958 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2500   SRP325444     MA3A.fq.gz fastq 1442377200.0 28847544.0 GSM5397958 r1 0:50 1:0 A:405524842;C:314014451;G:304964281;T:416845768;N:1027858 50 0     405524842 314014451 304964281 416845768 1027858 SRX11217413 SRS9271512 SRA1250059 GEO Kaufman, Oncology, Washington University in St. Louis 1 0.88956   0.1683   0.74018   0.52927   50   B   usable mapping rate illumina hiseq_era full_length cdna_unspecified smarter bulk unknown unknown   United States 2021-06-24 Undetermined Adult Cancer or Tumor Cancer or Tumor
65016 65016 SRR14902690 SRX11217412 SRS9271511 SRP325444 PRJNA741108 Transcriptional Profile in Zebrafish Melanocytes and Melanoma Tumors [RNA seq] GSE178801 Transcriptome Analysis With high genetic heterogeneity in melanoma understanding epigenetic and transcriptional differences between melanocytes and melanoma cells will enable further understanding of the genes pathways and epigenetic regions influencing melanoma development. We performed RNA seq and ATAC seq on fluorescently isolated melanocytes and melanoma cells from a zebrafish melanoma model. Overall design: RNA seq profiles of FACS isolated mitfa:mCherry reporter positive melanocytes and crestin:GFP positive melanoma cells from adult zebrafish D. rerio. parent bioproject:PRJNA741103 pubmed:34791221   MA2 RNAseq GSM5397957   source name:Sorted melanoma tumor|genotype:BRAFV600E/p53lf/lf/crestin:EGFP|tissue:Melanoma MA2 RNAseq Assess read quality with FastQC Align to GRCz11/danRer11 using STAR Quantify transcriptome using RSEM Normalize reads with DESeq2 Genome build: danRer11 Supplementary files format and content: tab delimited text files with CPM values for each sample Supplementary files format and content: tab delimited text files with RPKM values for each sample Supplementary files format and content: Excel spreadsheet summarizing log2FC values between melanocytes and melanoma cells as well as Sorted melanoma tumor   FACS for fluorescent tag: mCherry for melanocytes MC and GFP for melanoma cells MA then use Machery Nagel kit to extract total RNA cDNA generated using Clontech SMARTer cDNA amplification kit   genotype:BRAFV600E/p53lf/lf/crestin:EGFP|tissue:Melanoma|run #:1 GSM5397957 GSM5397957: MA2 RNAseq; Danio rerio; RNA Seq GSM5397957   1 FACS for fluorescent tag: mCherry for melanocytes MC and GFP for melanoma cells MA then use Machery Nagel kit to extract total RNA cDNA generated using Clontech SMARTer cDNA amplification kit GEO Accession:GSM5397957 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2500   SRP325444     MA2.fq.gz fastq 1402279300.0 28045586.0 GSM5397957 r1 0:50 1:0 A:389166788;C:306462364;G:298729361;T:406923403;N:997384 50 0     389166788 306462364 298729361 406923403 997384 SRX11217412 SRS9271511 SRA1250059 GEO Kaufman, Oncology, Washington University in St. Louis 1 0.88844   0.14383   0.74923   0.53282   50   B   usable mapping rate illumina hiseq_era full_length cdna_unspecified smarter bulk unknown unknown   United States 2021-06-24 Undetermined Adult Cancer or Tumor Cancer or Tumor
65017 65017 SRR14902689 SRX11217411 SRS9271510 SRP325444 PRJNA741108 Transcriptional Profile in Zebrafish Melanocytes and Melanoma Tumors [RNA seq] GSE178801 Transcriptome Analysis With high genetic heterogeneity in melanoma understanding epigenetic and transcriptional differences between melanocytes and melanoma cells will enable further understanding of the genes pathways and epigenetic regions influencing melanoma development. We performed RNA seq and ATAC seq on fluorescently isolated melanocytes and melanoma cells from a zebrafish melanoma model. Overall design: RNA seq profiles of FACS isolated mitfa:mCherry reporter positive melanocytes and crestin:GFP positive melanoma cells from adult zebrafish D. rerio. parent bioproject:PRJNA741103 pubmed:34791221   MA1 RNAseq GSM5397956   source name:Sorted melanoma tumor|genotype:BRAFV600E/p53lf/lf/crestin:EGFP|tissue:Melanoma MA1 RNAseq Assess read quality with FastQC Align to GRCz11/danRer11 using STAR Quantify transcriptome using RSEM Normalize reads with DESeq2 Genome build: danRer11 Supplementary files format and content: tab delimited text files with CPM values for each sample Supplementary files format and content: tab delimited text files with RPKM values for each sample Supplementary files format and content: Excel spreadsheet summarizing log2FC values between melanocytes and melanoma cells as well as Sorted melanoma tumor   FACS for fluorescent tag: mCherry for melanocytes MC and GFP for melanoma cells MA then use Machery Nagel kit to extract total RNA cDNA generated using Clontech SMARTer cDNA amplification kit   genotype:BRAFV600E/p53lf/lf/crestin:EGFP|tissue:Melanoma|run #:1 GSM5397956 GSM5397956: MA1 RNAseq; Danio rerio; RNA Seq GSM5397956   1 FACS for fluorescent tag: mCherry for melanocytes MC and GFP for melanoma cells MA then use Machery Nagel kit to extract total RNA cDNA generated using Clontech SMARTer cDNA amplification kit GEO Accession:GSM5397956 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2500   SRP325444     MA1.fq.gz fastq 1456780700.0 29135614.0 GSM5397956 r1 0:50 1:0 A:403913103;C:308144749;G:305293739;T:438394612;N:1034497 50 0     403913103 308144749 305293739 438394612 1034497 SRX11217411 SRS9271510 SRA1250059 GEO Kaufman, Oncology, Washington University in St. Louis 1 0.85833   0.16781   0.73407   0.52469   50   B   usable mapping rate illumina hiseq_era full_length cdna_unspecified smarter bulk unknown unknown   United States 2021-06-24 Undetermined Adult Cancer or Tumor Cancer or Tumor
67037 67037 SRR17007607 SRX13197809 SRS11124869 SRP347244 PRJNA782626 Characterization of zebrafish melanoma derived interstitial EVs and their ncRNA content GSE189352 Transcriptome Analysis Extracellular vesicles EVs are membranous particles released by all cell types. Their role as functional carriers of bioactive molecules is boosted in cancer where they can be either secreted in biological fluids or found in the intercellular space interstitial EVs iEVs. Here we have opti mised a method for the isolation and characterization of zebrafish iEVs from whole melanoma tissues. Zebrafish melanoma iEVs are in the range of 140 nm by nanoparticle tracking analysis NTA and TEM analysis. Western blot revealed enrichment for CD63 and Alix in the iEV frac tion but not in melanoma cell lysates. Super resolution and confocal microscopy revealed that purified zebrafish iEVs were GFP+ indicating that they integrate the oncogene GFP HRASV12G within their vesicular membrane. Analysis of RNA Seq data revealed that 118 ncRNAs are differentially distributed between zebrafish melanoma and their iEVs with only 18 of them be ing selectively enriched in iEVs. Among these the RNA components of RNAses MRP and P which process ribosomal RNA precursors mitochondrial RNAs and some mRNAs were enriched in iEVs. We found that melanoma iEVs induce an inflammatory response when injected in larval blood stream with increase of macrophage and induction of Interferon Responsive Genes. To clarify whether MRP and P contribute to the inflammation induced by melanoma iEVs we inject ed larvae with MRP or P RNAs and found an inflammatory response similar to that induced by melanoma iEVs. This suggests that zebrafish melanoma iEVs are a source of MRP and P RNAs that can trigger inflammation in cells of the tumor microenvironment. Overall design: In order to identify small RNAs preferentially accumulated in extracellular vesicles derived from zebrafish melanoma we performed RNA sequencing analysis RNA Seq of small RNAs isolated from EVs and melanoma samples.   pubmed:35628321   VA 6 S6: EVs3 GSM5699732   tissue:EVs3|cell type:extracellular vesicles|strain:kita:RAS VA 6 S6: EVs3 Basecalls performed using CASAVA Illumina Inc. Reads were aligned to the reference genome Danio rerio assembly GRCz11 using STAR [PMID: 23104886] with recommended options and thresholds version 2.5. HTSeq count version 0.9.1 [PMID: 25260700 ] was used to generate raw gene counts. EdgeR package version 3.24.3 [PMID: 19910308] was used to normalize counts to Trimmed Mean of M values TMM for visualization methods. Differential expression analysis was performed using DESeq2 package version 1.22.2 and for significance testing the Wald test was used. Genome build: GRCz11 Supplementary files format and content: tab delimited text files include COUNTS values for each Sample EVs3   RNA extracts were collected from melanoma developing in adult zebrafish or from EVs isolated from the same tumors. Total RNA was isolated using Single Cell RNA Purification Kit Norgen following manufacturer’s instructions subjected to DNase I Thermo Fisher Scientific treatment and subsequently purified using phenol chloroform Libraries were constructed using Clontech SMARTer smRNA Seq kit. Libraries were sequenced on the Illumina HiSeq 2500 following the manufacturer's protocols. Melanomas were induced in developing zebrafish through the Gal4/UAS system using the kita:Gal4 driver line and the injection of a UAS:HRASV12G plasmid cell type:extracellular vesicles|strain:kita:RAS GSM5699732 GSM5699732: VA 6 S6: EVs3; Danio rerio; ncRNA Seq GSM5699732 r1 GSM5699732 1 RNA extracts were collected from melanoma developing in adult zebrafish or from EVs isolated from the same tumors. Total RNA was isolated using Single Cell RNA Purification Kit Norgen following manufacturer's instructions subjected to DNase I Thermo Fisher Scientific treatment and subsequently purified using phenol chloroform Libraries were constructed using Clontech SMARTer smRNA Seq kit. Libraries were sequenced on the Illumina HiSeq 2500 following the manufacturer's protocols.   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP347244   loader:fastq load.py VA_6_S6.fastq fastq 1252482921.0 12400821.0 GSM5699732 r1 0:101 A:419008099;C:291188018;G:325856780;T:216362198;N:67826 101       419008099 291188018 325856780 216362198 67826 SRX13197809 SRS11124869 SRA1429699 Experimental Cancer Biology, CIBIO, University of Trento Experimental Cancer Biology, CIBIO, University of Trento 1 0.39065   0.05651   0.9752   0.82248   101   B   usable mapping rate illumina hiseq_era full_length size_fractionation smarter bulk unknown unknown   Italy 2021-11-22 Adult Adult Cancer or Tumor Cancer or Tumor
67038 67038 SRR17007608 SRX13197808 SRS11124868 SRP347244 PRJNA782626 Characterization of zebrafish melanoma derived interstitial EVs and their ncRNA content GSE189352 Transcriptome Analysis Extracellular vesicles EVs are membranous particles released by all cell types. Their role as functional carriers of bioactive molecules is boosted in cancer where they can be either secreted in biological fluids or found in the intercellular space interstitial EVs iEVs. Here we have opti mised a method for the isolation and characterization of zebrafish iEVs from whole melanoma tissues. Zebrafish melanoma iEVs are in the range of 140 nm by nanoparticle tracking analysis NTA and TEM analysis. Western blot revealed enrichment for CD63 and Alix in the iEV frac tion but not in melanoma cell lysates. Super resolution and confocal microscopy revealed that purified zebrafish iEVs were GFP+ indicating that they integrate the oncogene GFP HRASV12G within their vesicular membrane. Analysis of RNA Seq data revealed that 118 ncRNAs are differentially distributed between zebrafish melanoma and their iEVs with only 18 of them be ing selectively enriched in iEVs. Among these the RNA components of RNAses MRP and P which process ribosomal RNA precursors mitochondrial RNAs and some mRNAs were enriched in iEVs. We found that melanoma iEVs induce an inflammatory response when injected in larval blood stream with increase of macrophage and induction of Interferon Responsive Genes. To clarify whether MRP and P contribute to the inflammation induced by melanoma iEVs we inject ed larvae with MRP or P RNAs and found an inflammatory response similar to that induced by melanoma iEVs. This suggests that zebrafish melanoma iEVs are a source of MRP and P RNAs that can trigger inflammation in cells of the tumor microenvironment. Overall design: In order to identify small RNAs preferentially accumulated in extracellular vesicles derived from zebrafish melanoma we performed RNA sequencing analysis RNA Seq of small RNAs isolated from EVs and melanoma samples.   pubmed:35628321   VA 5 S5: EVs2 GSM5699731   tissue:EVs2|cell type:extracellular vesicles|strain:kita:RAS VA 5 S5: EVs2 Basecalls performed using CASAVA Illumina Inc. Reads were aligned to the reference genome Danio rerio assembly GRCz11 using STAR [PMID: 23104886] with recommended options and thresholds version 2.5. HTSeq count version 0.9.1 [PMID: 25260700 ] was used to generate raw gene counts. EdgeR package version 3.24.3 [PMID: 19910308] was used to normalize counts to Trimmed Mean of M values TMM for visualization methods. Differential expression analysis was performed using DESeq2 package version 1.22.2 and for significance testing the Wald test was used. Genome build: GRCz11 Supplementary files format and content: tab delimited text files include COUNTS values for each Sample EVs2   RNA extracts were collected from melanoma developing in adult zebrafish or from EVs isolated from the same tumors. Total RNA was isolated using Single Cell RNA Purification Kit Norgen following manufacturer’s instructions subjected to DNase I Thermo Fisher Scientific treatment and subsequently purified using phenol chloroform Libraries were constructed using Clontech SMARTer smRNA Seq kit. Libraries were sequenced on the Illumina HiSeq 2500 following the manufacturer's protocols. Melanomas were induced in developing zebrafish through the Gal4/UAS system using the kita:Gal4 driver line and the injection of a UAS:HRASV12G plasmid cell type:extracellular vesicles|strain:kita:RAS GSM5699731 GSM5699731: VA 5 S5: EVs2; Danio rerio; ncRNA Seq GSM5699731 r1 GSM5699731 1 RNA extracts were collected from melanoma developing in adult zebrafish or from EVs isolated from the same tumors. Total RNA was isolated using Single Cell RNA Purification Kit Norgen following manufacturer's instructions subjected to DNase I Thermo Fisher Scientific treatment and subsequently purified using phenol chloroform Libraries were constructed using Clontech SMARTer smRNA Seq kit. Libraries were sequenced on the Illumina HiSeq 2500 following the manufacturer's protocols.   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP347244   loader:fastq load.py VA_5_S5.fastq fastq 1338062039.0 13248139.0 GSM5699731 r1 0:101 A:479478471;C:303639439;G:333339820;T:221533029;N:71280 101       479478471 303639439 333339820 221533029 71280 SRX13197808 SRS11124868 SRA1429699 Experimental Cancer Biology, CIBIO, University of Trento Experimental Cancer Biology, CIBIO, University of Trento 1 0.20158   0.0338   0.98979   0.73724   101   B   usable mapping rate illumina hiseq_era full_length size_fractionation smarter bulk unknown unknown   Italy 2021-11-22 Adult Adult Cancer or Tumor Cancer or Tumor
67039 67039 SRR17007609 SRX13197807 SRS11124867 SRP347244 PRJNA782626 Characterization of zebrafish melanoma derived interstitial EVs and their ncRNA content GSE189352 Transcriptome Analysis Extracellular vesicles EVs are membranous particles released by all cell types. Their role as functional carriers of bioactive molecules is boosted in cancer where they can be either secreted in biological fluids or found in the intercellular space interstitial EVs iEVs. Here we have opti mised a method for the isolation and characterization of zebrafish iEVs from whole melanoma tissues. Zebrafish melanoma iEVs are in the range of 140 nm by nanoparticle tracking analysis NTA and TEM analysis. Western blot revealed enrichment for CD63 and Alix in the iEV frac tion but not in melanoma cell lysates. Super resolution and confocal microscopy revealed that purified zebrafish iEVs were GFP+ indicating that they integrate the oncogene GFP HRASV12G within their vesicular membrane. Analysis of RNA Seq data revealed that 118 ncRNAs are differentially distributed between zebrafish melanoma and their iEVs with only 18 of them be ing selectively enriched in iEVs. Among these the RNA components of RNAses MRP and P which process ribosomal RNA precursors mitochondrial RNAs and some mRNAs were enriched in iEVs. We found that melanoma iEVs induce an inflammatory response when injected in larval blood stream with increase of macrophage and induction of Interferon Responsive Genes. To clarify whether MRP and P contribute to the inflammation induced by melanoma iEVs we inject ed larvae with MRP or P RNAs and found an inflammatory response similar to that induced by melanoma iEVs. This suggests that zebrafish melanoma iEVs are a source of MRP and P RNAs that can trigger inflammation in cells of the tumor microenvironment. Overall design: In order to identify small RNAs preferentially accumulated in extracellular vesicles derived from zebrafish melanoma we performed RNA sequencing analysis RNA Seq of small RNAs isolated from EVs and melanoma samples.   pubmed:35628321   VA 4 S4: EVs1 GSM5699730   tissue:EVs1|cell type:extracellular vesicles|strain:kita:RAS VA 4 S4: EVs1 Basecalls performed using CASAVA Illumina Inc. Reads were aligned to the reference genome Danio rerio assembly GRCz11 using STAR [PMID: 23104886] with recommended options and thresholds version 2.5. HTSeq count version 0.9.1 [PMID: 25260700 ] was used to generate raw gene counts. EdgeR package version 3.24.3 [PMID: 19910308] was used to normalize counts to Trimmed Mean of M values TMM for visualization methods. Differential expression analysis was performed using DESeq2 package version 1.22.2 and for significance testing the Wald test was used. Genome build: GRCz11 Supplementary files format and content: tab delimited text files include COUNTS values for each Sample EVs1   RNA extracts were collected from melanoma developing in adult zebrafish or from EVs isolated from the same tumors. Total RNA was isolated using Single Cell RNA Purification Kit Norgen following manufacturer’s instructions subjected to DNase I Thermo Fisher Scientific treatment and subsequently purified using phenol chloroform Libraries were constructed using Clontech SMARTer smRNA Seq kit. Libraries were sequenced on the Illumina HiSeq 2500 following the manufacturer's protocols. Melanomas were induced in developing zebrafish through the Gal4/UAS system using the kita:Gal4 driver line and the injection of a UAS:HRASV12G plasmid cell type:extracellular vesicles|strain:kita:RAS GSM5699730 GSM5699730: VA 4 S4: EVs1; Danio rerio; ncRNA Seq GSM5699730 r1 GSM5699730 1 RNA extracts were collected from melanoma developing in adult zebrafish or from EVs isolated from the same tumors. Total RNA was isolated using Single Cell RNA Purification Kit Norgen following manufacturer's instructions subjected to DNase I Thermo Fisher Scientific treatment and subsequently purified using phenol chloroform Libraries were constructed using Clontech SMARTer smRNA Seq kit. Libraries were sequenced on the Illumina HiSeq 2500 following the manufacturer's protocols.   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP347244   loader:fastq load.py VA_4_S4.fastq fastq 1355391215.0 13419715.0 GSM5699730 r1 0:101 A:480538643;C:302531816;G:333018117;T:239227931;N:74708 101       480538643 302531816 333018117 239227931 74708 SRX13197807 SRS11124867 SRA1429699 Experimental Cancer Biology, CIBIO, University of Trento Experimental Cancer Biology, CIBIO, University of Trento 1 0.15363   0.03047   0.98563   0.85818   101   B   usable mapping rate illumina hiseq_era full_length size_fractionation smarter bulk unknown unknown   Italy 2021-11-22 Adult Adult Cancer or Tumor Cancer or Tumor
67040 67040 SRR17007610 SRX13197806 SRS11124866 SRP347244 PRJNA782626 Characterization of zebrafish melanoma derived interstitial EVs and their ncRNA content GSE189352 Transcriptome Analysis Extracellular vesicles EVs are membranous particles released by all cell types. Their role as functional carriers of bioactive molecules is boosted in cancer where they can be either secreted in biological fluids or found in the intercellular space interstitial EVs iEVs. Here we have opti mised a method for the isolation and characterization of zebrafish iEVs from whole melanoma tissues. Zebrafish melanoma iEVs are in the range of 140 nm by nanoparticle tracking analysis NTA and TEM analysis. Western blot revealed enrichment for CD63 and Alix in the iEV frac tion but not in melanoma cell lysates. Super resolution and confocal microscopy revealed that purified zebrafish iEVs were GFP+ indicating that they integrate the oncogene GFP HRASV12G within their vesicular membrane. Analysis of RNA Seq data revealed that 118 ncRNAs are differentially distributed between zebrafish melanoma and their iEVs with only 18 of them be ing selectively enriched in iEVs. Among these the RNA components of RNAses MRP and P which process ribosomal RNA precursors mitochondrial RNAs and some mRNAs were enriched in iEVs. We found that melanoma iEVs induce an inflammatory response when injected in larval blood stream with increase of macrophage and induction of Interferon Responsive Genes. To clarify whether MRP and P contribute to the inflammation induced by melanoma iEVs we inject ed larvae with MRP or P RNAs and found an inflammatory response similar to that induced by melanoma iEVs. This suggests that zebrafish melanoma iEVs are a source of MRP and P RNAs that can trigger inflammation in cells of the tumor microenvironment. Overall design: In order to identify small RNAs preferentially accumulated in extracellular vesicles derived from zebrafish melanoma we performed RNA sequencing analysis RNA Seq of small RNAs isolated from EVs and melanoma samples.   pubmed:35628321   VA 24 S14: Melanoma3 GSM5699729   tissue:Melanoma3|cell type:Melanocytes|strain:kita:RAS VA 24 S14: Melanoma3 Basecalls performed using CASAVA Illumina Inc. Reads were aligned to the reference genome Danio rerio assembly GRCz11 using STAR [PMID: 23104886] with recommended options and thresholds version 2.5. HTSeq count version 0.9.1 [PMID: 25260700 ] was used to generate raw gene counts. EdgeR package version 3.24.3 [PMID: 19910308] was used to normalize counts to Trimmed Mean of M values TMM for visualization methods. Differential expression analysis was performed using DESeq2 package version 1.22.2 and for significance testing the Wald test was used. Genome build: GRCz11 Supplementary files format and content: tab delimited text files include COUNTS values for each Sample Melanoma3   RNA extracts were collected from melanoma developing in adult zebrafish or from EVs isolated from the same tumors. Total RNA was isolated using Single Cell RNA Purification Kit Norgen following manufacturer’s instructions subjected to DNase I Thermo Fisher Scientific treatment and subsequently purified using phenol chloroform Libraries were constructed using Clontech SMARTer smRNA Seq kit. Libraries were sequenced on the Illumina HiSeq 2500 following the manufacturer's protocols. Melanomas were induced in developing zebrafish through the Gal4/UAS system using the kita:Gal4 driver line and the injection of a UAS:HRASV12G plasmid cell type:Melanocytes|strain:kita:RAS GSM5699729 GSM5699729: VA 24 S14: Melanoma3; Danio rerio; ncRNA Seq GSM5699729 r1 GSM5699729 1 RNA extracts were collected from melanoma developing in adult zebrafish or from EVs isolated from the same tumors. Total RNA was isolated using Single Cell RNA Purification Kit Norgen following manufacturer's instructions subjected to DNase I Thermo Fisher Scientific treatment and subsequently purified using phenol chloroform Libraries were constructed using Clontech SMARTer smRNA Seq kit. Libraries were sequenced on the Illumina HiSeq 2500 following the manufacturer's protocols.   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP347244   loader:fastq load.py VA_24_S14.fastq fastq 1029043954.0 10188554.0 GSM5699729 r1 0:101 A:385266918;C:235984418;G:223100119;T:184638731;N:53768 101       385266918 235984418 223100119 184638731 53768 SRX13197806 SRS11124866 SRA1429699 Experimental Cancer Biology, CIBIO, University of Trento Experimental Cancer Biology, CIBIO, University of Trento 1 0.31444   0.04431   0.97477   0.79077   101   B   usable mapping rate illumina hiseq_era full_length size_fractionation smarter bulk unknown unknown   Italy 2021-11-22 Adult Adult Cancer or Tumor Cancer or Tumor
67041 67041 SRR17007611 SRX13197805 SRS11124865 SRP347244 PRJNA782626 Characterization of zebrafish melanoma derived interstitial EVs and their ncRNA content GSE189352 Transcriptome Analysis Extracellular vesicles EVs are membranous particles released by all cell types. Their role as functional carriers of bioactive molecules is boosted in cancer where they can be either secreted in biological fluids or found in the intercellular space interstitial EVs iEVs. Here we have opti mised a method for the isolation and characterization of zebrafish iEVs from whole melanoma tissues. Zebrafish melanoma iEVs are in the range of 140 nm by nanoparticle tracking analysis NTA and TEM analysis. Western blot revealed enrichment for CD63 and Alix in the iEV frac tion but not in melanoma cell lysates. Super resolution and confocal microscopy revealed that purified zebrafish iEVs were GFP+ indicating that they integrate the oncogene GFP HRASV12G within their vesicular membrane. Analysis of RNA Seq data revealed that 118 ncRNAs are differentially distributed between zebrafish melanoma and their iEVs with only 18 of them be ing selectively enriched in iEVs. Among these the RNA components of RNAses MRP and P which process ribosomal RNA precursors mitochondrial RNAs and some mRNAs were enriched in iEVs. We found that melanoma iEVs induce an inflammatory response when injected in larval blood stream with increase of macrophage and induction of Interferon Responsive Genes. To clarify whether MRP and P contribute to the inflammation induced by melanoma iEVs we inject ed larvae with MRP or P RNAs and found an inflammatory response similar to that induced by melanoma iEVs. This suggests that zebrafish melanoma iEVs are a source of MRP and P RNAs that can trigger inflammation in cells of the tumor microenvironment. Overall design: In order to identify small RNAs preferentially accumulated in extracellular vesicles derived from zebrafish melanoma we performed RNA sequencing analysis RNA Seq of small RNAs isolated from EVs and melanoma samples.   pubmed:35628321   VA 23 S13: Melanoma2 GSM5699728   tissue:Melanoma2|cell type:Melanocytes|strain:kita:RAS VA 23 S13: Melanoma2 Basecalls performed using CASAVA Illumina Inc. Reads were aligned to the reference genome Danio rerio assembly GRCz11 using STAR [PMID: 23104886] with recommended options and thresholds version 2.5. HTSeq count version 0.9.1 [PMID: 25260700 ] was used to generate raw gene counts. EdgeR package version 3.24.3 [PMID: 19910308] was used to normalize counts to Trimmed Mean of M values TMM for visualization methods. Differential expression analysis was performed using DESeq2 package version 1.22.2 and for significance testing the Wald test was used. Genome build: GRCz11 Supplementary files format and content: tab delimited text files include COUNTS values for each Sample Melanoma2   RNA extracts were collected from melanoma developing in adult zebrafish or from EVs isolated from the same tumors. Total RNA was isolated using Single Cell RNA Purification Kit Norgen following manufacturer’s instructions subjected to DNase I Thermo Fisher Scientific treatment and subsequently purified using phenol chloroform Libraries were constructed using Clontech SMARTer smRNA Seq kit. Libraries were sequenced on the Illumina HiSeq 2500 following the manufacturer's protocols. Melanomas were induced in developing zebrafish through the Gal4/UAS system using the kita:Gal4 driver line and the injection of a UAS:HRASV12G plasmid cell type:Melanocytes|strain:kita:RAS GSM5699728 GSM5699728: VA 23 S13: Melanoma2; Danio rerio; ncRNA Seq GSM5699728 r1 GSM5699728 1 RNA extracts were collected from melanoma developing in adult zebrafish or from EVs isolated from the same tumors. Total RNA was isolated using Single Cell RNA Purification Kit Norgen following manufacturer's instructions subjected to DNase I Thermo Fisher Scientific treatment and subsequently purified using phenol chloroform Libraries were constructed using Clontech SMARTer smRNA Seq kit. Libraries were sequenced on the Illumina HiSeq 2500 following the manufacturer's protocols.   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP347244   loader:fastq load.py VA_23_S13.fastq fastq 1191776669.0 11799769.0 GSM5699728 r1 0:101 A:445740725;C:275311735;G:268819689;T:201841457;N:63063 101       445740725 275311735 268819689 201841457 63063 SRX13197805 SRS11124865 SRA1429699 Experimental Cancer Biology, CIBIO, University of Trento Experimental Cancer Biology, CIBIO, University of Trento 1 0.3168   0.04419   0.96978   0.837   101   B   usable mapping rate illumina hiseq_era full_length size_fractionation smarter bulk unknown unknown   Italy 2021-11-22 Adult Adult Cancer or Tumor Cancer or Tumor
67042 67042 SRR17007612 SRX13197804 SRS11124864 SRP347244 PRJNA782626 Characterization of zebrafish melanoma derived interstitial EVs and their ncRNA content GSE189352 Transcriptome Analysis Extracellular vesicles EVs are membranous particles released by all cell types. Their role as functional carriers of bioactive molecules is boosted in cancer where they can be either secreted in biological fluids or found in the intercellular space interstitial EVs iEVs. Here we have opti mised a method for the isolation and characterization of zebrafish iEVs from whole melanoma tissues. Zebrafish melanoma iEVs are in the range of 140 nm by nanoparticle tracking analysis NTA and TEM analysis. Western blot revealed enrichment for CD63 and Alix in the iEV frac tion but not in melanoma cell lysates. Super resolution and confocal microscopy revealed that purified zebrafish iEVs were GFP+ indicating that they integrate the oncogene GFP HRASV12G within their vesicular membrane. Analysis of RNA Seq data revealed that 118 ncRNAs are differentially distributed between zebrafish melanoma and their iEVs with only 18 of them be ing selectively enriched in iEVs. Among these the RNA components of RNAses MRP and P which process ribosomal RNA precursors mitochondrial RNAs and some mRNAs were enriched in iEVs. We found that melanoma iEVs induce an inflammatory response when injected in larval blood stream with increase of macrophage and induction of Interferon Responsive Genes. To clarify whether MRP and P contribute to the inflammation induced by melanoma iEVs we inject ed larvae with MRP or P RNAs and found an inflammatory response similar to that induced by melanoma iEVs. This suggests that zebrafish melanoma iEVs are a source of MRP and P RNAs that can trigger inflammation in cells of the tumor microenvironment. Overall design: In order to identify small RNAs preferentially accumulated in extracellular vesicles derived from zebrafish melanoma we performed RNA sequencing analysis RNA Seq of small RNAs isolated from EVs and melanoma samples.   pubmed:35628321   VA 22 S12: Melanoma1 GSM5699727   tissue:Melanoma1|cell type:Melanocytes|strain:Kita:RAS VA 22 S12: Melanoma1 Basecalls performed using CASAVA Illumina Inc. Reads were aligned to the reference genome Danio rerio assembly GRCz11 using STAR [PMID: 23104886] with recommended options and thresholds version 2.5. HTSeq count version 0.9.1 [PMID: 25260700 ] was used to generate raw gene counts. EdgeR package version 3.24.3 [PMID: 19910308] was used to normalize counts to Trimmed Mean of M values TMM for visualization methods. Differential expression analysis was performed using DESeq2 package version 1.22.2 and for significance testing the Wald test was used. Genome build: GRCz11 Supplementary files format and content: tab delimited text files include COUNTS values for each Sample Melanoma1   RNA extracts were collected from melanoma developing in adult zebrafish or from EVs isolated from the same tumors. Total RNA was isolated using Single Cell RNA Purification Kit Norgen following manufacturer’s instructions subjected to DNase I Thermo Fisher Scientific treatment and subsequently purified using phenol chloroform Libraries were constructed using Clontech SMARTer smRNA Seq kit. Libraries were sequenced on the Illumina HiSeq 2500 following the manufacturer's protocols. Melanomas were induced in developing zebrafish through the Gal4/UAS system using the kita:Gal4 driver line and the injection of a UAS:HRASV12G plasmid cell type:Melanocytes|strain:Kita:RAS GSM5699727 GSM5699727: VA 22 S12: Melanoma1; Danio rerio; ncRNA Seq GSM5699727 r1 GSM5699727 1 RNA extracts were collected from melanoma developing in adult zebrafish or from EVs isolated from the same tumors. Total RNA was isolated using Single Cell RNA Purification Kit Norgen following manufacturer's instructions subjected to DNase I Thermo Fisher Scientific treatment and subsequently purified using phenol chloroform Libraries were constructed using Clontech SMARTer smRNA Seq kit. Libraries were sequenced on the Illumina HiSeq 2500 following the manufacturer's protocols.   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina HiSeq 2500   SRP347244   loader:fastq load.py VA_22_S12.fastq fastq 849183861.0 8407761.0 GSM5699727 r1 0:101 A:315648935;C:198401378;G:181384813;T:153698818;N:49917 101       315648935 198401378 181384813 153698818 49917 SRX13197804 SRS11124864 SRA1429699 Experimental Cancer Biology, CIBIO, University of Trento Experimental Cancer Biology, CIBIO, University of Trento 1 0.37018   0.04901   0.96209   0.55085   101   B   usable mapping rate illumina hiseq_era full_length size_fractionation smarter bulk unknown unknown   Italy 2021-11-22 Adult Adult Cancer or Tumor Cancer or Tumor
67620 67620 SRR17219949 SRX13399948 SRS11303068 SRP350562 PRJNA788496 MITF deficiency accelerates GNAQ driven uveal melanoma GSE190802 Transcriptome Analysis Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator MITF is essential for both CM development and maintenance but its role in UM is largely unexplored. Here we use zebrafish models to dissect the key UM oncogenic signaling events and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways YAP and PLCß ERK was also investigated in this system and thus showed that while activated YAP YAPAA induced UM with high potency the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably mitfa deficiency was profoundly UM promoting dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably all of the mitfa / UM tumors including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa / fish displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively these data show that YAP signaling is the major mediator of UM and that MITF acts as bona fide tumor suppressor in UM in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L tp53 / mitfa / n=10; Tgmitfa:GNAQ Q209L mitfa / n=10; Tgmitfa:GNAQ Q209L tp53 / eye n=8; Tgmitfa:GNAQ Q209L tp53 / skin n=9; Tgmitfa:BRAF V600E tp…       Qp skin tumor 4 GSM5732243   source name:Qp skin tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor Qp skin tumor 4 NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24 RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset Qp skin tumor Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = 5’ biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’ where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies 5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’ where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyze…   genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor GSM5732243 GSM5732243: Qp skin tumor 4; Danio rerio; RNA Seq GSM5732243   1 Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = five prime biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries we… GEO Accession:GSM5732243 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP350562     D16-101283.fastq.gz fastq 122886760.0 3072169.0 GSM5732243 r1 0:40 A:41729821;C:25705614;G:27345231;T:28036062;N:70032 40       41729821 25705614 27345231 28036062 70032 SRX13399948 SRS11303068 SRA1343073 GEO Koch Institute 1 0.82784   0.32837   0.87756   0.66545   40   B   usable mapping rate illumina nextseq 3prime cdna_unspecified nextera bulk bulk bulk   Unknown 2021-12-13 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
67621 67621 SRR17219947 SRX13399947 SRS11303067 SRP350562 PRJNA788496 MITF deficiency accelerates GNAQ driven uveal melanoma GSE190802 Transcriptome Analysis Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator MITF is essential for both CM development and maintenance but its role in UM is largely unexplored. Here we use zebrafish models to dissect the key UM oncogenic signaling events and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways YAP and PLCß ERK was also investigated in this system and thus showed that while activated YAP YAPAA induced UM with high potency the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably mitfa deficiency was profoundly UM promoting dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably all of the mitfa / UM tumors including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa / fish displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively these data show that YAP signaling is the major mediator of UM and that MITF acts as bona fide tumor suppressor in UM in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L tp53 / mitfa / n=10; Tgmitfa:GNAQ Q209L mitfa / n=10; Tgmitfa:GNAQ Q209L tp53 / eye n=8; Tgmitfa:GNAQ Q209L tp53 / skin n=9; Tgmitfa:BRAF V600E tp…       Qp skin tumor 3 GSM5732242   source name:Qp skin tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor Qp skin tumor 3 NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24 RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset Qp skin tumor Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = 5’ biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’ where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies 5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’ where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyze…   genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor GSM5732242 GSM5732242: Qp skin tumor 3; Danio rerio; RNA Seq GSM5732242   1 Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = five prime biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries we… GEO Accession:GSM5732242 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP350562     D16-101282.fastq.gz fastq 283770840.0 7094271.0 GSM5732242 r1 0:40 A:98647149;C:57235772;G:60084594;T:67639169;N:164156 40       98647149 57235772 60084594 67639169 164156 SRX13399947 SRS11303067 SRA1343073 GEO Koch Institute 1 0.82456   0.20326   0.87194   0.65575   40   B   usable mapping rate illumina nextseq 3prime cdna_unspecified nextera bulk bulk bulk   Unknown 2021-12-13 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
67622 67622 SRR17219945 SRX13399946 SRS11303065 SRP350562 PRJNA788496 MITF deficiency accelerates GNAQ driven uveal melanoma GSE190802 Transcriptome Analysis Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator MITF is essential for both CM development and maintenance but its role in UM is largely unexplored. Here we use zebrafish models to dissect the key UM oncogenic signaling events and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways YAP and PLCß ERK was also investigated in this system and thus showed that while activated YAP YAPAA induced UM with high potency the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably mitfa deficiency was profoundly UM promoting dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably all of the mitfa / UM tumors including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa / fish displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively these data show that YAP signaling is the major mediator of UM and that MITF acts as bona fide tumor suppressor in UM in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L tp53 / mitfa / n=10; Tgmitfa:GNAQ Q209L mitfa / n=10; Tgmitfa:GNAQ Q209L tp53 / eye n=8; Tgmitfa:GNAQ Q209L tp53 / skin n=9; Tgmitfa:BRAF V600E tp…       Qp skin tumor 2 GSM5732241   source name:Qp skin tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor Qp skin tumor 2 NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24 RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset Qp skin tumor Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = 5’ biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’ where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies 5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’ where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyze…   genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor GSM5732241 GSM5732241: Qp skin tumor 2; Danio rerio; RNA Seq GSM5732241   1 Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = five prime biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries we… GEO Accession:GSM5732241 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP350562     D16-101281.fastq.gz fastq 187440520.0 4686013.0 GSM5732241 r1 0:40 A:64031749;C:38508754;G:39411330;T:45381562;N:107125 40       64031749 38508754 39411330 45381562 107125 SRX13399946 SRS11303065 SRA1343073 GEO Koch Institute 1 0.8171   0.15628   0.85593   0.5865   40   B   usable mapping rate illumina nextseq 3prime cdna_unspecified nextera bulk bulk bulk   Unknown 2021-12-13 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
67623 67623 SRR17219943 SRX13399945 SRS11303066 SRP350562 PRJNA788496 MITF deficiency accelerates GNAQ driven uveal melanoma GSE190802 Transcriptome Analysis Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator MITF is essential for both CM development and maintenance but its role in UM is largely unexplored. Here we use zebrafish models to dissect the key UM oncogenic signaling events and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways YAP and PLCß ERK was also investigated in this system and thus showed that while activated YAP YAPAA induced UM with high potency the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably mitfa deficiency was profoundly UM promoting dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably all of the mitfa / UM tumors including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa / fish displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively these data show that YAP signaling is the major mediator of UM and that MITF acts as bona fide tumor suppressor in UM in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L tp53 / mitfa / n=10; Tgmitfa:GNAQ Q209L mitfa / n=10; Tgmitfa:GNAQ Q209L tp53 / eye n=8; Tgmitfa:GNAQ Q209L tp53 / skin n=9; Tgmitfa:BRAF V600E tp…       Qp skin tumor 1 GSM5732240   source name:Qp skin tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor Qp skin tumor 1 NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24 RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset Qp skin tumor Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = 5’ biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’ where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies 5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’ where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyze…   genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor GSM5732240 GSM5732240: Qp skin tumor 1; Danio rerio; RNA Seq GSM5732240   1 Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = five prime biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries we… GEO Accession:GSM5732240 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP350562     D16-101280.fastq.gz fastq 118902800.0 2972570.0 GSM5732240 r1 0:40 A:41431989;C:24163332;G:24495495;T:28744442;N:67542 40       41431989 24163332 24495495 28744442 67542 SRX13399945 SRS11303066 SRA1343073 GEO Koch Institute 1 0.82006   0.15984   0.8604   0.56292   40   B   usable mapping rate illumina nextseq 3prime cdna_unspecified nextera bulk bulk bulk   Unknown 2021-12-13 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
67624 67624 SRR17219941 SRX13399944 SRS11303064 SRP350562 PRJNA788496 MITF deficiency accelerates GNAQ driven uveal melanoma GSE190802 Transcriptome Analysis Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator MITF is essential for both CM development and maintenance but its role in UM is largely unexplored. Here we use zebrafish models to dissect the key UM oncogenic signaling events and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways YAP and PLCß ERK was also investigated in this system and thus showed that while activated YAP YAPAA induced UM with high potency the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably mitfa deficiency was profoundly UM promoting dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably all of the mitfa / UM tumors including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa / fish displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively these data show that YAP signaling is the major mediator of UM and that MITF acts as bona fide tumor suppressor in UM in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L tp53 / mitfa / n=10; Tgmitfa:GNAQ Q209L mitfa / n=10; Tgmitfa:GNAQ Q209L tp53 / eye n=8; Tgmitfa:GNAQ Q209L tp53 / skin n=9; Tgmitfa:BRAF V600E tp…       Qp eye tumor 8 GSM5732239   source name:Qp eye tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:uveal melanoma tumor Qp eye tumor 8 NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24 RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset Qp eye tumor Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = 5’ biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’ where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies 5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’ where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyze…   genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:uveal melanoma tumor GSM5732239 GSM5732239: Qp eye tumor 8; Danio rerio; RNA Seq GSM5732239   1 Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = five prime biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries we… GEO Accession:GSM5732239 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP350562     D16-101279.fastq.gz fastq 146962160.0 3674054.0 GSM5732239 r1 0:40 A:50428551;C:30417822;G:31827580;T:34204334;N:83873 40       50428551 30417822 31827580 34204334 83873 SRX13399944 SRS11303064 SRA1343073 GEO Koch Institute 1 0.80609   0.25781   0.85583   0.63728   40   B   usable mapping rate illumina nextseq 3prime cdna_unspecified nextera bulk bulk bulk   Unknown 2021-12-13 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
67625 67625 SRR17219939 SRX13399943 SRS11303063 SRP350562 PRJNA788496 MITF deficiency accelerates GNAQ driven uveal melanoma GSE190802 Transcriptome Analysis Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator MITF is essential for both CM development and maintenance but its role in UM is largely unexplored. Here we use zebrafish models to dissect the key UM oncogenic signaling events and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways YAP and PLCß ERK was also investigated in this system and thus showed that while activated YAP YAPAA induced UM with high potency the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably mitfa deficiency was profoundly UM promoting dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably all of the mitfa / UM tumors including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa / fish displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively these data show that YAP signaling is the major mediator of UM and that MITF acts as bona fide tumor suppressor in UM in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L tp53 / mitfa / n=10; Tgmitfa:GNAQ Q209L mitfa / n=10; Tgmitfa:GNAQ Q209L tp53 / eye n=8; Tgmitfa:GNAQ Q209L tp53 / skin n=9; Tgmitfa:BRAF V600E tp…       Qp eye tumor 7 GSM5732238   source name:Qp eye tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:uveal melanoma tumor Qp eye tumor 7 NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24 RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset Qp eye tumor Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = 5’ biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’ where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies 5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’ where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyze…   genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:uveal melanoma tumor GSM5732238 GSM5732238: Qp eye tumor 7; Danio rerio; RNA Seq GSM5732238   1 Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = five prime biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries we… GEO Accession:GSM5732238 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP350562     D16-101278.fastq.gz fastq 215250880.0 5381272.0 GSM5732238 r1 0:40 A:75096682;C:43785266;G:46300057;T:49947139;N:121736 40       75096682 43785266 46300057 49947139 121736 SRX13399943 SRS11303063 SRA1343073 GEO Koch Institute 1 0.81371   0.25397   0.85815   0.65296   40   B   usable mapping rate illumina nextseq 3prime cdna_unspecified nextera bulk bulk bulk   Unknown 2021-12-13 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
67626 67626 SRR17219937 SRX13399942 SRS11303062 SRP350562 PRJNA788496 MITF deficiency accelerates GNAQ driven uveal melanoma GSE190802 Transcriptome Analysis Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator MITF is essential for both CM development and maintenance but its role in UM is largely unexplored. Here we use zebrafish models to dissect the key UM oncogenic signaling events and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways YAP and PLCß ERK was also investigated in this system and thus showed that while activated YAP YAPAA induced UM with high potency the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably mitfa deficiency was profoundly UM promoting dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably all of the mitfa / UM tumors including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa / fish displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively these data show that YAP signaling is the major mediator of UM and that MITF acts as bona fide tumor suppressor in UM in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L tp53 / mitfa / n=10; Tgmitfa:GNAQ Q209L mitfa / n=10; Tgmitfa:GNAQ Q209L tp53 / eye n=8; Tgmitfa:GNAQ Q209L tp53 / skin n=9; Tgmitfa:BRAF V600E tp…       Qp eye tumor 6 GSM5732237   source name:Qp eye tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:uveal melanoma tumor Qp eye tumor 6 NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24 RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset Qp eye tumor Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = 5’ biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’ where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies 5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’ where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyze…   genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:uveal melanoma tumor GSM5732237 GSM5732237: Qp eye tumor 6; Danio rerio; RNA Seq GSM5732237   1 Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = five prime biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries we… GEO Accession:GSM5732237 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP350562     D16-101277.fastq.gz fastq 148936240.0 3723406.0 GSM5732237 r1 0:40 A:49984372;C:31061474;G:32793566;T:35009887;N:86941 40       49984372 31061474 32793566 35009887 86941 SRX13399942 SRS11303062 SRA1343073 GEO Koch Institute 1 0.82112   0.28545   0.85527   0.64027   40   B   usable mapping rate illumina nextseq 3prime cdna_unspecified nextera bulk bulk bulk   Unknown 2021-12-13 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
67627 67627 SRR17219935 SRX13399941 SRS11303061 SRP350562 PRJNA788496 MITF deficiency accelerates GNAQ driven uveal melanoma GSE190802 Transcriptome Analysis Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator MITF is essential for both CM development and maintenance but its role in UM is largely unexplored. Here we use zebrafish models to dissect the key UM oncogenic signaling events and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways YAP and PLCß ERK was also investigated in this system and thus showed that while activated YAP YAPAA induced UM with high potency the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably mitfa deficiency was profoundly UM promoting dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably all of the mitfa / UM tumors including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa / fish displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively these data show that YAP signaling is the major mediator of UM and that MITF acts as bona fide tumor suppressor in UM in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L tp53 / mitfa / n=10; Tgmitfa:GNAQ Q209L mitfa / n=10; Tgmitfa:GNAQ Q209L tp53 / eye n=8; Tgmitfa:GNAQ Q209L tp53 / skin n=9; Tgmitfa:BRAF V600E tp…       Qp eye tumor 5 GSM5732236   source name:Qp eye tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:uveal melanoma tumor Qp eye tumor 5 NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24 RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset Qp eye tumor Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = 5’ biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’ where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies 5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’ where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyze…   genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:uveal melanoma tumor GSM5732236 GSM5732236: Qp eye tumor 5; Danio rerio; RNA Seq GSM5732236   1 Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = five prime biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries we… GEO Accession:GSM5732236 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP350562     D16-101276.fastq.gz fastq 54051040.0 1351276.0 GSM5732236 r1 0:40 A:18297537;C:11096954;G:11777149;T:12846946;N:32454 40       18297537 11096954 11777149 12846946 32454 SRX13399941 SRS11303061 SRA1343073 GEO Koch Institute 1 0.81006   0.30042   0.85072   0.63453   40   B   usable mapping rate illumina nextseq 3prime cdna_unspecified nextera bulk bulk bulk   Unknown 2021-12-13 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
67628 67628 SRR17219977 SRX13399940 SRS11303060 SRP350562 PRJNA788496 MITF deficiency accelerates GNAQ driven uveal melanoma GSE190802 Transcriptome Analysis Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator MITF is essential for both CM development and maintenance but its role in UM is largely unexplored. Here we use zebrafish models to dissect the key UM oncogenic signaling events and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways YAP and PLCß ERK was also investigated in this system and thus showed that while activated YAP YAPAA induced UM with high potency the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably mitfa deficiency was profoundly UM promoting dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably all of the mitfa / UM tumors including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa / fish displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively these data show that YAP signaling is the major mediator of UM and that MITF acts as bona fide tumor suppressor in UM in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L tp53 / mitfa / n=10; Tgmitfa:GNAQ Q209L mitfa / n=10; Tgmitfa:GNAQ Q209L tp53 / eye n=8; Tgmitfa:GNAQ Q209L tp53 / skin n=9; Tgmitfa:BRAF V600E tp…       Bp tumor 9 GSM5732257   source name:Bp tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:BRAF V600E|genotype:tp53 / |tissue:uveal melanoma tumor Bp tumor 9 NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24 RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset Bp tumor Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = 5’ biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’ where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies 5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’ where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyze…   genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:BRAF V600E|genotype:tp53 / |tissue:uveal melanoma tumor GSM5732257 GSM5732257: Bp tumor 9; Danio rerio; RNA Seq GSM5732257   1 Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = five prime biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries we… GEO Accession:GSM5732257 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP350562     D16-101299.fastq.gz fastq 210377040.0 5259426.0 GSM5732257 r1 0:40 A:74755471;C:40672211;G:42048467;T:52783767;N:117124 40       74755471 40672211 42048467 52783767 117124 SRX13399940 SRS11303060 SRA1343073 GEO Koch Institute 1 0.81918   0.19474   0.84352   0.58427   40   B   usable mapping rate illumina nextseq 3prime cdna_unspecified nextera bulk bulk bulk   Unknown 2021-12-13 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
67629 67629 SRR17219975 SRX13399939 SRS11303059 SRP350562 PRJNA788496 MITF deficiency accelerates GNAQ driven uveal melanoma GSE190802 Transcriptome Analysis Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator MITF is essential for both CM development and maintenance but its role in UM is largely unexplored. Here we use zebrafish models to dissect the key UM oncogenic signaling events and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways YAP and PLCß ERK was also investigated in this system and thus showed that while activated YAP YAPAA induced UM with high potency the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably mitfa deficiency was profoundly UM promoting dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably all of the mitfa / UM tumors including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa / fish displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively these data show that YAP signaling is the major mediator of UM and that MITF acts as bona fide tumor suppressor in UM in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L tp53 / mitfa / n=10; Tgmitfa:GNAQ Q209L mitfa / n=10; Tgmitfa:GNAQ Q209L tp53 / eye n=8; Tgmitfa:GNAQ Q209L tp53 / skin n=9; Tgmitfa:BRAF V600E tp…       Bp tumor 8 GSM5732256   source name:Bp tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:BRAF V600E|genotype:tp53 / |tissue:uveal melanoma tumor Bp tumor 8 NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24 RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset Bp tumor Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = 5’ biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’ where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies 5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’ where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyze…   genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:BRAF V600E|genotype:tp53 / |tissue:uveal melanoma tumor GSM5732256 GSM5732256: Bp tumor 8; Danio rerio; RNA Seq GSM5732256   1 Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = five prime biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries we… GEO Accession:GSM5732256 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP350562     D16-101298.fastq.gz fastq 61311760.0 1532794.0 GSM5732256 r1 0:40 A:21165931;C:12861878;G:13049767;T:14199958;N:34226 40       21165931 12861878 13049767 14199958 34226 SRX13399939 SRS11303059 SRA1343073 GEO Koch Institute 1 0.82689   0.32586   0.8829   0.64682   40   B   usable mapping rate illumina nextseq 3prime cdna_unspecified nextera bulk bulk bulk   Unknown 2021-12-13 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
67630 67630 SRR17219973 SRX13399938 SRS11303057 SRP350562 PRJNA788496 MITF deficiency accelerates GNAQ driven uveal melanoma GSE190802 Transcriptome Analysis Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator MITF is essential for both CM development and maintenance but its role in UM is largely unexplored. Here we use zebrafish models to dissect the key UM oncogenic signaling events and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways YAP and PLCß ERK was also investigated in this system and thus showed that while activated YAP YAPAA induced UM with high potency the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably mitfa deficiency was profoundly UM promoting dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably all of the mitfa / UM tumors including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa / fish displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively these data show that YAP signaling is the major mediator of UM and that MITF acts as bona fide tumor suppressor in UM in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L tp53 / mitfa / n=10; Tgmitfa:GNAQ Q209L mitfa / n=10; Tgmitfa:GNAQ Q209L tp53 / eye n=8; Tgmitfa:GNAQ Q209L tp53 / skin n=9; Tgmitfa:BRAF V600E tp…       Bp tumor 7 GSM5732255   source name:Bp tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:BRAF V600E|genotype:tp53 / |tissue:uveal melanoma tumor Bp tumor 7 NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24 RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset Bp tumor Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = 5’ biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’ where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies 5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’ where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyze…   genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:BRAF V600E|genotype:tp53 / |tissue:uveal melanoma tumor GSM5732255 GSM5732255: Bp tumor 7; Danio rerio; RNA Seq GSM5732255   1 Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = five prime biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries we… GEO Accession:GSM5732255 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP350562     D16-101297.fastq.gz fastq 77653280.0 1941332.0 GSM5732255 r1 0:40 A:25595564;C:16454184;G:17705274;T:17852242;N:46016 40       25595564 16454184 17705274 17852242 46016 SRX13399938 SRS11303057 SRA1343073 GEO Koch Institute 1 0.82555   0.35244   0.87414   0.64795   40   B   usable mapping rate illumina nextseq 3prime cdna_unspecified nextera bulk bulk bulk   Unknown 2021-12-13 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
67631 67631 SRR17219971 SRX13399937 SRS11303056 SRP350562 PRJNA788496 MITF deficiency accelerates GNAQ driven uveal melanoma GSE190802 Transcriptome Analysis Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator MITF is essential for both CM development and maintenance but its role in UM is largely unexplored. Here we use zebrafish models to dissect the key UM oncogenic signaling events and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways YAP and PLCß ERK was also investigated in this system and thus showed that while activated YAP YAPAA induced UM with high potency the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably mitfa deficiency was profoundly UM promoting dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably all of the mitfa / UM tumors including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa / fish displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively these data show that YAP signaling is the major mediator of UM and that MITF acts as bona fide tumor suppressor in UM in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L tp53 / mitfa / n=10; Tgmitfa:GNAQ Q209L mitfa / n=10; Tgmitfa:GNAQ Q209L tp53 / eye n=8; Tgmitfa:GNAQ Q209L tp53 / skin n=9; Tgmitfa:BRAF V600E tp…       Bp tumor 6 GSM5732254   source name:Bp tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:BRAF V600E|genotype:tp53 / |tissue:uveal melanoma tumor Bp tumor 6 NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24 RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset Bp tumor Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = 5’ biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’ where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies 5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’ where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyze…   genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:BRAF V600E|genotype:tp53 / |tissue:uveal melanoma tumor GSM5732254 GSM5732254: Bp tumor 6; Danio rerio; RNA Seq GSM5732254   1 Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = five prime biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries we… GEO Accession:GSM5732254 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP350562     D16-101296.fastq.gz fastq 153995840.0 3849896.0 GSM5732254 r1 0:40 A:54845937;C:30246084;G:30853649;T:37960198;N:89972 40       54845937 30246084 30853649 37960198 89972 SRX13399937 SRS11303056 SRA1343073 GEO Koch Institute 1 0.81951   0.24749   0.85492   0.63444   40   B   usable mapping rate illumina nextseq 3prime cdna_unspecified nextera bulk bulk bulk   Unknown 2021-12-13 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
67632 67632 SRR17219969 SRX13399936 SRS11303058 SRP350562 PRJNA788496 MITF deficiency accelerates GNAQ driven uveal melanoma GSE190802 Transcriptome Analysis Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator MITF is essential for both CM development and maintenance but its role in UM is largely unexplored. Here we use zebrafish models to dissect the key UM oncogenic signaling events and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways YAP and PLCß ERK was also investigated in this system and thus showed that while activated YAP YAPAA induced UM with high potency the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably mitfa deficiency was profoundly UM promoting dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably all of the mitfa / UM tumors including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa / fish displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively these data show that YAP signaling is the major mediator of UM and that MITF acts as bona fide tumor suppressor in UM in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L tp53 / mitfa / n=10; Tgmitfa:GNAQ Q209L mitfa / n=10; Tgmitfa:GNAQ Q209L tp53 / eye n=8; Tgmitfa:GNAQ Q209L tp53 / skin n=9; Tgmitfa:BRAF V600E tp…       Bp tumor 5 GSM5732253   source name:Bp tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:BRAF V600E|genotype:tp53 / |tissue:uveal melanoma tumor Bp tumor 5 NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24 RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset Bp tumor Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = 5’ biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’ where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies 5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’ where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyze…   genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:BRAF V600E|genotype:tp53 / |tissue:uveal melanoma tumor GSM5732253 GSM5732253: Bp tumor 5; Danio rerio; RNA Seq GSM5732253   1 Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = five prime biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries we… GEO Accession:GSM5732253 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP350562     D16-101295.fastq.gz fastq 145077520.0 3626938.0 GSM5732253 r1 0:40 A:50896676;C:28947088;G:29778646;T:35373335;N:81775 40       50896676 28947088 29778646 35373335 81775 SRX13399936 SRS11303058 SRA1343073 GEO Koch Institute 1 0.83261   0.15352   0.8714   0.66861   40   B   usable mapping rate illumina nextseq 3prime cdna_unspecified nextera bulk bulk bulk   Unknown 2021-12-13 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
67633 67633 SRR17219967 SRX13399935 SRS11303055 SRP350562 PRJNA788496 MITF deficiency accelerates GNAQ driven uveal melanoma GSE190802 Transcriptome Analysis Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator MITF is essential for both CM development and maintenance but its role in UM is largely unexplored. Here we use zebrafish models to dissect the key UM oncogenic signaling events and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways YAP and PLCß ERK was also investigated in this system and thus showed that while activated YAP YAPAA induced UM with high potency the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably mitfa deficiency was profoundly UM promoting dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably all of the mitfa / UM tumors including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa / fish displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively these data show that YAP signaling is the major mediator of UM and that MITF acts as bona fide tumor suppressor in UM in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L tp53 / mitfa / n=10; Tgmitfa:GNAQ Q209L mitfa / n=10; Tgmitfa:GNAQ Q209L tp53 / eye n=8; Tgmitfa:GNAQ Q209L tp53 / skin n=9; Tgmitfa:BRAF V600E tp…       Bp tumor 4 GSM5732252   source name:Bp tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:BRAF V600E|genotype:tp53 / |tissue:uveal melanoma tumor Bp tumor 4 NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24 RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset Bp tumor Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = 5’ biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’ where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies 5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’ where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyze…   genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:BRAF V600E|genotype:tp53 / |tissue:uveal melanoma tumor GSM5732252 GSM5732252: Bp tumor 4; Danio rerio; RNA Seq GSM5732252   1 Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = five prime biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries we… GEO Accession:GSM5732252 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP350562     D16-101294.fastq.gz fastq 164977400.0 4124435.0 GSM5732252 r1 0:40 A:56984652;C:35127348;G:35228728;T:37543026;N:93646 40       56984652 35127348 35228728 37543026 93646 SRX13399935 SRS11303055 SRA1343073 GEO Koch Institute 1 0.8376   0.16272   0.8871   0.60385   40   B   usable mapping rate illumina nextseq 3prime cdna_unspecified nextera bulk bulk bulk   Unknown 2021-12-13 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
67634 67634 SRR17219933 SRX13399934 SRS11303054 SRP350562 PRJNA788496 MITF deficiency accelerates GNAQ driven uveal melanoma GSE190802 Transcriptome Analysis Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator MITF is essential for both CM development and maintenance but its role in UM is largely unexplored. Here we use zebrafish models to dissect the key UM oncogenic signaling events and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways YAP and PLCß ERK was also investigated in this system and thus showed that while activated YAP YAPAA induced UM with high potency the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably mitfa deficiency was profoundly UM promoting dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably all of the mitfa / UM tumors including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa / fish displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively these data show that YAP signaling is the major mediator of UM and that MITF acts as bona fide tumor suppressor in UM in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L tp53 / mitfa / n=10; Tgmitfa:GNAQ Q209L mitfa / n=10; Tgmitfa:GNAQ Q209L tp53 / eye n=8; Tgmitfa:GNAQ Q209L tp53 / skin n=9; Tgmitfa:BRAF V600E tp…       Qp eye tumor 4 GSM5732235   source name:Qp eye tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:uveal melanoma tumor Qp eye tumor 4 NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24 RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset Qp eye tumor Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = 5’ biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’ where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies 5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’ where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyze…   genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:uveal melanoma tumor GSM5732235 GSM5732235: Qp eye tumor 4; Danio rerio; RNA Seq GSM5732235   1 Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = five prime biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries we… GEO Accession:GSM5732235 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP350562     D16-101275.fastq.gz fastq 69014880.0 1725372.0 GSM5732235 r1 0:40 A:23878875;C:13623172;G:14194689;T:17279107;N:39037 40       23878875 13623172 14194689 17279107 39037 SRX13399934 SRS11303054 SRA1343073 GEO Koch Institute 1 0.80282   0.22626   0.83489   0.6254   40   B   usable mapping rate illumina nextseq 3prime cdna_unspecified nextera bulk bulk bulk   Unknown 2021-12-13 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
67635 67635 SRR17219931 SRX13399933 SRS11303053 SRP350562 PRJNA788496 MITF deficiency accelerates GNAQ driven uveal melanoma GSE190802 Transcriptome Analysis Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator MITF is essential for both CM development and maintenance but its role in UM is largely unexplored. Here we use zebrafish models to dissect the key UM oncogenic signaling events and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways YAP and PLCß ERK was also investigated in this system and thus showed that while activated YAP YAPAA induced UM with high potency the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably mitfa deficiency was profoundly UM promoting dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably all of the mitfa / UM tumors including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa / fish displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively these data show that YAP signaling is the major mediator of UM and that MITF acts as bona fide tumor suppressor in UM in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L tp53 / mitfa / n=10; Tgmitfa:GNAQ Q209L mitfa / n=10; Tgmitfa:GNAQ Q209L tp53 / eye n=8; Tgmitfa:GNAQ Q209L tp53 / skin n=9; Tgmitfa:BRAF V600E tp…       Qp eye tumor 3 GSM5732234   source name:Qp eye tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:uveal melanoma tumor Qp eye tumor 3 NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24 RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset Qp eye tumor Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = 5’ biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’ where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies 5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’ where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyze…   genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:uveal melanoma tumor GSM5732234 GSM5732234: Qp eye tumor 3; Danio rerio; RNA Seq GSM5732234   1 Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = five prime biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries we… GEO Accession:GSM5732234 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP350562     D16-101274.fastq.gz fastq 85565720.0 2139143.0 GSM5732234 r1 0:40 A:30643576;C:16725788;G:16483878;T:21663657;N:48821 40       30643576 16725788 16483878 21663657 48821 SRX13399933 SRS11303053 SRA1343073 GEO Koch Institute 1 0.80932   0.18194   0.84952   0.59231   40   B   usable mapping rate illumina nextseq 3prime cdna_unspecified nextera bulk bulk bulk   Unknown 2021-12-13 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
67636 67636 SRR17219929 SRX13399932 SRS11303052 SRP350562 PRJNA788496 MITF deficiency accelerates GNAQ driven uveal melanoma GSE190802 Transcriptome Analysis Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator MITF is essential for both CM development and maintenance but its role in UM is largely unexplored. Here we use zebrafish models to dissect the key UM oncogenic signaling events and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways YAP and PLCß ERK was also investigated in this system and thus showed that while activated YAP YAPAA induced UM with high potency the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably mitfa deficiency was profoundly UM promoting dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably all of the mitfa / UM tumors including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa / fish displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively these data show that YAP signaling is the major mediator of UM and that MITF acts as bona fide tumor suppressor in UM in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L tp53 / mitfa / n=10; Tgmitfa:GNAQ Q209L mitfa / n=10; Tgmitfa:GNAQ Q209L tp53 / eye n=8; Tgmitfa:GNAQ Q209L tp53 / skin n=9; Tgmitfa:BRAF V600E tp…       Qp eye tumor 2 GSM5732233   source name:Qp eye tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:uveal melanoma tumor Qp eye tumor 2 NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24 RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset Qp eye tumor Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = 5’ biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’ where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies 5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’ where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyze…   genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:uveal melanoma tumor GSM5732233 GSM5732233: Qp eye tumor 2; Danio rerio; RNA Seq GSM5732233   1 Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = five prime biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries we… GEO Accession:GSM5732233 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP350562     D16-101273.fastq.gz fastq 49625960.0 1240649.0 GSM5732233 r1 0:40 A:16689341;C:10162844;G:10888880;T:11856436;N:28459 40       16689341 10162844 10888880 11856436 28459 SRX13399932 SRS11303052 SRA1343073 GEO Koch Institute 1 0.81618   0.26509   0.84827   0.65117   40   B   usable mapping rate illumina nextseq 3prime cdna_unspecified nextera bulk bulk bulk   Unknown 2021-12-13 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
67637 67637 SRR17219927 SRX13399931 SRS11303050 SRP350562 PRJNA788496 MITF deficiency accelerates GNAQ driven uveal melanoma GSE190802 Transcriptome Analysis Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator MITF is essential for both CM development and maintenance but its role in UM is largely unexplored. Here we use zebrafish models to dissect the key UM oncogenic signaling events and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways YAP and PLCß ERK was also investigated in this system and thus showed that while activated YAP YAPAA induced UM with high potency the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably mitfa deficiency was profoundly UM promoting dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably all of the mitfa / UM tumors including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa / fish displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively these data show that YAP signaling is the major mediator of UM and that MITF acts as bona fide tumor suppressor in UM in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L tp53 / mitfa / n=10; Tgmitfa:GNAQ Q209L mitfa / n=10; Tgmitfa:GNAQ Q209L tp53 / eye n=8; Tgmitfa:GNAQ Q209L tp53 / skin n=9; Tgmitfa:BRAF V600E tp…       Qp eye tumor 1 GSM5732232   source name:Qp eye tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:uveal melanoma tumor Qp eye tumor 1 NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24 RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset Qp eye tumor Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = 5’ biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’ where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies 5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’ where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyze…   genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:uveal melanoma tumor GSM5732232 GSM5732232: Qp eye tumor 1; Danio rerio; RNA Seq GSM5732232   1 Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = five prime biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries we… GEO Accession:GSM5732232 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP350562     D16-101272.fastq.gz fastq 73671880.0 1841797.0 GSM5732232 r1 0:40 A:26063623;C:14422230;G:14515642;T:18627765;N:42620 40       26063623 14422230 14515642 18627765 42620 SRX13399931 SRS11303050 SRA1343073 GEO Koch Institute 1 0.80786   0.21001   0.84938   0.6324   40   B   usable mapping rate illumina nextseq 3prime cdna_unspecified nextera bulk bulk bulk   Unknown 2021-12-13 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
67638 67638 SRR17219925 SRX13399930 SRS11303051 SRP350562 PRJNA788496 MITF deficiency accelerates GNAQ driven uveal melanoma GSE190802 Transcriptome Analysis Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator MITF is essential for both CM development and maintenance but its role in UM is largely unexplored. Here we use zebrafish models to dissect the key UM oncogenic signaling events and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways YAP and PLCß ERK was also investigated in this system and thus showed that while activated YAP YAPAA induced UM with high potency the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably mitfa deficiency was profoundly UM promoting dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably all of the mitfa / UM tumors including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa / fish displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively these data show that YAP signaling is the major mediator of UM and that MITF acts as bona fide tumor suppressor in UM in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L tp53 / mitfa / n=10; Tgmitfa:GNAQ Q209L mitfa / n=10; Tgmitfa:GNAQ Q209L tp53 / eye n=8; Tgmitfa:GNAQ Q209L tp53 / skin n=9; Tgmitfa:BRAF V600E tp…       Qm tumor 10 GSM5732231   source name:Qm tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor Qm tumor 10 NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24 RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset Qm tumor Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = 5’ biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’ where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies 5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’ where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyze…   genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor GSM5732231 GSM5732231: Qm tumor 10; Danio rerio; RNA Seq GSM5732231   1 Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = five prime biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries we… GEO Accession:GSM5732231 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP350562     D16-101271.fastq.gz fastq 101188800.0 2529720.0 GSM5732231 r1 0:40 A:35586693;C:19763784;G:20181202;T:25598600;N:58521 40       35586693 19763784 20181202 25598600 58521 SRX13399930 SRS11303051 SRA1343073 GEO Koch Institute 1 0.80571   0.20498   0.84273   0.61432   40   B   usable mapping rate illumina nextseq 3prime cdna_unspecified nextera bulk bulk bulk   Unknown 2021-12-13 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
67639 67639 SRR17219923 SRX13399929 SRS11303049 SRP350562 PRJNA788496 MITF deficiency accelerates GNAQ driven uveal melanoma GSE190802 Transcriptome Analysis Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator MITF is essential for both CM development and maintenance but its role in UM is largely unexplored. Here we use zebrafish models to dissect the key UM oncogenic signaling events and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways YAP and PLCß ERK was also investigated in this system and thus showed that while activated YAP YAPAA induced UM with high potency the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably mitfa deficiency was profoundly UM promoting dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably all of the mitfa / UM tumors including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa / fish displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively these data show that YAP signaling is the major mediator of UM and that MITF acts as bona fide tumor suppressor in UM in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L tp53 / mitfa / n=10; Tgmitfa:GNAQ Q209L mitfa / n=10; Tgmitfa:GNAQ Q209L tp53 / eye n=8; Tgmitfa:GNAQ Q209L tp53 / skin n=9; Tgmitfa:BRAF V600E tp…       Qm tumor 9 GSM5732230   source name:Qm tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor Qm tumor 9 NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24 RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset Qm tumor Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = 5’ biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’ where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies 5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’ where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyze…   genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor GSM5732230 GSM5732230: Qm tumor 9; Danio rerio; RNA Seq GSM5732230   1 Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = five prime biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries we… GEO Accession:GSM5732230 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP350562     D16-101270.fastq.gz fastq 116338960.0 2908474.0 GSM5732230 r1 0:40 A:40934240;C:23631257;G:23574658;T:28131114;N:67691 40       40934240 23631257 23574658 28131114 67691 SRX13399929 SRS11303049 SRA1343073 GEO Koch Institute 1 0.8118   0.18354   0.85354   0.60389   40   B   usable mapping rate illumina nextseq 3prime cdna_unspecified nextera bulk bulk bulk   Unknown 2021-12-13 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
67640 67640 SRR17219921 SRX13399928 SRS11303048 SRP350562 PRJNA788496 MITF deficiency accelerates GNAQ driven uveal melanoma GSE190802 Transcriptome Analysis Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator MITF is essential for both CM development and maintenance but its role in UM is largely unexplored. Here we use zebrafish models to dissect the key UM oncogenic signaling events and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways YAP and PLCß ERK was also investigated in this system and thus showed that while activated YAP YAPAA induced UM with high potency the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably mitfa deficiency was profoundly UM promoting dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably all of the mitfa / UM tumors including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa / fish displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively these data show that YAP signaling is the major mediator of UM and that MITF acts as bona fide tumor suppressor in UM in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L tp53 / mitfa / n=10; Tgmitfa:GNAQ Q209L mitfa / n=10; Tgmitfa:GNAQ Q209L tp53 / eye n=8; Tgmitfa:GNAQ Q209L tp53 / skin n=9; Tgmitfa:BRAF V600E tp…       Qm tumor 8 GSM5732229   source name:Qm tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor Qm tumor 8 NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24 RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset Qm tumor Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = 5’ biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’ where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies 5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’ where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyze…   genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor GSM5732229 GSM5732229: Qm tumor 8; Danio rerio; RNA Seq GSM5732229   1 Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = five prime biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries we… GEO Accession:GSM5732229 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP350562     D16-101269.fastq.gz fastq 113227280.0 2830682.0 GSM5732229 r1 0:40 A:38328913;C:23480607;G:24489533;T:26864215;N:64012 40       38328913 23480607 24489533 26864215 64012 SRX13399928 SRS11303048 SRA1343073 GEO Koch Institute 1 0.82097   0.20002   0.85904   0.65238   40   B   usable mapping rate illumina nextseq 3prime cdna_unspecified nextera bulk bulk bulk   Unknown 2021-12-13 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
67641 67641 SRR17219919 SRX13399927 SRS11303047 SRP350562 PRJNA788496 MITF deficiency accelerates GNAQ driven uveal melanoma GSE190802 Transcriptome Analysis Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator MITF is essential for both CM development and maintenance but its role in UM is largely unexplored. Here we use zebrafish models to dissect the key UM oncogenic signaling events and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways YAP and PLCß ERK was also investigated in this system and thus showed that while activated YAP YAPAA induced UM with high potency the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably mitfa deficiency was profoundly UM promoting dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably all of the mitfa / UM tumors including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa / fish displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively these data show that YAP signaling is the major mediator of UM and that MITF acts as bona fide tumor suppressor in UM in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L tp53 / mitfa / n=10; Tgmitfa:GNAQ Q209L mitfa / n=10; Tgmitfa:GNAQ Q209L tp53 / eye n=8; Tgmitfa:GNAQ Q209L tp53 / skin n=9; Tgmitfa:BRAF V600E tp…       Qm tumor 7 GSM5732228   source name:Qm tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor Qm tumor 7 NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24 RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset Qm tumor Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = 5’ biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’ where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies 5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’ where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyze…   genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor GSM5732228 GSM5732228: Qm tumor 7; Danio rerio; RNA Seq GSM5732228   1 Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = five prime biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries we… GEO Accession:GSM5732228 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP350562     D16-101268.fastq.gz fastq 104497160.0 2612429.0 GSM5732228 r1 0:40 A:35306615;C:21368264;G:22765419;T:24995701;N:61161 40       35306615 21368264 22765419 24995701 61161 SRX13399927 SRS11303047 SRA1343073 GEO Koch Institute 1 0.82081   0.20118   0.85082   0.60839   40   B   usable mapping rate illumina nextseq 3prime cdna_unspecified nextera bulk bulk bulk   Unknown 2021-12-13 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
67642 67642 SRR17219965 SRX13399926 SRS11303046 SRP350562 PRJNA788496 MITF deficiency accelerates GNAQ driven uveal melanoma GSE190802 Transcriptome Analysis Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator MITF is essential for both CM development and maintenance but its role in UM is largely unexplored. Here we use zebrafish models to dissect the key UM oncogenic signaling events and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways YAP and PLCß ERK was also investigated in this system and thus showed that while activated YAP YAPAA induced UM with high potency the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably mitfa deficiency was profoundly UM promoting dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably all of the mitfa / UM tumors including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa / fish displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively these data show that YAP signaling is the major mediator of UM and that MITF acts as bona fide tumor suppressor in UM in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L tp53 / mitfa / n=10; Tgmitfa:GNAQ Q209L mitfa / n=10; Tgmitfa:GNAQ Q209L tp53 / eye n=8; Tgmitfa:GNAQ Q209L tp53 / skin n=9; Tgmitfa:BRAF V600E tp…       Bp tumor 3 GSM5732251   source name:Bp tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:BRAF V600E|genotype:tp53 / |tissue:uveal melanoma tumor Bp tumor 3 NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24 RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset Bp tumor Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = 5’ biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’ where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies 5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’ where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyze…   genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:BRAF V600E|genotype:tp53 / |tissue:uveal melanoma tumor GSM5732251 GSM5732251: Bp tumor 3; Danio rerio; RNA Seq GSM5732251   1 Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = five prime biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries we… GEO Accession:GSM5732251 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP350562     D16-101293.fastq.gz fastq 160349920.0 4008748.0 GSM5732251 r1 0:40 A:52636356;C:34485561;G:37062014;T:36075665;N:90324 40       52636356 34485561 37062014 36075665 90324 SRX13399926 SRS11303046 SRA1343073 GEO Koch Institute 1 0.83192   0.18947   0.86645   0.63435   40   B   usable mapping rate illumina nextseq 3prime cdna_unspecified nextera bulk bulk bulk   Unknown 2021-12-13 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
67643 67643 SRR17219963 SRX13399925 SRS11303045 SRP350562 PRJNA788496 MITF deficiency accelerates GNAQ driven uveal melanoma GSE190802 Transcriptome Analysis Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator MITF is essential for both CM development and maintenance but its role in UM is largely unexplored. Here we use zebrafish models to dissect the key UM oncogenic signaling events and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways YAP and PLCß ERK was also investigated in this system and thus showed that while activated YAP YAPAA induced UM with high potency the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably mitfa deficiency was profoundly UM promoting dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably all of the mitfa / UM tumors including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa / fish displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively these data show that YAP signaling is the major mediator of UM and that MITF acts as bona fide tumor suppressor in UM in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L tp53 / mitfa / n=10; Tgmitfa:GNAQ Q209L mitfa / n=10; Tgmitfa:GNAQ Q209L tp53 / eye n=8; Tgmitfa:GNAQ Q209L tp53 / skin n=9; Tgmitfa:BRAF V600E tp…       Bp tumor 2 GSM5732250   source name:Bp tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:BRAF V600E|genotype:tp53 / |tissue:uveal melanoma tumor Bp tumor 2 NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24 RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset Bp tumor Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = 5’ biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’ where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies 5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’ where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyze…   genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:BRAF V600E|genotype:tp53 / |tissue:uveal melanoma tumor GSM5732250 GSM5732250: Bp tumor 2; Danio rerio; RNA Seq GSM5732250   1 Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = five prime biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries we… GEO Accession:GSM5732250 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP350562     D16-101291.fastq.gz fastq 86530240.0 2163256.0 GSM5732250 r1 0:40 A:28567808;C:18531588;G:20031608;T:19348376;N:50860 40       28567808 18531588 20031608 19348376 50860 SRX13399925 SRS11303045 SRA1343073 GEO Koch Institute 1 0.8305   0.33333   0.89286   0.68581   40   B   usable mapping rate illumina nextseq 3prime cdna_unspecified nextera bulk bulk bulk   Unknown 2021-12-13 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
67644 67644 SRR17219961 SRX13399924 SRS11303044 SRP350562 PRJNA788496 MITF deficiency accelerates GNAQ driven uveal melanoma GSE190802 Transcriptome Analysis Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator MITF is essential for both CM development and maintenance but its role in UM is largely unexplored. Here we use zebrafish models to dissect the key UM oncogenic signaling events and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways YAP and PLCß ERK was also investigated in this system and thus showed that while activated YAP YAPAA induced UM with high potency the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably mitfa deficiency was profoundly UM promoting dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably all of the mitfa / UM tumors including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa / fish displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively these data show that YAP signaling is the major mediator of UM and that MITF acts as bona fide tumor suppressor in UM in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L tp53 / mitfa / n=10; Tgmitfa:GNAQ Q209L mitfa / n=10; Tgmitfa:GNAQ Q209L tp53 / eye n=8; Tgmitfa:GNAQ Q209L tp53 / skin n=9; Tgmitfa:BRAF V600E tp…       Bp tumor 1 GSM5732249   source name:Bp tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:BRAF V600E|genotype:tp53 / |tissue:uveal melanoma tumor Bp tumor 1 NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24 RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset Bp tumor Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = 5’ biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’ where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies 5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’ where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyze…   genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:BRAF V600E|genotype:tp53 / |tissue:uveal melanoma tumor GSM5732249 GSM5732249: Bp tumor 1; Danio rerio; RNA Seq GSM5732249   1 Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = five prime biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries we… GEO Accession:GSM5732249 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP350562     D16-101290.fastq.gz fastq 129363640.0 3234091.0 GSM5732249 r1 0:40 A:44511787;C:27719005;G:28065443;T:28993522;N:73883 40       44511787 27719005 28065443 28993522 73883 SRX13399924 SRS11303044 SRA1343073 GEO Koch Institute 1 0.83185   0.31848   0.88534   0.65619   40   B   usable mapping rate illumina nextseq 3prime cdna_unspecified nextera bulk bulk bulk   Unknown 2021-12-13 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
67645 67645 SRR17219959 SRX13399923 SRS11303043 SRP350562 PRJNA788496 MITF deficiency accelerates GNAQ driven uveal melanoma GSE190802 Transcriptome Analysis Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator MITF is essential for both CM development and maintenance but its role in UM is largely unexplored. Here we use zebrafish models to dissect the key UM oncogenic signaling events and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways YAP and PLCß ERK was also investigated in this system and thus showed that while activated YAP YAPAA induced UM with high potency the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably mitfa deficiency was profoundly UM promoting dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably all of the mitfa / UM tumors including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa / fish displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively these data show that YAP signaling is the major mediator of UM and that MITF acts as bona fide tumor suppressor in UM in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L tp53 / mitfa / n=10; Tgmitfa:GNAQ Q209L mitfa / n=10; Tgmitfa:GNAQ Q209L tp53 / eye n=8; Tgmitfa:GNAQ Q209L tp53 / skin n=9; Tgmitfa:BRAF V600E tp…       Qp skin tumor 9 GSM5732248   source name:Qp skin tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor Qp skin tumor 9 NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24 RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset Qp skin tumor Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = 5’ biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’ where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies 5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’ where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyze…   genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor GSM5732248 GSM5732248: Qp skin tumor 9; Danio rerio; RNA Seq GSM5732248   1 Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = five prime biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries we… GEO Accession:GSM5732248 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP350562     D16-101289.fastq.gz fastq 152510400.0 3812760.0 GSM5732248 r1 0:40 A:52274113;C:31326291;G:31850664;T:36971245;N:88087 40       52274113 31326291 31850664 36971245 88087 SRX13399923 SRS11303043 SRA1343073 GEO Koch Institute 1 0.82364   0.24647   0.85871   0.66872   40   B   usable mapping rate illumina nextseq 3prime cdna_unspecified nextera bulk bulk bulk   Unknown 2021-12-13 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
67646 67646 SRR17219957 SRX13399922 SRS11303042 SRP350562 PRJNA788496 MITF deficiency accelerates GNAQ driven uveal melanoma GSE190802 Transcriptome Analysis Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator MITF is essential for both CM development and maintenance but its role in UM is largely unexplored. Here we use zebrafish models to dissect the key UM oncogenic signaling events and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways YAP and PLCß ERK was also investigated in this system and thus showed that while activated YAP YAPAA induced UM with high potency the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably mitfa deficiency was profoundly UM promoting dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably all of the mitfa / UM tumors including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa / fish displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively these data show that YAP signaling is the major mediator of UM and that MITF acts as bona fide tumor suppressor in UM in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L tp53 / mitfa / n=10; Tgmitfa:GNAQ Q209L mitfa / n=10; Tgmitfa:GNAQ Q209L tp53 / eye n=8; Tgmitfa:GNAQ Q209L tp53 / skin n=9; Tgmitfa:BRAF V600E tp…       Qp skin tumor 8 GSM5732247   source name:Qp skin tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor Qp skin tumor 8 NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24 RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset Qp skin tumor Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = 5’ biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’ where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies 5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’ where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyze…   genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor GSM5732247 GSM5732247: Qp skin tumor 8; Danio rerio; RNA Seq GSM5732247   1 Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = five prime biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries we… GEO Accession:GSM5732247 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP350562     D16-101287.fastq.gz fastq 76828360.0 1920709.0 GSM5732247 r1 0:40 A:26523726;C:15399788;G:16949111;T:17911010;N:44725 40       26523726 15399788 16949111 17911010 44725 SRX13399922 SRS11303042 SRA1343073 GEO Koch Institute 1 0.82316   0.38565   0.87801   0.65616   40   B   usable mapping rate illumina nextseq 3prime cdna_unspecified nextera bulk bulk bulk   Unknown 2021-12-13 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
67647 67647 SRR17219955 SRX13399921 SRS11303041 SRP350562 PRJNA788496 MITF deficiency accelerates GNAQ driven uveal melanoma GSE190802 Transcriptome Analysis Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator MITF is essential for both CM development and maintenance but its role in UM is largely unexplored. Here we use zebrafish models to dissect the key UM oncogenic signaling events and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways YAP and PLCß ERK was also investigated in this system and thus showed that while activated YAP YAPAA induced UM with high potency the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably mitfa deficiency was profoundly UM promoting dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably all of the mitfa / UM tumors including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa / fish displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively these data show that YAP signaling is the major mediator of UM and that MITF acts as bona fide tumor suppressor in UM in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L tp53 / mitfa / n=10; Tgmitfa:GNAQ Q209L mitfa / n=10; Tgmitfa:GNAQ Q209L tp53 / eye n=8; Tgmitfa:GNAQ Q209L tp53 / skin n=9; Tgmitfa:BRAF V600E tp…       Qp skin tumor 7 GSM5732246   source name:Qp skin tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor Qp skin tumor 7 NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24 RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset Qp skin tumor Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = 5’ biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’ where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies 5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’ where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyze…   genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor GSM5732246 GSM5732246: Qp skin tumor 7; Danio rerio; RNA Seq GSM5732246   1 Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = five prime biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries we… GEO Accession:GSM5732246 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP350562     D16-101286.fastq.gz fastq 77108080.0 1927702.0 GSM5732246 r1 0:40 A:26570402;C:15649619;G:16889594;T:17953263;N:45202 40       26570402 15649619 16889594 17953263 45202 SRX13399921 SRS11303041 SRA1343073 GEO Koch Institute 1 0.81122   0.33667   0.87178   0.66288   40   B   usable mapping rate illumina nextseq 3prime cdna_unspecified nextera bulk bulk bulk   Unknown 2021-12-13 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
67648 67648 SRR17219953 SRX13399920 SRS11303040 SRP350562 PRJNA788496 MITF deficiency accelerates GNAQ driven uveal melanoma GSE190802 Transcriptome Analysis Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator MITF is essential for both CM development and maintenance but its role in UM is largely unexplored. Here we use zebrafish models to dissect the key UM oncogenic signaling events and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways YAP and PLCß ERK was also investigated in this system and thus showed that while activated YAP YAPAA induced UM with high potency the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably mitfa deficiency was profoundly UM promoting dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably all of the mitfa / UM tumors including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa / fish displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively these data show that YAP signaling is the major mediator of UM and that MITF acts as bona fide tumor suppressor in UM in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L tp53 / mitfa / n=10; Tgmitfa:GNAQ Q209L mitfa / n=10; Tgmitfa:GNAQ Q209L tp53 / eye n=8; Tgmitfa:GNAQ Q209L tp53 / skin n=9; Tgmitfa:BRAF V600E tp…       Qp skin tumor 6 GSM5732245   source name:Qp skin tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor Qp skin tumor 6 NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24 RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset Qp skin tumor Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = 5’ biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’ where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies 5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’ where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyze…   genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor GSM5732245 GSM5732245: Qp skin tumor 6; Danio rerio; RNA Seq GSM5732245   1 Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = five prime biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries we… GEO Accession:GSM5732245 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP350562     D16-101285.fastq.gz fastq 124624040.0 3115601.0 GSM5732245 r1 0:40 A:41502232;C:26253849;G:27083319;T:29714036;N:70604 40       41502232 26253849 27083319 29714036 70604 SRX13399920 SRS11303040 SRA1343073 GEO Koch Institute 1 0.81706   0.26109   0.85811   0.65526   40   B   usable mapping rate illumina nextseq 3prime cdna_unspecified nextera bulk bulk bulk   Unknown 2021-12-13 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
67649 67649 SRR17219951 SRX13399919 SRS11303039 SRP350562 PRJNA788496 MITF deficiency accelerates GNAQ driven uveal melanoma GSE190802 Transcriptome Analysis Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator MITF is essential for both CM development and maintenance but its role in UM is largely unexplored. Here we use zebrafish models to dissect the key UM oncogenic signaling events and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways YAP and PLCß ERK was also investigated in this system and thus showed that while activated YAP YAPAA induced UM with high potency the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably mitfa deficiency was profoundly UM promoting dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably all of the mitfa / UM tumors including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa / fish displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively these data show that YAP signaling is the major mediator of UM and that MITF acts as bona fide tumor suppressor in UM in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L tp53 / mitfa / n=10; Tgmitfa:GNAQ Q209L mitfa / n=10; Tgmitfa:GNAQ Q209L tp53 / eye n=8; Tgmitfa:GNAQ Q209L tp53 / skin n=9; Tgmitfa:BRAF V600E tp…       Qp skin tumor 5 GSM5732244   source name:Qp skin tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor Qp skin tumor 5 NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24 RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset Qp skin tumor Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = 5’ biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’ where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies 5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’ where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyze…   genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor GSM5732244 GSM5732244: Qp skin tumor 5; Danio rerio; RNA Seq GSM5732244   1 Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = five prime biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries we… GEO Accession:GSM5732244 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP350562     D16-101284.fastq.gz fastq 97066400.0 2426660.0 GSM5732244 r1 0:40 A:32977109;C:19973503;G:20845864;T:23215430;N:54494 40       32977109 19973503 20845864 23215430 54494 SRX13399919 SRS11303039 SRA1343073 GEO Koch Institute 1 0.82484   0.28858   0.86561   0.64518   40   B   usable mapping rate illumina nextseq 3prime cdna_unspecified nextera bulk bulk bulk   Unknown 2021-12-13 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
67650 67650 SRR17219917 SRX13399918 SRS11303037 SRP350562 PRJNA788496 MITF deficiency accelerates GNAQ driven uveal melanoma GSE190802 Transcriptome Analysis Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator MITF is essential for both CM development and maintenance but its role in UM is largely unexplored. Here we use zebrafish models to dissect the key UM oncogenic signaling events and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways YAP and PLCß ERK was also investigated in this system and thus showed that while activated YAP YAPAA induced UM with high potency the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably mitfa deficiency was profoundly UM promoting dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably all of the mitfa / UM tumors including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa / fish displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively these data show that YAP signaling is the major mediator of UM and that MITF acts as bona fide tumor suppressor in UM in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L tp53 / mitfa / n=10; Tgmitfa:GNAQ Q209L mitfa / n=10; Tgmitfa:GNAQ Q209L tp53 / eye n=8; Tgmitfa:GNAQ Q209L tp53 / skin n=9; Tgmitfa:BRAF V600E tp…       Qm tumor 6 GSM5732227   source name:Qm tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor Qm tumor 6 NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24 RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset Qm tumor Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = 5’ biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’ where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies 5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’ where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyze…   genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor GSM5732227 GSM5732227: Qm tumor 6; Danio rerio; RNA Seq GSM5732227   1 Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = five prime biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries we… GEO Accession:GSM5732227 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP350562     D16-101267.fastq.gz fastq 94190240.0 2354756.0 GSM5732227 r1 0:40 A:32749934;C:18714126;G:19617591;T:23052224;N:56365 40       32749934 18714126 19617591 23052224 56365 SRX13399918 SRS11303037 SRA1343073 GEO Koch Institute 1 0.8137   0.21484   0.85395   0.6013   40   B   usable mapping rate illumina nextseq 3prime cdna_unspecified nextera bulk bulk bulk   Unknown 2021-12-13 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
67651 67651 SRR17219915 SRX13399917 SRS11303036 SRP350562 PRJNA788496 MITF deficiency accelerates GNAQ driven uveal melanoma GSE190802 Transcriptome Analysis Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator MITF is essential for both CM development and maintenance but its role in UM is largely unexplored. Here we use zebrafish models to dissect the key UM oncogenic signaling events and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways YAP and PLCß ERK was also investigated in this system and thus showed that while activated YAP YAPAA induced UM with high potency the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably mitfa deficiency was profoundly UM promoting dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably all of the mitfa / UM tumors including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa / fish displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively these data show that YAP signaling is the major mediator of UM and that MITF acts as bona fide tumor suppressor in UM in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L tp53 / mitfa / n=10; Tgmitfa:GNAQ Q209L mitfa / n=10; Tgmitfa:GNAQ Q209L tp53 / eye n=8; Tgmitfa:GNAQ Q209L tp53 / skin n=9; Tgmitfa:BRAF V600E tp…       Qm tumor 5 GSM5732226   source name:Qm tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor Qm tumor 5 NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24 RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset Qm tumor Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = 5’ biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’ where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies 5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’ where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyze…   genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor GSM5732226 GSM5732226: Qm tumor 5; Danio rerio; RNA Seq GSM5732226   1 Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = five prime biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries we… GEO Accession:GSM5732226 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP350562     D16-101266.fastq.gz fastq 142630800.0 3565770.0 GSM5732226 r1 0:40 A:50773272;C:29136199;G:28699617;T:33938415;N:83297 40       50773272 29136199 28699617 33938415 83297 SRX13399917 SRS11303036 SRA1343073 GEO Koch Institute 1 0.81831   0.21344   0.86935   0.62355   40   B   usable mapping rate illumina nextseq 3prime cdna_unspecified nextera bulk bulk bulk   Unknown 2021-12-13 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
67652 67652 SRR17219913 SRX13399916 SRS11303038 SRP350562 PRJNA788496 MITF deficiency accelerates GNAQ driven uveal melanoma GSE190802 Transcriptome Analysis Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator MITF is essential for both CM development and maintenance but its role in UM is largely unexplored. Here we use zebrafish models to dissect the key UM oncogenic signaling events and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways YAP and PLCß ERK was also investigated in this system and thus showed that while activated YAP YAPAA induced UM with high potency the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably mitfa deficiency was profoundly UM promoting dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably all of the mitfa / UM tumors including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa / fish displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively these data show that YAP signaling is the major mediator of UM and that MITF acts as bona fide tumor suppressor in UM in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L tp53 / mitfa / n=10; Tgmitfa:GNAQ Q209L mitfa / n=10; Tgmitfa:GNAQ Q209L tp53 / eye n=8; Tgmitfa:GNAQ Q209L tp53 / skin n=9; Tgmitfa:BRAF V600E tp…       Qm tumor 4 GSM5732225   source name:Qm tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor Qm tumor 4 NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24 RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset Qm tumor Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = 5’ biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’ where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies 5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’ where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyze…   genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor GSM5732225 GSM5732225: Qm tumor 4; Danio rerio; RNA Seq GSM5732225   1 Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = five prime biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries we… GEO Accession:GSM5732225 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP350562     D16-101265.fastq.gz fastq 72664840.0 1816621.0 GSM5732225 r1 0:40 A:24936806;C:14864464;G:15139082;T:17684025;N:40463 40       24936806 14864464 15139082 17684025 40463 SRX13399916 SRS11303038 SRA1343073 GEO Koch Institute 1 0.81563   0.19935   0.84956   0.61926   40   B   usable mapping rate illumina nextseq 3prime cdna_unspecified nextera bulk bulk bulk   Unknown 2021-12-13 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
67653 67653 SRR17219911 SRX13399915 SRS11303035 SRP350562 PRJNA788496 MITF deficiency accelerates GNAQ driven uveal melanoma GSE190802 Transcriptome Analysis Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator MITF is essential for both CM development and maintenance but its role in UM is largely unexplored. Here we use zebrafish models to dissect the key UM oncogenic signaling events and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways YAP and PLCß ERK was also investigated in this system and thus showed that while activated YAP YAPAA induced UM with high potency the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably mitfa deficiency was profoundly UM promoting dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably all of the mitfa / UM tumors including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa / fish displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively these data show that YAP signaling is the major mediator of UM and that MITF acts as bona fide tumor suppressor in UM in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L tp53 / mitfa / n=10; Tgmitfa:GNAQ Q209L mitfa / n=10; Tgmitfa:GNAQ Q209L tp53 / eye n=8; Tgmitfa:GNAQ Q209L tp53 / skin n=9; Tgmitfa:BRAF V600E tp…       Qm tumor 3 GSM5732224   source name:Qm tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor Qm tumor 3 NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24 RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset Qm tumor Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = 5’ biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’ where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies 5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’ where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyze…   genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor GSM5732224 GSM5732224: Qm tumor 3; Danio rerio; RNA Seq GSM5732224   1 Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = five prime biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries we… GEO Accession:GSM5732224 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP350562     D16-101264.fastq.gz fastq 137738640.0 3443466.0 GSM5732224 r1 0:40 A:46262332;C:28700073;G:30367217;T:32328223;N:80795 40       46262332 28700073 30367217 32328223 80795 SRX13399915 SRS11303035 SRA1343073 GEO Koch Institute 1 0.82243   0.19809   0.86103   0.62402   40   B   usable mapping rate illumina nextseq 3prime cdna_unspecified nextera bulk bulk bulk   Unknown 2021-12-13 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
67654 67654 SRR17219909 SRX13399914 SRS11303034 SRP350562 PRJNA788496 MITF deficiency accelerates GNAQ driven uveal melanoma GSE190802 Transcriptome Analysis Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator MITF is essential for both CM development and maintenance but its role in UM is largely unexplored. Here we use zebrafish models to dissect the key UM oncogenic signaling events and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways YAP and PLCß ERK was also investigated in this system and thus showed that while activated YAP YAPAA induced UM with high potency the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably mitfa deficiency was profoundly UM promoting dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably all of the mitfa / UM tumors including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa / fish displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively these data show that YAP signaling is the major mediator of UM and that MITF acts as bona fide tumor suppressor in UM in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L tp53 / mitfa / n=10; Tgmitfa:GNAQ Q209L mitfa / n=10; Tgmitfa:GNAQ Q209L tp53 / eye n=8; Tgmitfa:GNAQ Q209L tp53 / skin n=9; Tgmitfa:BRAF V600E tp…       Qm tumor 2 GSM5732223   source name:Qm tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor Qm tumor 2 NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24 RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset Qm tumor Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = 5’ biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’ where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies 5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’ where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyze…   genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor GSM5732223 GSM5732223: Qm tumor 2; Danio rerio; RNA Seq GSM5732223   1 Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = five prime biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries we… GEO Accession:GSM5732223 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP350562     D16-101263.fastq.gz fastq 100736440.0 2518411.0 GSM5732223 r1 0:40 A:35350874;C:19629100;G:20709910;T:24987897;N:58659 40       35350874 19629100 20709910 24987897 58659 SRX13399914 SRS11303034 SRA1343073 GEO Koch Institute 1 0.816   0.19534   0.85498   0.58105   40   B   usable mapping rate illumina nextseq 3prime cdna_unspecified nextera bulk bulk bulk   Unknown 2021-12-13 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
67655 67655 SRR17219907 SRX13399913 SRS11303033 SRP350562 PRJNA788496 MITF deficiency accelerates GNAQ driven uveal melanoma GSE190802 Transcriptome Analysis Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator MITF is essential for both CM development and maintenance but its role in UM is largely unexplored. Here we use zebrafish models to dissect the key UM oncogenic signaling events and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways YAP and PLCß ERK was also investigated in this system and thus showed that while activated YAP YAPAA induced UM with high potency the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably mitfa deficiency was profoundly UM promoting dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably all of the mitfa / UM tumors including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa / fish displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively these data show that YAP signaling is the major mediator of UM and that MITF acts as bona fide tumor suppressor in UM in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L tp53 / mitfa / n=10; Tgmitfa:GNAQ Q209L mitfa / n=10; Tgmitfa:GNAQ Q209L tp53 / eye n=8; Tgmitfa:GNAQ Q209L tp53 / skin n=9; Tgmitfa:BRAF V600E tp…       Qm tumor 1 GSM5732222   source name:Qm tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor Qm tumor 1 NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24 RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset Qm tumor Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = 5’ biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’ where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies 5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’ where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyze…   genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor GSM5732222 GSM5732222: Qm tumor 1; Danio rerio; RNA Seq GSM5732222   1 Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = five prime biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries we… GEO Accession:GSM5732222 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP350562     D16-101262.fastq.gz fastq 105944280.0 2648607.0 GSM5732222 r1 0:40 A:37210955;C:21008075;G:21663482;T:26000794;N:60974 40       37210955 21008075 21663482 26000794 60974 SRX13399913 SRS11303033 SRA1343073 GEO Koch Institute 1 0.81581   0.20031   0.86334   0.6085   40   B   usable mapping rate illumina nextseq 3prime cdna_unspecified nextera bulk bulk bulk   Unknown 2021-12-13 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
67656 67656 SRR17219905 SRX13399912 SRS11303032 SRP350562 PRJNA788496 MITF deficiency accelerates GNAQ driven uveal melanoma GSE190802 Transcriptome Analysis Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator MITF is essential for both CM development and maintenance but its role in UM is largely unexplored. Here we use zebrafish models to dissect the key UM oncogenic signaling events and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways YAP and PLCß ERK was also investigated in this system and thus showed that while activated YAP YAPAA induced UM with high potency the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably mitfa deficiency was profoundly UM promoting dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably all of the mitfa / UM tumors including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa / fish displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively these data show that YAP signaling is the major mediator of UM and that MITF acts as bona fide tumor suppressor in UM in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L tp53 / mitfa / n=10; Tgmitfa:GNAQ Q209L mitfa / n=10; Tgmitfa:GNAQ Q209L tp53 / eye n=8; Tgmitfa:GNAQ Q209L tp53 / skin n=9; Tgmitfa:BRAF V600E tp…       Qpm tumor 10 GSM5732221   source name:Qpm tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor Qpm tumor 10 NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24 RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset Qpm tumor Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = 5’ biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’ where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies 5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’ where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyze…   genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor GSM5732221 GSM5732221: Qpm tumor 10; Danio rerio; RNA Seq GSM5732221   1 Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = five prime biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries we… GEO Accession:GSM5732221 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP350562     D16-101261.fastq.gz fastq 101472840.0 2536821.0 GSM5732221 r1 0:40 A:34475762;C:20816302;G:21286989;T:24838307;N:55480 40       34475762 20816302 21286989 24838307 55480 SRX13399912 SRS11303032 SRA1343073 GEO Koch Institute 1 0.81061   0.20131   0.84613   0.60722   40   B   usable mapping rate illumina nextseq 3prime cdna_unspecified nextera bulk bulk bulk   Unknown 2021-12-13 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
67657 67657 SRR17219903 SRX13399911 SRS11303031 SRP350562 PRJNA788496 MITF deficiency accelerates GNAQ driven uveal melanoma GSE190802 Transcriptome Analysis Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator MITF is essential for both CM development and maintenance but its role in UM is largely unexplored. Here we use zebrafish models to dissect the key UM oncogenic signaling events and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways YAP and PLCß ERK was also investigated in this system and thus showed that while activated YAP YAPAA induced UM with high potency the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably mitfa deficiency was profoundly UM promoting dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably all of the mitfa / UM tumors including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa / fish displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively these data show that YAP signaling is the major mediator of UM and that MITF acts as bona fide tumor suppressor in UM in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L tp53 / mitfa / n=10; Tgmitfa:GNAQ Q209L mitfa / n=10; Tgmitfa:GNAQ Q209L tp53 / eye n=8; Tgmitfa:GNAQ Q209L tp53 / skin n=9; Tgmitfa:BRAF V600E tp…       Qpm tumor 9 GSM5732220   source name:Qpm tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor Qpm tumor 9 NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24 RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset Qpm tumor Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = 5’ biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’ where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies 5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’ where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyze…   genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor GSM5732220 GSM5732220: Qpm tumor 9; Danio rerio; RNA Seq GSM5732220   1 Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = five prime biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries we… GEO Accession:GSM5732220 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP350562     D16-101260.fastq.gz fastq 99755640.0 2493891.0 GSM5732220 r1 0:40 A:34870327;C:19628149;G:20126136;T:25072821;N:58207 40       34870327 19628149 20126136 25072821 58207 SRX13399911 SRS11303031 SRA1343073 GEO Koch Institute 1 0.80894   0.20798   0.84678   0.61006   40   B   usable mapping rate illumina nextseq 3prime cdna_unspecified nextera bulk bulk bulk   Unknown 2021-12-13 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
67658 67658 SRR17219901 SRX13399910 SRS11303030 SRP350562 PRJNA788496 MITF deficiency accelerates GNAQ driven uveal melanoma GSE190802 Transcriptome Analysis Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator MITF is essential for both CM development and maintenance but its role in UM is largely unexplored. Here we use zebrafish models to dissect the key UM oncogenic signaling events and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways YAP and PLCß ERK was also investigated in this system and thus showed that while activated YAP YAPAA induced UM with high potency the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably mitfa deficiency was profoundly UM promoting dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably all of the mitfa / UM tumors including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa / fish displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively these data show that YAP signaling is the major mediator of UM and that MITF acts as bona fide tumor suppressor in UM in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L tp53 / mitfa / n=10; Tgmitfa:GNAQ Q209L mitfa / n=10; Tgmitfa:GNAQ Q209L tp53 / eye n=8; Tgmitfa:GNAQ Q209L tp53 / skin n=9; Tgmitfa:BRAF V600E tp…       Qpm tumor 8 GSM5732219   source name:Qpm tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor Qpm tumor 8 NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24 RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset Qpm tumor Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = 5’ biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’ where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies 5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’ where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyze…   genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor GSM5732219 GSM5732219: Qpm tumor 8; Danio rerio; RNA Seq GSM5732219   1 Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = five prime biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries we… GEO Accession:GSM5732219 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP350562     D16-101259.fastq.gz fastq 164204720.0 4105118.0 GSM5732219 r1 0:40 A:57421304;C:32261871;G:33727368;T:40700224;N:93953 40       57421304 32261871 33727368 40700224 93953 SRX13399910 SRS11303030 SRA1343073 GEO Koch Institute 1 0.81413   0.19281   0.85001   0.62212   40   B   usable mapping rate illumina nextseq 3prime cdna_unspecified nextera bulk bulk bulk   Unknown 2021-12-13 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
67659 67659 SRR17219899 SRX13399909 SRS11303027 SRP350562 PRJNA788496 MITF deficiency accelerates GNAQ driven uveal melanoma GSE190802 Transcriptome Analysis Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator MITF is essential for both CM development and maintenance but its role in UM is largely unexplored. Here we use zebrafish models to dissect the key UM oncogenic signaling events and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways YAP and PLCß ERK was also investigated in this system and thus showed that while activated YAP YAPAA induced UM with high potency the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably mitfa deficiency was profoundly UM promoting dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably all of the mitfa / UM tumors including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa / fish displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively these data show that YAP signaling is the major mediator of UM and that MITF acts as bona fide tumor suppressor in UM in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L tp53 / mitfa / n=10; Tgmitfa:GNAQ Q209L mitfa / n=10; Tgmitfa:GNAQ Q209L tp53 / eye n=8; Tgmitfa:GNAQ Q209L tp53 / skin n=9; Tgmitfa:BRAF V600E tp…       Qpm tumor 7 GSM5732217   source name:Qpm tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor Qpm tumor 7 NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24 RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset Qpm tumor Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = 5’ biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’ where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies 5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’ where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyze…   genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor GSM5732217 GSM5732217: Qpm tumor 7; Danio rerio; RNA Seq GSM5732217   1 Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = five prime biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries we… GEO Accession:GSM5732217 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP350562     D16-101258.fastq.gz fastq 170806960.0 4270174.0 GSM5732217 r1 0:40 A:59047625;C:34088876;G:36165441;T:41402090;N:102928 40       59047625 34088876 36165441 41402090 102928 SRX13399909 SRS11303027 SRA1343073 GEO Koch Institute 1 0.81948   0.19309   0.85222   0.62553   40   B   usable mapping rate illumina nextseq 3prime cdna_unspecified nextera bulk bulk bulk   Unknown 2021-12-13 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
67660 67660 SRR17219897 SRX13399908 SRS11303029 SRP350562 PRJNA788496 MITF deficiency accelerates GNAQ driven uveal melanoma GSE190802 Transcriptome Analysis Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator MITF is essential for both CM development and maintenance but its role in UM is largely unexplored. Here we use zebrafish models to dissect the key UM oncogenic signaling events and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways YAP and PLCß ERK was also investigated in this system and thus showed that while activated YAP YAPAA induced UM with high potency the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably mitfa deficiency was profoundly UM promoting dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably all of the mitfa / UM tumors including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa / fish displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively these data show that YAP signaling is the major mediator of UM and that MITF acts as bona fide tumor suppressor in UM in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L tp53 / mitfa / n=10; Tgmitfa:GNAQ Q209L mitfa / n=10; Tgmitfa:GNAQ Q209L tp53 / eye n=8; Tgmitfa:GNAQ Q209L tp53 / skin n=9; Tgmitfa:BRAF V600E tp…       Qpm tumor 6 GSM5732215   source name:Qpm tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor Qpm tumor 6 NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24 RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset Qpm tumor Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = 5’ biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’ where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies 5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’ where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyze…   genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor GSM5732215 GSM5732215: Qpm tumor 6; Danio rerio; RNA Seq GSM5732215   1 Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = five prime biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries we… GEO Accession:GSM5732215 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP350562     D16-101257.fastq.gz fastq 115180880.0 2879522.0 GSM5732215 r1 0:40 A:39638720;C:23294416;G:23781904;T:28400153;N:65687 40       39638720 23294416 23781904 28400153 65687 SRX13399908 SRS11303029 SRA1343073 GEO Koch Institute 1 0.80861   0.19172   0.84528   0.62263   40   B   usable mapping rate illumina nextseq 3prime cdna_unspecified nextera bulk bulk bulk   Unknown 2021-12-13 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
67661 67661 SRR17219895 SRX13399907 SRS11303028 SRP350562 PRJNA788496 MITF deficiency accelerates GNAQ driven uveal melanoma GSE190802 Transcriptome Analysis Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator MITF is essential for both CM development and maintenance but its role in UM is largely unexplored. Here we use zebrafish models to dissect the key UM oncogenic signaling events and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways YAP and PLCß ERK was also investigated in this system and thus showed that while activated YAP YAPAA induced UM with high potency the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably mitfa deficiency was profoundly UM promoting dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably all of the mitfa / UM tumors including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa / fish displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively these data show that YAP signaling is the major mediator of UM and that MITF acts as bona fide tumor suppressor in UM in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L tp53 / mitfa / n=10; Tgmitfa:GNAQ Q209L mitfa / n=10; Tgmitfa:GNAQ Q209L tp53 / eye n=8; Tgmitfa:GNAQ Q209L tp53 / skin n=9; Tgmitfa:BRAF V600E tp…       Qpm tumor 5 GSM5732214   source name:Qpm tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor Qpm tumor 5 NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24 RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset Qpm tumor Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = 5’ biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’ where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies 5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’ where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyze…   genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor GSM5732214 GSM5732214: Qpm tumor 5; Danio rerio; RNA Seq GSM5732214   1 Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = five prime biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries we… GEO Accession:GSM5732214 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP350562     D16-101256.fastq.gz fastq 98789880.0 2469747.0 GSM5732214 r1 0:40 A:34779177;C:19539836;G:19833227;T:24577420;N:60220 40       34779177 19539836 19833227 24577420 60220 SRX13399907 SRS11303028 SRA1343073 GEO Koch Institute 1 0.8048   0.19299   0.85216   0.5989   40   B   usable mapping rate illumina nextseq 3prime cdna_unspecified nextera bulk bulk bulk   Unknown 2021-12-13 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
67662 67662 SRR17219893 SRX13399906 SRS11303026 SRP350562 PRJNA788496 MITF deficiency accelerates GNAQ driven uveal melanoma GSE190802 Transcriptome Analysis Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator MITF is essential for both CM development and maintenance but its role in UM is largely unexplored. Here we use zebrafish models to dissect the key UM oncogenic signaling events and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways YAP and PLCß ERK was also investigated in this system and thus showed that while activated YAP YAPAA induced UM with high potency the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably mitfa deficiency was profoundly UM promoting dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably all of the mitfa / UM tumors including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa / fish displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively these data show that YAP signaling is the major mediator of UM and that MITF acts as bona fide tumor suppressor in UM in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L tp53 / mitfa / n=10; Tgmitfa:GNAQ Q209L mitfa / n=10; Tgmitfa:GNAQ Q209L tp53 / eye n=8; Tgmitfa:GNAQ Q209L tp53 / skin n=9; Tgmitfa:BRAF V600E tp…       Qpm tumor 4 GSM5732212   source name:Qpm tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor Qpm tumor 4 NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24 RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset Qpm tumor Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = 5’ biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’ where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies 5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’ where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyze…   genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor GSM5732212 GSM5732212: Qpm tumor 4; Danio rerio; RNA Seq GSM5732212   1 Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = five prime biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries we… GEO Accession:GSM5732212 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP350562     D16-101255.fastq.gz fastq 156209080.0 3905227.0 GSM5732212 r1 0:40 A:54435131;C:31318276;G:32371758;T:37994070;N:89845 40       54435131 31318276 32371758 37994070 89845 SRX13399906 SRS11303026 SRA1343073 GEO Koch Institute 1 0.81902   0.18706   0.84524   0.62441   40   B   usable mapping rate illumina nextseq 3prime cdna_unspecified nextera bulk bulk bulk   Unknown 2021-12-13 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
67663 67663 SRR17219891 SRX13399905 SRS11303025 SRP350562 PRJNA788496 MITF deficiency accelerates GNAQ driven uveal melanoma GSE190802 Transcriptome Analysis Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator MITF is essential for both CM development and maintenance but its role in UM is largely unexplored. Here we use zebrafish models to dissect the key UM oncogenic signaling events and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways YAP and PLCß ERK was also investigated in this system and thus showed that while activated YAP YAPAA induced UM with high potency the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably mitfa deficiency was profoundly UM promoting dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably all of the mitfa / UM tumors including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa / fish displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively these data show that YAP signaling is the major mediator of UM and that MITF acts as bona fide tumor suppressor in UM in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L tp53 / mitfa / n=10; Tgmitfa:GNAQ Q209L mitfa / n=10; Tgmitfa:GNAQ Q209L tp53 / eye n=8; Tgmitfa:GNAQ Q209L tp53 / skin n=9; Tgmitfa:BRAF V600E tp…       Qpm tumor 3 GSM5732211   source name:Qpm tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor Qpm tumor 3 NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24 RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset Qpm tumor Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = 5’ biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’ where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies 5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’ where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyze…   genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor GSM5732211 GSM5732211: Qpm tumor 3; Danio rerio; RNA Seq GSM5732211   1 Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = five prime biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries we… GEO Accession:GSM5732211 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP350562     D16-101254.fastq.gz fastq 148839960.0 3720999.0 GSM5732211 r1 0:40 A:52156979;C:30408766;G:31252231;T:34935943;N:86041 40       52156979 30408766 31252231 34935943 86041 SRX13399905 SRS11303025 SRA1343073 GEO Koch Institute 1 0.82271   0.19102   0.8633   0.64179   40   B   usable mapping rate illumina nextseq 3prime cdna_unspecified nextera bulk bulk bulk   Unknown 2021-12-13 Undetermined Undetermined Cancer or Tumor Cancer or Tumor
67664 67664 SRR17219889 SRX13399904 SRS11303024 SRP350562 PRJNA788496 MITF deficiency accelerates GNAQ driven uveal melanoma GSE190802 Transcriptome Analysis Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator MITF is essential for both CM development and maintenance but its role in UM is largely unexplored. Here we use zebrafish models to dissect the key UM oncogenic signaling events and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways YAP and PLCß ERK was also investigated in this system and thus showed that while activated YAP YAPAA induced UM with high potency the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably mitfa deficiency was profoundly UM promoting dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably all of the mitfa / UM tumors including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa / fish displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively these data show that YAP signaling is the major mediator of UM and that MITF acts as bona fide tumor suppressor in UM in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L tp53 / mitfa / n=10; Tgmitfa:GNAQ Q209L mitfa / n=10; Tgmitfa:GNAQ Q209L tp53 / eye n=8; Tgmitfa:GNAQ Q209L tp53 / skin n=9; Tgmitfa:BRAF V600E tp…       Qpm tumor 2 GSM5732209   source name:Qpm tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor Qpm tumor 2 NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24 RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset Qpm tumor Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = 5’ biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’ where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies 5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’ where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyze…   genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor GSM5732209 GSM5732209: Qpm tumor 2; Danio rerio; RNA Seq GSM5732209   1 Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning RNA samples were cleaned using SPRI beads 1.8X quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime where 5Biosg = five prime biotin [BC6] = 6bp barcode specific to each sample/well N10 = Unique Molecular Identifiers Integrated DNA technologies to generate two subpools of 24 samples each. post addition of the oligonucleotides Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime where iC: iso dC iG: iso dG rG: RNA G ] followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM Integrated DNA Technologies five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime where * = phosphorothioate bonds. in place of the normal N500 primer. Final libraries we… GEO Accession:GSM5732209 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP350562     D16-101253.fastq.gz fastq 128233680.0 3205842.0 GSM5732209 r1 0:40 A:44051377;C:26029222;G:27011242;T:31066810;N:75029 40       44051377 26029222 27011242 31066810 75029 SRX13399904 SRS11303024 SRA1343073 GEO Koch Institute 1 0.81523   0.2073   0.84285   0.58754   40   B   usable mapping rate illumina nextseq 3prime cdna_unspecified nextera bulk bulk bulk   Unknown 2021-12-13 Undetermined Undetermined Cancer or Tumor Cancer or Tumor

Next page

Advanced export

JSON shape: default, array, newline-delimited

CSV options: 

CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;