run_metadata
3,544 rows where experiment.library_layout = "SINGLE" and tissue_curation = "Embryo Imprecise"
This data as json, CSV (advanced)
| Link | rowid ▼ | run.accession | experiment.accession | sample.accession | study.accession | bioproject | study.title | study.alias | study.type | study.abstract | study.attributes | study.PMIDs | sample.description | sample.title | sample.alias | sample.centername | sample.attributes | GEOsample.title | GEOsample.dataprocessing | GEOsample.source | GEOsample.treatmentprotocol | GEOsample.extractprotocol | GEOsample.growthprotocol | GEOsample.characteristics | GEOsample.accession | experiment.title | experiment.alias | experiment.library_name | experiment.design_description | experiment.library_construction_protocol | experiment.attributes | experiment.library_strategy | experiment.library_source | experiment.library_selection | experiment.library_layout | experiment.platform | experiment.instrument_model | experiment.spot_descriptor | experiment.study_ref | run.title | run.attributes | run.filename | run.semantic_name | run.total_bases | run.total_spots | run.alias | run.read_lengths | run.base_counts | run.r1_length | run.r2_length | run.r3_length | run.r4_length | run.Acount | run.Ccount | run.Gcount | run.Tcount | run.Ncount | run.experiment | run.pool_member | submission.accession | submission.srasource | submission.bioprojectsource | seqdetective.n_mates | seqdetective.mapping_rate.mate1 | seqdetective.mapping_rate.mate2 | seqdetective.nofeature_rate.mate1 | seqdetective.nofeature_rate.mate2 | seqdetective.sparsity.mate1 | seqdetective.sparsity.mate2 | seqdetective.pos_strand_rate.mate1 | seqdetective.pos_strand_rate.mate2 | seqdetective.readlen.mate1 | seqdetective.readlen.mate2 | seqdetective.judgement.mate1 | seqdetective.judgement.mate2 | seqdetective.judgement.reason | platform_family | instrument_generation | read_bias | selection_class | prep_kit | sc_or_bulk | tech_class | technology | tech_variant | submission.bioprojectsource.country | earliest_date | devstage_curation | devstage_curation_coarse | tissue_curation | tissue_curation_coarse |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 3015 | 3015 | ERR1396841 | ERX1468100 | ERS1051448 | ERP013615 | PRJEB12173 | Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts | Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011 | Transcriptome Analysis | Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos. | ArrayExpress:E ERAD 449 | zmp ph230 dgcr8 C7 | SAMEA3864314 | Wellcome Sanger Institute | ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864314|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:35Z|INSDC status:public|Submitter Id:2a85d100 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for dgcr8 allele sa223. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a85d100 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed | Illumina HiSeq 2500 sequencing | SC EXP 18732 2#24 | 15616955 | Illumina sequencing of library 15616955 constructed from sample accession ERS1051448 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 2. This submission includes reads tagged with the sequence ATTCCT. | Small RNA miRNA | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP013615 | Illumina HiSeq 2500 sequencing | ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16 | 18732_2#24.cram | cram | 252742350.0 | 5054847.0 | SC RUN 18732 2#24 | 0:50 | A:72444190;C:64568625;G:62796637;T:52911792;N:21106 | 50 | 72444190 | 64568625 | 62796637 | 52911792 | 21106 | ERX1468100 | ERS1051448 | ERA612385 | European Nucleotide Archive | Wellcome Sanger Institute | 1 | 0.61824 | 0.09608 | 0.8842 | 0.56978 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | unknown | unknown | United Kingdom | 2016-02-03 | Larval | Larval | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||
| 3039 | 3039 | ERR1396817 | ERX1468076 | ERS1051448 | ERP013615 | PRJEB12173 | Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts | Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011 | Transcriptome Analysis | Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos. | ArrayExpress:E ERAD 449 | zmp ph230 dgcr8 C7 | SAMEA3864314 | Wellcome Sanger Institute | ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864314|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:35Z|INSDC status:public|Submitter Id:2a85d100 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for dgcr8 allele sa223. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a85d100 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed | Illumina HiSeq 2500 sequencing | SC EXP 18732 1#24 | 15616955 | Illumina sequencing of library 15616955 constructed from sample accession ERS1051448 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 1. This submission includes reads tagged with the sequence ATTCCT. | Small RNA miRNA | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP013615 | Illumina HiSeq 2500 sequencing | ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16 | 18732_1#24.cram | cram | 258624300.0 | 5172486.0 | SC RUN 18732 1#24 | 0:50 | A:74123846;C:66047722;G:64286422;T:54141623;N:24687 | 50 | 74123846 | 66047722 | 64286422 | 54141623 | 24687 | ERX1468076 | ERS1051448 | ERA612385 | European Nucleotide Archive | Wellcome Sanger Institute | 1 | 0.62009 | 0.09612 | 0.88434 | 0.55718 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | unknown | unknown | United Kingdom | 2016-02-03 | Larval | Larval | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||
| 8088 | 8088 | ERR034127 | ERX012653 | ERS032268 | ERP000635 | PRJEB2512 | The Zebrafish transcriptome during early development | KI-BN-JKE-DRERIO-RNASEQ-2011 | Transcriptome Analysis | Background: Zebrafish Danio rerio is an important model for the study of early vertebrate development. The transition from fertilized egg to embryo is accompanied by a multitude of changes in gene expression and the transcriptional events that underlie these processes have not been fully characterized. In this study we use RNA Seq to characterize and compare the transcriptome of four early developmental stages in zebrafish on a global scale. Results: An average of 79M total reads were detected from the different stages. Out of the total number of reads 65% 73% reads were successfully mapped to the zebrafish genome and 36% 44% out of those were uniquely mapped. The total number of detected unique gene transcripts was 11187 of which 10096 of these were already present at 1 cell stage. The largest number of common transcripts was observed between 1 cell stage and 16 cell stage. An enrichment of gene transcripts with molecular functions of DNA binding protein folding and processing as well as metal ion binding was observed with progression of development. To confirm our RNA Seq results and to further investigate the developmental expression of specific genes the transcript levels of a subset of genes were analyzed using TaqMan® array micro fluidic card TLDA. Conclusion: Clustering analysis of the detected transcripts show a majority of gene transcripts being present at steady levels with a minority of the gene transcripts clustering as increasing or decreasing in expression during development. Developmental stages pre MBT were similar when comparing highly expressed genes whereas 50% epiboly stage differed from the earlier three stages in highly expressed genes number of uniquely expressed genes and enrichment of GO molecular functions. | RNA extracted from zebrafish embryo at 50% epiboly stage | zebrafish embryo 50 epiboly | SAMEA791629 | Department of Biosciences and Nutrition, Karolinska Institutet, Sweden | ENA first public:2011 06 09|ENA last update:2018 03 08|External Id:SAMEA791629|INSDC center alias:KI BN|INSDC center name:Department of Biosciences and Nutrition Karolinska Institutet Sweden|INSDC first public:2011 06 09T11:04:10Z|INSDC last update:2018 03 08T15:26:39Z|INSDC status:public|Submitter Id:KI BN JKE DRERIO RNASEQ 2011 50epiboly|common name:zebrafish|sample name:KI BN JKE DRERIO RNASEQ 2011 50epiboly|sex:mixed|strain:Tuebingen | Transcriptome profiling of early zebrafish development | KI BN JKE DRERIO RNASEQ 2011 50epiboly | JKE Drerio rna seq | Transcriptome profiling of 50% epiboly stages of zebrafish embryos. | Total RNA was extracted from approximately 150 embryos per developmental stage using Trireagent Sigma Aldrich. The total RNA was then processed further according to the Small RNA Expression Kit Applied Biosystems. | RNA-Seq | TRANSCRIPTOMIC | RANDOM | SINGLE | ABI_SOLID | AB SOLiD System 3.0 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>50</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | ERP000635 | AB SOLiD System 3.0 sequencing; Transcriptome profiling of early zebrafish development | ENA FIRST PUBLIC:2011 06 09|ENA LAST UPDATE:2018 11 16 | KI-BN-JKE-DRERIO-RNASEQ-2011-50epiboly.csfasta.gz KI-BN-JKE-DRERIO-RNASEQ-2011-50epiboly_QV.qual.gz | SOLiD_native SOLiD_native | 3929903550.0 | 78598071.0 | KI BN JKE DRERIO RNASEQ 2011 50epiboly | 0:50 | 50 | ERX012653 | ERS032268 | ERA029959 | KI-BN|Department of Biosciences and Nutrition | Department of Biosciences and Nutrition, Karolinska Institutet, Sweden | 1 | 0.60757 | 0.09893 | 0.94899 | 0.77821 | 50 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | unknown | unknown | Sweden | 2011-06-09 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 8089 | 8089 | ERR034126 | ERX012652 | ERS032267 | ERP000635 | PRJEB2512 | The Zebrafish transcriptome during early development | KI-BN-JKE-DRERIO-RNASEQ-2011 | Transcriptome Analysis | Background: Zebrafish Danio rerio is an important model for the study of early vertebrate development. The transition from fertilized egg to embryo is accompanied by a multitude of changes in gene expression and the transcriptional events that underlie these processes have not been fully characterized. In this study we use RNA Seq to characterize and compare the transcriptome of four early developmental stages in zebrafish on a global scale. Results: An average of 79M total reads were detected from the different stages. Out of the total number of reads 65% 73% reads were successfully mapped to the zebrafish genome and 36% 44% out of those were uniquely mapped. The total number of detected unique gene transcripts was 11187 of which 10096 of these were already present at 1 cell stage. The largest number of common transcripts was observed between 1 cell stage and 16 cell stage. An enrichment of gene transcripts with molecular functions of DNA binding protein folding and processing as well as metal ion binding was observed with progression of development. To confirm our RNA Seq results and to further investigate the developmental expression of specific genes the transcript levels of a subset of genes were analyzed using TaqMan® array micro fluidic card TLDA. Conclusion: Clustering analysis of the detected transcripts show a majority of gene transcripts being present at steady levels with a minority of the gene transcripts clustering as increasing or decreasing in expression during development. Developmental stages pre MBT were similar when comparing highly expressed genes whereas 50% epiboly stage differed from the earlier three stages in highly expressed genes number of uniquely expressed genes and enrichment of GO molecular functions. | RNA extracted from zebrafish embryo at 512 cell stage | zebrafish embryo 512 cell | SAMEA791632 | Department of Biosciences and Nutrition, Karolinska Institutet, Sweden | ENA first public:2011 06 09|ENA last update:2018 03 08|External Id:SAMEA791632|INSDC center alias:KI BN|INSDC center name:Department of Biosciences and Nutrition Karolinska Institutet Sweden|INSDC first public:2011 06 09T11:04:10Z|INSDC last update:2018 03 08T15:26:39Z|INSDC status:public|Submitter Id:KI BN JKE DRERIO RNASEQ 2011 512cell|common name:zebrafish|sample name:KI BN JKE DRERIO RNASEQ 2011 512cell|sex:mixed|strain:Tuebingen | Transcriptome profiling of early zebrafish development | KI BN JKE DRERIO RNASEQ 2011 512cell | JKE Drerio rna seq | Transcriptome profiling of 512 cell stage of zebrafish embryos. | Total RNA was extracted from approximately 150 embryos per developmental stage using Trireagent Sigma Aldrich. The total RNA was then processed further according to the Small RNA Expression Kit Applied Biosystems. | RNA-Seq | TRANSCRIPTOMIC | RANDOM | SINGLE | ABI_SOLID | AB SOLiD System 3.0 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>50</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | ERP000635 | AB SOLiD System 3.0 sequencing; Transcriptome profiling of early zebrafish development | ENA FIRST PUBLIC:2011 06 09|ENA LAST UPDATE:2018 11 16 | KI-BN-JKE-DRERIO-RNASEQ-2011-512cell.csfasta.gz KI-BN-JKE-DRERIO-RNASEQ-2011-512cell_QV.qual.gz | SOLiD_native SOLiD_native | 3918756250.0 | 78375125.0 | KI BN JKE DRERIO RNASEQ 2011 512cell | 0:50 | 50 | ERX012652 | ERS032267 | ERA029959 | KI-BN|Department of Biosciences and Nutrition | Department of Biosciences and Nutrition, Karolinska Institutet, Sweden | 1 | 0.63824 | 0.09111 | 0.91969 | 0.73496 | 50 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | unknown | unknown | Sweden | 2011-06-09 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 8090 | 8090 | ERR034125 | ERX012651 | ERS032266 | ERP000635 | PRJEB2512 | The Zebrafish transcriptome during early development | KI-BN-JKE-DRERIO-RNASEQ-2011 | Transcriptome Analysis | Background: Zebrafish Danio rerio is an important model for the study of early vertebrate development. The transition from fertilized egg to embryo is accompanied by a multitude of changes in gene expression and the transcriptional events that underlie these processes have not been fully characterized. In this study we use RNA Seq to characterize and compare the transcriptome of four early developmental stages in zebrafish on a global scale. Results: An average of 79M total reads were detected from the different stages. Out of the total number of reads 65% 73% reads were successfully mapped to the zebrafish genome and 36% 44% out of those were uniquely mapped. The total number of detected unique gene transcripts was 11187 of which 10096 of these were already present at 1 cell stage. The largest number of common transcripts was observed between 1 cell stage and 16 cell stage. An enrichment of gene transcripts with molecular functions of DNA binding protein folding and processing as well as metal ion binding was observed with progression of development. To confirm our RNA Seq results and to further investigate the developmental expression of specific genes the transcript levels of a subset of genes were analyzed using TaqMan® array micro fluidic card TLDA. Conclusion: Clustering analysis of the detected transcripts show a majority of gene transcripts being present at steady levels with a minority of the gene transcripts clustering as increasing or decreasing in expression during development. Developmental stages pre MBT were similar when comparing highly expressed genes whereas 50% epiboly stage differed from the earlier three stages in highly expressed genes number of uniquely expressed genes and enrichment of GO molecular functions. | RNA extracted from zebrafish embryo at 16 cell stage | zebrafish embryo 16 cell | SAMEA791631 | Department of Biosciences and Nutrition, Karolinska Institutet, Sweden | ENA first public:2011 06 09|ENA last update:2018 03 08|External Id:SAMEA791631|INSDC center alias:KI BN|INSDC center name:Department of Biosciences and Nutrition Karolinska Institutet Sweden|INSDC first public:2011 06 09T11:04:10Z|INSDC last update:2018 03 08T15:26:39Z|INSDC status:public|Submitter Id:KI BN JKE DRERIO RNASEQ 2011 16cell|common name:zebrafish|sample name:KI BN JKE DRERIO RNASEQ 2011 16cell|sex:mixed|strain:Tuebingen | Transcriptome profiling of early zebrafish development | KI BN JKE DRERIO RNASEQ 2011 16cell | JKE Drerio rna seq | Transcriptome profiling of 16 cell stage of zebrafish embryos. | Total RNA was extracted from approximately 150 embryos per developmental stage using Trireagent Sigma Aldrich. The total RNA was then processed further according to the Small RNA Expression Kit Applied Biosystems. | RNA-Seq | TRANSCRIPTOMIC | RANDOM | SINGLE | ABI_SOLID | AB SOLiD System 3.0 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>50</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | ERP000635 | AB SOLiD System 3.0 sequencing; Transcriptome profiling of early zebrafish development | ENA FIRST PUBLIC:2011 06 09|ENA LAST UPDATE:2018 11 16 | KI-BN-JKE-DRERIO-RNASEQ-2011-16cell.csfasta.gz KI-BN-JKE-DRERIO-RNASEQ-2011-16cell_QV.qual.gz | SOLiD_native SOLiD_native | 4256756500.0 | 85135130.0 | KI BN JKE DRERIO RNASEQ 2011 16cell | 0:50 | 50 | ERX012651 | ERS032266 | ERA029959 | KI-BN|Department of Biosciences and Nutrition | Department of Biosciences and Nutrition, Karolinska Institutet, Sweden | 1 | 0.57946 | 0.08115 | 0.91896 | 0.72164 | 50 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | unknown | unknown | Sweden | 2011-06-09 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 8091 | 8091 | ERR034124 | ERX012650 | ERS032265 | ERP000635 | PRJEB2512 | The Zebrafish transcriptome during early development | KI-BN-JKE-DRERIO-RNASEQ-2011 | Transcriptome Analysis | Background: Zebrafish Danio rerio is an important model for the study of early vertebrate development. The transition from fertilized egg to embryo is accompanied by a multitude of changes in gene expression and the transcriptional events that underlie these processes have not been fully characterized. In this study we use RNA Seq to characterize and compare the transcriptome of four early developmental stages in zebrafish on a global scale. Results: An average of 79M total reads were detected from the different stages. Out of the total number of reads 65% 73% reads were successfully mapped to the zebrafish genome and 36% 44% out of those were uniquely mapped. The total number of detected unique gene transcripts was 11187 of which 10096 of these were already present at 1 cell stage. The largest number of common transcripts was observed between 1 cell stage and 16 cell stage. An enrichment of gene transcripts with molecular functions of DNA binding protein folding and processing as well as metal ion binding was observed with progression of development. To confirm our RNA Seq results and to further investigate the developmental expression of specific genes the transcript levels of a subset of genes were analyzed using TaqMan® array micro fluidic card TLDA. Conclusion: Clustering analysis of the detected transcripts show a majority of gene transcripts being present at steady levels with a minority of the gene transcripts clustering as increasing or decreasing in expression during development. Developmental stages pre MBT were similar when comparing highly expressed genes whereas 50% epiboly stage differed from the earlier three stages in highly expressed genes number of uniquely expressed genes and enrichment of GO molecular functions. | RNA extracted from zebrafish embryo at 1 cell stage | zebrafish embryo 1 cell | SAMEA791630 | Department of Biosciences and Nutrition, Karolinska Institutet, Sweden | ENA first public:2011 06 09|ENA last update:2018 03 08|External Id:SAMEA791630|INSDC center alias:KI BN|INSDC center name:Department of Biosciences and Nutrition Karolinska Institutet Sweden|INSDC first public:2011 06 09T11:04:10Z|INSDC last update:2018 03 08T15:26:39Z|INSDC status:public|Submitter Id:KI BN JKE DRERIO RNASEQ 2011 1cell|common name:zebrafish|sample name:KI BN JKE DRERIO RNASEQ 2011 1cell|sex:mixed|strain:Tuebingen | Transcriptome profiling of early zebrafish development | KI BN JKE DRERIO RNASEQ 2011 1cell | JKE Drerio rna seq | Transcriptome profiling of 1 cell stage of zebrafish embryos. | Total RNA was extracted from approximately 150 embryos per developmental stage using Trireagent Sigma Aldrich. The total RNA was then processed further according to the Small RNA Expression Kit Applied Biosystems. | RNA-Seq | TRANSCRIPTOMIC | RANDOM | SINGLE | ABI_SOLID | AB SOLiD System 3.0 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>50</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | ERP000635 | AB SOLiD System 3.0 sequencing; Transcriptome profiling of early zebrafish development | ENA FIRST PUBLIC:2011 06 09|ENA LAST UPDATE:2018 11 16 | KI-BN-JKE-DRERIO-RNASEQ-2011-1cell.csfasta.gz KI-BN-JKE-DRERIO-RNASEQ-2011-1cell_QV.qual.gz | SOLiD_native SOLiD_native | 3676380950.0 | 73527619.0 | KI BN JKE DRERIO RNASEQ 2011 1cell | 0:50 | 50 | ERX012650 | ERS032265 | ERA029959 | KI-BN|Department of Biosciences and Nutrition | Department of Biosciences and Nutrition, Karolinska Institutet, Sweden | 1 | 0.64855 | 0.08432 | 0.9052 | 0.74223 | 50 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | unknown | unknown | Sweden | 2011-06-09 | Zygote | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 9361 | 9361 | ERR3011947 | ERX3014407 | ERS2994081 | ERP112907 | PRJEB30451 | Effects of anti androgenic compounds on zebrafish insulin mutants | E-MTAB-7283 | Transcriptome Analysis | Aiming to identify insulin independent modulators of glucose homeostasis we performed a drug screen on zebrafish insulin ins mutants and identified androgen receptor AR antagonists. To investigate how AR antagonism mediates glucose level reduction in ins mutants we evaluated the effects of antagonist treatment using transcriptomic studies. RNA Seq analyses were performed on 120 hpf ins mutants treated with Flutamide or Cyproterone starting at 84 hpf compared to vehicle DMSO treated mutants. | ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18 | Protocols: insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina | Flutamide 2 | SAMEA5186582 | Max Planck Institute for Heart and Lung Research | ENA FIRST PUBLIC:2018 12 21T17:03:09Z|ENA LAST UPDATE:2018 12 18T09:28:56Z|External Id:SAMEA5186582|INSDC center name:Max Planck Institute for Heart and Lung Research|INSDC first public:2018 12 21T17:03:09Z|INSDC last update:2018 12 18T09:28:56Z|INSDC status:public|Submitter Id:E MTAB 7283:Flutamide 2|age:120|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:ins CRISPR/Cas9 mediated knockout|individual:mixed pool of 10 embryos|organism part:whole organism|sample name:E MTAB 7283:Flutamide 2|scientific name:Danio rerio|strain:ins bns102 | NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants | E MTAB 7283:Flutamide 2 s | Flutamide 2 s | Effects of anti androgenic compounds on zebrafish insulin mutants | insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina | Experimental Factor: compound:flutamide|Experimental Factor: dose:10 | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | NextSeq 500 | ERP112907 | NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants | ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18 | Teja_Flutamide_2_R1.fastq.gz | fastq | 1754963940.0 | 23552243.0 | E MTAB 7283:Flutamide 2 | 0:74.51 1:0 | A:455444321;C:410713896;G:385640226;T:503155736;N:9761 | 74 | 0 | 455444321 | 410713896 | 385640226 | 503155736 | 9761 | ERX3014407 | ERS2994081 | ERA1697296 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94351 | 0.11595 | 0.67483 | 0.48762 | 73 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | trueseq | bulk | unknown | unknown | Unknown | 2018-12-18 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9362 | 9362 | ERR3011946 | ERX3014406 | ERS2994080 | ERP112907 | PRJEB30451 | Effects of anti androgenic compounds on zebrafish insulin mutants | E-MTAB-7283 | Transcriptome Analysis | Aiming to identify insulin independent modulators of glucose homeostasis we performed a drug screen on zebrafish insulin ins mutants and identified androgen receptor AR antagonists. To investigate how AR antagonism mediates glucose level reduction in ins mutants we evaluated the effects of antagonist treatment using transcriptomic studies. RNA Seq analyses were performed on 120 hpf ins mutants treated with Flutamide or Cyproterone starting at 84 hpf compared to vehicle DMSO treated mutants. | ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18 | Protocols: insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina | Flutamide 1 | SAMEA5186581 | Max Planck Institute for Heart and Lung Research | ENA FIRST PUBLIC:2018 12 21T17:03:09Z|ENA LAST UPDATE:2018 12 18T09:28:56Z|External Id:SAMEA5186581|INSDC center name:Max Planck Institute for Heart and Lung Research|INSDC first public:2018 12 21T17:03:09Z|INSDC last update:2018 12 18T09:28:56Z|INSDC status:public|Submitter Id:E MTAB 7283:Flutamide 1|age:120|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:ins CRISPR/Cas9 mediated knockout|individual:mixed pool of 10 embryos|organism part:whole organism|sample name:E MTAB 7283:Flutamide 1|scientific name:Danio rerio|strain:ins bns102 | NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants | E MTAB 7283:Flutamide 1 s | Flutamide 1 s | Effects of anti androgenic compounds on zebrafish insulin mutants | insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina | Experimental Factor: compound:flutamide|Experimental Factor: dose:10 | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | NextSeq 500 | ERP112907 | NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants | ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18 | Teja_Flutamide_1_R1.fastq.gz | fastq | 1631102863.0 | 21898245.0 | E MTAB 7283:Flutamide 1 | 0:74.49 1:0 | A:424378341;C:380806325;G:358128992;T:467779945;N:9260 | 74 | 0 | 424378341 | 380806325 | 358128992 | 467779945 | 9260 | ERX3014406 | ERS2994080 | ERA1697296 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94332 | 0.11797 | 0.67596 | 0.48847 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | trueseq | bulk | unknown | unknown | Unknown | 2018-12-18 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9363 | 9363 | ERR3011945 | ERX3014405 | ERS2994079 | ERP112907 | PRJEB30451 | Effects of anti androgenic compounds on zebrafish insulin mutants | E-MTAB-7283 | Transcriptome Analysis | Aiming to identify insulin independent modulators of glucose homeostasis we performed a drug screen on zebrafish insulin ins mutants and identified androgen receptor AR antagonists. To investigate how AR antagonism mediates glucose level reduction in ins mutants we evaluated the effects of antagonist treatment using transcriptomic studies. RNA Seq analyses were performed on 120 hpf ins mutants treated with Flutamide or Cyproterone starting at 84 hpf compared to vehicle DMSO treated mutants. | ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18 | Protocols: insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina | DMSO 2 | SAMEA5186580 | Max Planck Institute for Heart and Lung Research | ENA FIRST PUBLIC:2018 12 21T17:03:09Z|ENA LAST UPDATE:2018 12 18T09:28:56Z|External Id:SAMEA5186580|INSDC center name:Max Planck Institute for Heart and Lung Research|INSDC first public:2018 12 21T17:03:09Z|INSDC last update:2018 12 18T09:28:56Z|INSDC status:public|Submitter Id:E MTAB 7283:DMSO 2|age:120|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:ins CRISPR/Cas9 mediated knockout|individual:mixed pool of 10 embryos|organism part:whole organism|sample name:E MTAB 7283:DMSO 2|scientific name:Danio rerio|strain:ins bns102 | NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants | E MTAB 7283:DMSO 2 s | DMSO 2 s | Effects of anti androgenic compounds on zebrafish insulin mutants | insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina | Experimental Factor: compound:dimethyl sulfoxide|Experimental Factor: dose:1 | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | NextSeq 500 | ERP112907 | NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants | ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18 | Teja_DMSO_2_R1.fastq.gz | fastq | 1811573293.0 | 24316929.0 | E MTAB 7283:DMSO 2 | 0:74.50 1:0 | A:470888315;C:423635861;G:396796840;T:520242179;N:10098 | 74 | 0 | 470888315 | 423635861 | 396796840 | 520242179 | 10098 | ERX3014405 | ERS2994079 | ERA1697296 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94219 | 0.12305 | 0.67184 | 0.47704 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | trueseq | bulk | unknown | unknown | Unknown | 2018-12-18 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9364 | 9364 | ERR3011944 | ERX3014404 | ERS2994078 | ERP112907 | PRJEB30451 | Effects of anti androgenic compounds on zebrafish insulin mutants | E-MTAB-7283 | Transcriptome Analysis | Aiming to identify insulin independent modulators of glucose homeostasis we performed a drug screen on zebrafish insulin ins mutants and identified androgen receptor AR antagonists. To investigate how AR antagonism mediates glucose level reduction in ins mutants we evaluated the effects of antagonist treatment using transcriptomic studies. RNA Seq analyses were performed on 120 hpf ins mutants treated with Flutamide or Cyproterone starting at 84 hpf compared to vehicle DMSO treated mutants. | ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18 | Protocols: insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina | DMSO 1 | SAMEA5186579 | Max Planck Institute for Heart and Lung Research | ENA FIRST PUBLIC:2018 12 21T17:03:09Z|ENA LAST UPDATE:2018 12 18T09:28:56Z|External Id:SAMEA5186579|INSDC center name:Max Planck Institute for Heart and Lung Research|INSDC first public:2018 12 21T17:03:09Z|INSDC last update:2018 12 18T09:28:56Z|INSDC status:public|Submitter Id:E MTAB 7283:DMSO 1|age:120|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:ins CRISPR/Cas9 mediated knockout|individual:mixed pool of 10 embryos|organism part:whole organism|sample name:E MTAB 7283:DMSO 1|scientific name:Danio rerio|strain:ins bns102 | NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants | E MTAB 7283:DMSO 1 s | DMSO 1 s | Effects of anti androgenic compounds on zebrafish insulin mutants | insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina | Experimental Factor: compound:dimethyl sulfoxide|Experimental Factor: dose:1 | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | NextSeq 500 | ERP112907 | NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants | ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18 | Teja_DMSO_1_R1.fastq.gz | fastq | 1609807409.0 | 21611475.0 | E MTAB 7283:DMSO 1 | 0:74.49 1:0 | A:420253680;C:374436301;G:352526427;T:462581933;N:9068 | 74 | 0 | 420253680 | 374436301 | 352526427 | 462581933 | 9068 | ERX3014404 | ERS2994078 | ERA1697296 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94094 | 0.12292 | 0.67006 | 0.48442 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | trueseq | bulk | unknown | unknown | Unknown | 2018-12-18 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9365 | 9365 | ERR3011943 | ERX3014403 | ERS2994077 | ERP112907 | PRJEB30451 | Effects of anti androgenic compounds on zebrafish insulin mutants | E-MTAB-7283 | Transcriptome Analysis | Aiming to identify insulin independent modulators of glucose homeostasis we performed a drug screen on zebrafish insulin ins mutants and identified androgen receptor AR antagonists. To investigate how AR antagonism mediates glucose level reduction in ins mutants we evaluated the effects of antagonist treatment using transcriptomic studies. RNA Seq analyses were performed on 120 hpf ins mutants treated with Flutamide or Cyproterone starting at 84 hpf compared to vehicle DMSO treated mutants. | ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18 | Protocols: insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina | Cyproter1 2 | SAMEA5186578 | Max Planck Institute for Heart and Lung Research | ENA FIRST PUBLIC:2018 12 21T17:03:09Z|ENA LAST UPDATE:2018 12 18T09:28:56Z|External Id:SAMEA5186578|INSDC center name:Max Planck Institute for Heart and Lung Research|INSDC first public:2018 12 21T17:03:09Z|INSDC last update:2018 12 18T09:28:56Z|INSDC status:public|Submitter Id:E MTAB 7283:Cyproter1 2|age:120|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:ins CRISPR/Cas9 mediated knockout|individual:mixed pool of 10 embryos|organism part:whole organism|sample name:E MTAB 7283:Cyproter1 2|scientific name:Danio rerio|strain:ins bns102 | NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants | E MTAB 7283:Cyproterone 2 s | Cyproterone 2 s | Effects of anti androgenic compounds on zebrafish insulin mutants | insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina | Experimental Factor: compound:cyproter1|Experimental Factor: dose:10 | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | NextSeq 500 | ERP112907 | NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants | ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18 | Teja_Cyproterone_2_R1.fastq.gz | fastq | 1823142918.0 | 24468337.0 | E MTAB 7283:Cyproterone 2 | 0:74.51 1:0 | A:469387174;C:428783310;G:403791044;T:521171021;N:10369 | 74 | 0 | 469387174 | 428783310 | 403791044 | 521171021 | 10369 | ERX3014403 | ERS2994077 | ERA1697296 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.9432 | 0.11718 | 0.67389 | 0.4768 | 74 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | trueseq | bulk | unknown | unknown | Unknown | 2018-12-18 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9366 | 9366 | ERR3011942 | ERX3014402 | ERS2994076 | ERP112907 | PRJEB30451 | Effects of anti androgenic compounds on zebrafish insulin mutants | E-MTAB-7283 | Transcriptome Analysis | Aiming to identify insulin independent modulators of glucose homeostasis we performed a drug screen on zebrafish insulin ins mutants and identified androgen receptor AR antagonists. To investigate how AR antagonism mediates glucose level reduction in ins mutants we evaluated the effects of antagonist treatment using transcriptomic studies. RNA Seq analyses were performed on 120 hpf ins mutants treated with Flutamide or Cyproterone starting at 84 hpf compared to vehicle DMSO treated mutants. | ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18 | Protocols: insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina | Cyproter1 1 | SAMEA5186577 | Max Planck Institute for Heart and Lung Research | ENA FIRST PUBLIC:2018 12 21T17:03:09Z|ENA LAST UPDATE:2018 12 18T09:28:56Z|External Id:SAMEA5186577|INSDC center name:Max Planck Institute for Heart and Lung Research|INSDC first public:2018 12 21T17:03:09Z|INSDC last update:2018 12 18T09:28:56Z|INSDC status:public|Submitter Id:E MTAB 7283:Cyproter1 1|age:120|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:ins CRISPR/Cas9 mediated knockout|individual:mixed pool of 10 embryos|organism part:whole organism|sample name:E MTAB 7283:Cyproter1 1|scientific name:Danio rerio|strain:ins bns102 | NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants | E MTAB 7283:Cyproterone 1 s | Cyproterone 1 s | Effects of anti androgenic compounds on zebrafish insulin mutants | insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina | Experimental Factor: compound:cyproter1|Experimental Factor: dose:10 | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | NextSeq 500 | ERP112907 | NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants | ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18 | Teja_Cyproterone_1_R1.fastq.gz | fastq | 1901027130.0 | 25512731.0 | E MTAB 7283:Cyproterone 1 | 0:74.51 1:0 | A:487302419;C:449208827;G:422183780;T:542321577;N:10527 | 74 | 0 | 487302419 | 449208827 | 422183780 | 542321577 | 10527 | ERX3014402 | ERS2994076 | ERA1697296 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94427 | 0.11318 | 0.67294 | 0.47183 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | trueseq | bulk | unknown | unknown | Unknown | 2018-12-18 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9651 | 9651 | ERR3266392 | ERX3293003 | ERS3358386 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp positive rep2 | SAMEA5556346 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp positive rep2 s | sponge tdr gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_9pos_S2_L001_R1_001.fastq.gz | fastq | 603238067.0 | 8014716.0 | E MTAB 7846:sponge tdr gfp positive rep2 lane1 | 0:75.27 1:0 | A:164797697;C:136552121;G:141138007;T:160737152;N:13090 | 75 | 0 | 164797697 | 136552121 | 141138007 | 160737152 | 13090 | ERX3293003 | ERS3358386 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95083 | 0.06432 | 0.71532 | 0.50098 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9652 | 9652 | ERR3266393 | ERX3293003 | ERS3358386 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp positive rep2 | SAMEA5556346 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp positive rep2 s | sponge tdr gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_9pos_S2_L002_R1_001.fastq.gz | fastq | 603749720.0 | 8021069.0 | E MTAB 7846:sponge tdr gfp positive rep2 lane2 | 0:75.27 1:0 | A:164972969;C:136661417;G:141205792;T:160896264;N:13278 | 75 | 0 | 164972969 | 136661417 | 141205792 | 160896264 | 13278 | ERX3293003 | ERS3358386 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.951 | 0.06542 | 0.71768 | 0.50051 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9653 | 9653 | ERR3266394 | ERX3293003 | ERS3358386 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp positive rep2 | SAMEA5556346 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp positive rep2 s | sponge tdr gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_9pos_S2_L003_R1_001.fastq.gz | fastq | 608154053.0 | 8079704.0 | E MTAB 7846:sponge tdr gfp positive rep2 lane3 | 0:75.27 1:0 | A:166117918;C:137731172;G:142320339;T:161970092;N:14532 | 75 | 0 | 166117918 | 137731172 | 142320339 | 161970092 | 14532 | ERX3293003 | ERS3358386 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95155 | 0.0657 | 0.71634 | 0.49493 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9654 | 9654 | ERR3266395 | ERX3293003 | ERS3358386 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp positive rep2 | SAMEA5556346 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp positive rep2 s | sponge tdr gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_9pos_S2_L004_R1_001.fastq.gz | fastq | 599143392.0 | 7959897.0 | E MTAB 7846:sponge tdr gfp positive rep2 lane4 | 0:75.27 1:0 | A:163706904;C:135622453;G:140192351;T:159605249;N:16435 | 75 | 0 | 163706904 | 135622453 | 140192351 | 159605249 | 16435 | ERX3293003 | ERS3358386 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95061 | 0.06431 | 0.71764 | 0.50166 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9655 | 9655 | ERR3266388 | ERX3293002 | ERS3358385 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp positive rep1 | SAMEA5556345 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp positive rep1 s | sponge tdr gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_6pos_S4_L001_R1_001.fastq.gz | fastq | 616761505.0 | 8202480.0 | E MTAB 7846:sponge tdr gfp positive rep1 lane1 | 0:75.19 1:0 | A:168679238;C:139548565;G:143969797;T:164545362;N:18543 | 75 | 0 | 168679238 | 139548565 | 143969797 | 164545362 | 18543 | ERX3293002 | ERS3358385 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95019 | 0.06806 | 0.7097 | 0.50337 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9656 | 9656 | ERR3266389 | ERX3293002 | ERS3358385 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp positive rep1 | SAMEA5556345 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp positive rep1 s | sponge tdr gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_6pos_S4_L002_R1_001.fastq.gz | fastq | 617529482.0 | 8212485.0 | E MTAB 7846:sponge tdr gfp positive rep1 lane2 | 0:75.19 1:0 | A:168925757;C:139655387;G:144096837;T:164831236;N:20265 | 75 | 0 | 168925757 | 139655387 | 144096837 | 164831236 | 20265 | ERX3293002 | ERS3358385 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.9492 | 0.06753 | 0.712 | 0.49881 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9657 | 9657 | ERR3266390 | ERX3293002 | ERS3358385 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp positive rep1 | SAMEA5556345 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp positive rep1 s | sponge tdr gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_6pos_S4_L003_R1_001.fastq.gz | fastq | 624156883.0 | 8300861.0 | E MTAB 7846:sponge tdr gfp positive rep1 lane3 | 0:75.19 1:0 | A:170696950;C:141302376;G:145759286;T:166377781;N:20490 | 75 | 0 | 170696950 | 141302376 | 145759286 | 166377781 | 20490 | ERX3293002 | ERS3358385 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94917 | 0.06724 | 0.71291 | 0.50783 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9658 | 9658 | ERR3266391 | ERX3293002 | ERS3358385 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp positive rep1 | SAMEA5556345 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp positive rep1 s | sponge tdr gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_6pos_S4_L004_R1_001.fastq.gz | fastq | 615013615.0 | 8179180.0 | E MTAB 7846:sponge tdr gfp positive rep1 lane4 | 0:75.19 1:0 | A:168237742;C:139106952;G:143535658;T:164110735;N:22528 | 75 | 0 | 168237742 | 139106952 | 143535658 | 164110735 | 22528 | ERX3293002 | ERS3358385 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94892 | 0.06723 | 0.71206 | 0.50775 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9659 | 9659 | ERR3266384 | ERX3293001 | ERS3358384 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp negative rep2 | SAMEA5556344 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556344|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp negative rep2 s | sponge tdr gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_9neg_S1_L001_R1_001.fastq.gz | fastq | 659562366.0 | 8762947.0 | E MTAB 7846:sponge tdr gfp negative rep2 lane1 | 0:75.27 1:0 | A:178744772;C:150091912;G:155092318;T:175619332;N:14032 | 75 | 0 | 178744772 | 150091912 | 155092318 | 175619332 | 14032 | ERX3293001 | ERS3358384 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.9517 | 0.06908 | 0.70822 | 0.48025 | 73 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9660 | 9660 | ERR3266385 | ERX3293001 | ERS3358384 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp negative rep2 | SAMEA5556344 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556344|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp negative rep2 s | sponge tdr gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_9neg_S1_L002_R1_001.fastq.gz | fastq | 658688825.0 | 8751176.0 | E MTAB 7846:sponge tdr gfp negative rep2 lane2 | 0:75.27 1:0 | A:178540155;C:149844100;G:154850294;T:175438757;N:15519 | 75 | 0 | 178540155 | 149844100 | 154850294 | 175438757 | 15519 | ERX3293001 | ERS3358384 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95059 | 0.06748 | 0.70806 | 0.48177 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9661 | 9661 | ERR3266386 | ERX3293001 | ERS3358384 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp negative rep2 | SAMEA5556344 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556344|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp negative rep2 s | sponge tdr gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_9neg_S1_L003_R1_001.fastq.gz | fastq | 665901310.0 | 8846927.0 | E MTAB 7846:sponge tdr gfp negative rep2 lane3 | 0:75.27 1:0 | A:180412445;C:151589489;G:156677030;T:177206192;N:16154 | 75 | 0 | 180412445 | 151589489 | 156677030 | 177206192 | 16154 | ERX3293001 | ERS3358384 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95095 | 0.06855 | 0.7082 | 0.4787 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9662 | 9662 | ERR3266387 | ERX3293001 | ERS3358384 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp negative rep2 | SAMEA5556344 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556344|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp negative rep2 s | sponge tdr gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_9neg_S1_L004_R1_001.fastq.gz | fastq | 655674573.0 | 8711278.0 | E MTAB 7846:sponge tdr gfp negative rep2 lane4 | 0:75.27 1:0 | A:177658097;C:149188009;G:154201531;T:174609176;N:17760 | 75 | 0 | 177658097 | 149188009 | 154201531 | 174609176 | 17760 | ERX3293001 | ERS3358384 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.9503 | 0.06838 | 0.70926 | 0.47475 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9663 | 9663 | ERR3266380 | ERX3293000 | ERS3358383 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp negative rep1 | SAMEA5556343 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556343|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp negative rep1 s | sponge tdr gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_6neg_S3_L001_R1_001.fastq.gz | fastq | 634491637.0 | 8440052.0 | E MTAB 7846:sponge tdr gfp negative rep1 lane1 | 0:75.18 1:0 | A:170881257;C:145535643;G:150561786;T:167495156;N:17795 | 75 | 0 | 170881257 | 145535643 | 150561786 | 167495156 | 17795 | ERX3293000 | ERS3358383 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94996 | 0.05672 | 0.70571 | 0.48691 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9664 | 9664 | ERR3266381 | ERX3293000 | ERS3358383 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp negative rep1 | SAMEA5556343 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556343|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp negative rep1 s | sponge tdr gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_6neg_S3_L002_R1_001.fastq.gz | fastq | 632900752.0 | 8418846.0 | E MTAB 7846:sponge tdr gfp negative rep1 lane2 | 0:75.18 1:0 | A:170454908;C:145141392;G:150172752;T:167112562;N:19138 | 75 | 0 | 170454908 | 145141392 | 150172752 | 167112562 | 19138 | ERX3293000 | ERS3358383 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94905 | 0.05627 | 0.70457 | 0.4865 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9665 | 9665 | ERR3266382 | ERX3293000 | ERS3358383 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp negative rep1 | SAMEA5556343 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556343|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp negative rep1 s | sponge tdr gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_6neg_S3_L003_R1_001.fastq.gz | fastq | 638530115.0 | 8494045.0 | E MTAB 7846:sponge tdr gfp negative rep1 lane3 | 0:75.17 1:0 | A:171907482;C:146526309;G:151612209;T:168464163;N:19952 | 75 | 0 | 171907482 | 146526309 | 151612209 | 168464163 | 19952 | ERX3293000 | ERS3358383 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94919 | 0.05578 | 0.70849 | 0.48073 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9666 | 9666 | ERR3266383 | ERX3293000 | ERS3358383 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp negative rep1 | SAMEA5556343 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556343|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp negative rep1 s | sponge tdr gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_6neg_S3_L004_R1_001.fastq.gz | fastq | 627433322.0 | 8346505.0 | E MTAB 7846:sponge tdr gfp negative rep1 lane4 | 0:75.17 1:0 | A:169016383;C:143886824;G:148914725;T:165593528;N:21862 | 75 | 0 | 169016383 | 143886824 | 148914725 | 165593528 | 21862 | ERX3293000 | ERS3358383 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94993 | 0.05721 | 0.7052 | 0.48878 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9667 | 9667 | ERR3266376 | ERX3292999 | ERS3358382 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp positive rep2 | SAMEA5556342 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556342|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp positive rep2 s | sponge isl gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_7pos_S10_L001_R1_001.fastq.gz | fastq | 618672195.0 | 8218047.0 | E MTAB 7846:sponge isl gfp positive rep2 lane1 | 0:75.28 1:0 | A:166422886;C:142212204;G:146857539;T:163167819;N:11747 | 75 | 0 | 166422886 | 142212204 | 146857539 | 163167819 | 11747 | ERX3292999 | ERS3358382 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94979 | 0.08351 | 0.70863 | 0.47581 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9668 | 9668 | ERR3266377 | ERX3292999 | ERS3358382 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp positive rep2 | SAMEA5556342 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556342|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp positive rep2 s | sponge isl gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_7pos_S10_L002_R1_001.fastq.gz | fastq | 618709102.0 | 8218295.0 | E MTAB 7846:sponge isl gfp positive rep2 lane2 | 0:75.28 1:0 | A:166470432;C:142189977;G:146819280;T:163216323;N:13090 | 75 | 0 | 166470432 | 142189977 | 146819280 | 163216323 | 13090 | ERX3292999 | ERS3358382 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94977 | 0.08255 | 0.70644 | 0.47228 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9669 | 9669 | ERR3266378 | ERX3292999 | ERS3358382 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp positive rep2 | SAMEA5556342 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556342|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp positive rep2 s | sponge isl gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_7pos_S10_L003_R1_001.fastq.gz | fastq | 625353059.0 | 8306375.0 | E MTAB 7846:sponge isl gfp positive rep2 lane3 | 0:75.29 1:0 | A:168233274;C:143793178;G:148510556;T:164802476;N:13575 | 75 | 0 | 168233274 | 143793178 | 148510556 | 164802476 | 13575 | ERX3292999 | ERS3358382 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95014 | 0.08368 | 0.70743 | 0.47846 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9670 | 9670 | ERR3266379 | ERX3292999 | ERS3358382 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp positive rep2 | SAMEA5556342 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556342|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp positive rep2 s | sponge isl gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_7pos_S10_L004_R1_001.fastq.gz | fastq | 615204990.0 | 8171748.0 | E MTAB 7846:sponge isl gfp positive rep2 lane4 | 0:75.28 1:0 | A:165565861;C:141380152;G:146028839;T:162214263;N:15875 | 75 | 0 | 165565861 | 141380152 | 146028839 | 162214263 | 15875 | ERX3292999 | ERS3358382 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94954 | 0.08233 | 0.70834 | 0.48166 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9671 | 9671 | ERR3266372 | ERX3292998 | ERS3358381 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp positive rep1 | SAMEA5556341 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556341|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp positive rep1 s | sponge isl gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_6pos_S12_L001_R1_001.fastq.gz | fastq | 626474467.0 | 8318996.0 | E MTAB 7846:sponge isl gfp positive rep1 lane1 | 0:75.31 1:0 | A:170186220;C:142441110;G:147048643;T:166786401;N:12093 | 75 | 0 | 170186220 | 142441110 | 147048643 | 166786401 | 12093 | ERX3292998 | ERS3358381 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94907 | 0.08132 | 0.69684 | 0.4736 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9672 | 9672 | ERR3266373 | ERX3292998 | ERS3358381 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp positive rep1 | SAMEA5556341 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556341|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp positive rep1 s | sponge isl gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_6pos_S12_L002_R1_001.fastq.gz | fastq | 626477579.0 | 8318750.0 | E MTAB 7846:sponge isl gfp positive rep1 lane2 | 0:75.31 1:0 | A:170185337;C:142396801;G:147032265;T:166850532;N:12644 | 75 | 0 | 170185337 | 142396801 | 147032265 | 166850532 | 12644 | ERX3292998 | ERS3358381 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94941 | 0.08253 | 0.6957 | 0.47554 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9673 | 9673 | ERR3266374 | ERX3292998 | ERS3358381 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp positive rep1 | SAMEA5556341 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556341|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp positive rep1 s | sponge isl gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_6pos_S12_L003_R1_001.fastq.gz | fastq | 632098509.0 | 8393388.0 | E MTAB 7846:sponge isl gfp positive rep1 lane3 | 0:75.31 1:0 | A:171699353;C:143766296;G:148442110;T:168177264;N:13486 | 75 | 0 | 171699353 | 143766296 | 148442110 | 168177264 | 13486 | ERX3292998 | ERS3358381 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94866 | 0.08247 | 0.69601 | 0.48009 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9674 | 9674 | ERR3266375 | ERX3292998 | ERS3358381 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp positive rep1 | SAMEA5556341 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556341|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp positive rep1 s | sponge isl gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_6pos_S12_L004_R1_001.fastq.gz | fastq | 622997479.0 | 8272752.0 | E MTAB 7846:sponge isl gfp positive rep1 lane4 | 0:75.31 1:0 | A:169306677;C:141586415;G:146241288;T:165847752;N:15347 | 75 | 0 | 169306677 | 141586415 | 146241288 | 165847752 | 15347 | ERX3292998 | ERS3358381 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.9483 | 0.08034 | 0.69662 | 0.47868 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9675 | 9675 | ERR3266368 | ERX3292997 | ERS3358380 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp negative rep2 | SAMEA5556340 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556340|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp negative rep2 s | sponge isl gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_7neg_S9_L001_R1_001.fastq.gz | fastq | 707454819.0 | 9395082.0 | E MTAB 7846:sponge isl gfp negative rep2 lane1 | 0:75.30 1:0 | A:194991862;C:157927850;G:163280639;T:191241488;N:12980 | 75 | 0 | 194991862 | 157927850 | 163280639 | 191241488 | 12980 | ERX3292997 | ERS3358380 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.93871 | 0.08926 | 0.70806 | 0.46501 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9676 | 9676 | ERR3266369 | ERX3292997 | ERS3358380 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp negative rep2 | SAMEA5556340 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556340|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp negative rep2 s | sponge isl gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_7neg_S9_L002_R1_001.fastq.gz | fastq | 704791838.0 | 9359668.0 | E MTAB 7846:sponge isl gfp negative rep2 lane2 | 0:75.30 1:0 | A:194317422;C:157276895;G:162624670;T:190558322;N:14529 | 75 | 0 | 194317422 | 157276895 | 162624670 | 190558322 | 14529 | ERX3292997 | ERS3358380 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.93816 | 0.08859 | 0.70999 | 0.4661 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9677 | 9677 | ERR3266370 | ERX3292997 | ERS3358380 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp negative rep2 | SAMEA5556340 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556340|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp negative rep2 s | sponge isl gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_7neg_S9_L003_R1_001.fastq.gz | fastq | 715991833.0 | 9508323.0 | E MTAB 7846:sponge isl gfp negative rep2 lane3 | 0:75.30 1:0 | A:197297222;C:159913026;G:165363927;T:193402765;N:14893 | 75 | 0 | 197297222 | 159913026 | 165363927 | 193402765 | 14893 | ERX3292997 | ERS3358380 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.93844 | 0.08854 | 0.70828 | 0.46042 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9678 | 9678 | ERR3266371 | ERX3292997 | ERS3358380 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp negative rep2 | SAMEA5556340 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556340|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp negative rep2 s | sponge isl gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_7neg_S9_L004_R1_001.fastq.gz | fastq | 703723869.0 | 9345669.0 | E MTAB 7846:sponge isl gfp negative rep2 lane4 | 0:75.30 1:0 | A:194029886;C:157050176;G:162432310;T:190193608;N:17889 | 75 | 0 | 194029886 | 157050176 | 162432310 | 190193608 | 17889 | ERX3292997 | ERS3358380 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.93897 | 0.08993 | 0.70863 | 0.45707 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9679 | 9679 | ERR3266364 | ERX3292996 | ERS3358379 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp negative rep1 | SAMEA5556339 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556339|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp negative rep1 s | sponge isl gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_6neg_S11_L001_R1_001.fastq.gz | fastq | 676581458.0 | 8983758.0 | E MTAB 7846:sponge isl gfp negative rep1 lane1 | 0:75.31 1:0 | A:184297337;C:153352193;G:158268476;T:180651038;N:12414 | 75 | 0 | 184297337 | 153352193 | 158268476 | 180651038 | 12414 | ERX3292996 | ERS3358379 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94981 | 0.07715 | 0.69138 | 0.47243 | 74 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9680 | 9680 | ERR3266365 | ERX3292996 | ERS3358379 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp negative rep1 | SAMEA5556339 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556339|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp negative rep1 s | sponge isl gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_6neg_S11_L002_R1_001.fastq.gz | fastq | 676876555.0 | 8987445.0 | E MTAB 7846:sponge isl gfp negative rep1 lane2 | 0:75.31 1:0 | A:184435129;C:153332402;G:158323789;T:180770978;N:14257 | 75 | 0 | 184435129 | 153332402 | 158323789 | 180770978 | 14257 | ERX3292996 | ERS3358379 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94901 | 0.07805 | 0.69179 | 0.47182 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9681 | 9681 | ERR3266366 | ERX3292996 | ERS3358379 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp negative rep1 | SAMEA5556339 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556339|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp negative rep1 s | sponge isl gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_6neg_S11_L003_R1_001.fastq.gz | fastq | 681771213.0 | 9052615.0 | E MTAB 7846:sponge isl gfp negative rep1 lane3 | 0:75.31 1:0 | A:185717696;C:154552039;G:159567102;T:181919781;N:14595 | 75 | 0 | 185717696 | 154552039 | 159567102 | 181919781 | 14595 | ERX3292996 | ERS3358379 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94923 | 0.07768 | 0.69167 | 0.47219 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9682 | 9682 | ERR3266367 | ERX3292996 | ERS3358379 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp negative rep1 | SAMEA5556339 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556339|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp negative rep1 s | sponge isl gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_6neg_S11_L004_R1_001.fastq.gz | fastq | 671169917.0 | 8911624.0 | E MTAB 7846:sponge isl gfp negative rep1 lane4 | 0:75.31 1:0 | A:182910490;C:152045814;G:157010053;T:179186548;N:17012 | 75 | 0 | 182910490 | 152045814 | 157010053 | 179186548 | 17012 | ERX3292996 | ERS3358379 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94941 | 0.07612 | 0.69106 | 0.47736 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9683 | 9683 | ERR3266360 | ERX3292995 | ERS3358378 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp positive rep2 | SAMEA5556338 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556338|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp positive rep2 s | sponge ccn gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_8pos_S6_L001_R1_001.fastq.gz | fastq | 745666738.0 | 9917771.0 | E MTAB 7846:sponge ccn gfp positive rep2 lane1 | 0:75.18 1:0 | A:207714377;C:163732420;G:169037726;T:205161925;N:20290 | 75 | 0 | 207714377 | 163732420 | 169037726 | 205161925 | 20290 | ERX3292995 | ERS3358378 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94006 | 0.17809 | 0.68166 | 0.48912 | 74 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9684 | 9684 | ERR3266361 | ERX3292995 | ERS3358378 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp positive rep2 | SAMEA5556338 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556338|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp positive rep2 s | sponge ccn gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_8pos_S6_L002_R1_001.fastq.gz | fastq | 747693645.0 | 9944395.0 | E MTAB 7846:sponge ccn gfp positive rep2 lane2 | 0:75.19 1:0 | A:208257288;C:164106384;G:169478025;T:205830399;N:21549 | 75 | 0 | 208257288 | 164106384 | 169478025 | 205830399 | 21549 | ERX3292995 | ERS3358378 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.93873 | 0.17738 | 0.68296 | 0.49656 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9685 | 9685 | ERR3266362 | ERX3292995 | ERS3358378 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp positive rep2 | SAMEA5556338 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556338|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp positive rep2 s | sponge ccn gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_8pos_S6_L003_R1_001.fastq.gz | fastq | 756134124.0 | 10056818.0 | E MTAB 7846:sponge ccn gfp positive rep2 lane3 | 0:75.19 1:0 | A:210573012;C:166089133;G:171475300;T:207973232;N:23447 | 75 | 0 | 210573012 | 166089133 | 171475300 | 207973232 | 23447 | ERX3292995 | ERS3358378 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94077 | 0.18001 | 0.68004 | 0.49812 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9686 | 9686 | ERR3266363 | ERX3292995 | ERS3358378 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp positive rep2 | SAMEA5556338 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556338|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp positive rep2 s | sponge ccn gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_8pos_S6_L004_R1_001.fastq.gz | fastq | 747687619.0 | 9944417.0 | E MTAB 7846:sponge ccn gfp positive rep2 lane4 | 0:75.19 1:0 | A:208315943;C:164104155;G:169484250;T:205757712;N:25559 | 75 | 0 | 208315943 | 164104155 | 169484250 | 205757712 | 25559 | ERX3292995 | ERS3358378 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94025 | 0.17965 | 0.68124 | 0.49249 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9687 | 9687 | ERR3266356 | ERX3292994 | ERS3358377 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp positive rep1 | SAMEA5556337 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556337|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp positive rep1 s | sponge ccn gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_7pos_S8_L001_R1_001.fastq.gz | fastq | 600153564.0 | 7972767.0 | E MTAB 7846:sponge ccn gfp positive rep1 lane1 | 0:75.28 1:0 | A:165075878;C:133961511;G:138306424;T:162797903;N:11848 | 75 | 0 | 165075878 | 133961511 | 138306424 | 162797903 | 11848 | ERX3292994 | ERS3358377 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95367 | 0.14146 | 0.69154 | 0.46621 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9688 | 9688 | ERR3266357 | ERX3292994 | ERS3358377 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp positive rep1 | SAMEA5556337 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556337|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp positive rep1 s | sponge ccn gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_7pos_S8_L002_R1_001.fastq.gz | fastq | 600790169.0 | 7981038.0 | E MTAB 7846:sponge ccn gfp positive rep1 lane2 | 0:75.28 1:0 | A:165262968;C:133988329;G:138458635;T:163066854;N:13383 | 75 | 0 | 165262968 | 133988329 | 138458635 | 163066854 | 13383 | ERX3292994 | ERS3358377 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95365 | 0.14116 | 0.69301 | 0.46836 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9689 | 9689 | ERR3266358 | ERX3292994 | ERS3358377 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp positive rep1 | SAMEA5556337 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556337|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp positive rep1 s | sponge ccn gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_7pos_S8_L003_R1_001.fastq.gz | fastq | 608611085.0 | 8084904.0 | E MTAB 7846:sponge ccn gfp positive rep1 lane3 | 0:75.28 1:0 | A:167402055;C:135871708;G:140314669;T:165009252;N:13401 | 75 | 0 | 167402055 | 135871708 | 140314669 | 165009252 | 13401 | ERX3292994 | ERS3358377 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95403 | 0.14167 | 0.69311 | 0.4702 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9690 | 9690 | ERR3266359 | ERX3292994 | ERS3358377 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp positive rep1 | SAMEA5556337 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556337|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp positive rep1 s | sponge ccn gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_7pos_S8_L004_R1_001.fastq.gz | fastq | 599558663.0 | 7964718.0 | E MTAB 7846:sponge ccn gfp positive rep1 lane4 | 0:75.28 1:0 | A:164965131;C:133749666;G:138194884;T:162633558;N:15424 | 75 | 0 | 164965131 | 133749666 | 138194884 | 162633558 | 15424 | ERX3292994 | ERS3358377 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95285 | 0.14085 | 0.69037 | 0.47345 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9691 | 9691 | ERR3266352 | ERX3292993 | ERS3358376 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp negative rep2 | SAMEA5556336 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556336|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp negative rep2 s | sponge ccn gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_8neg_S5_L001_R1_001.fastq.gz | fastq | 599599608.0 | 7970460.0 | E MTAB 7846:sponge ccn gfp negative rep2 lane1 | 0:75.23 1:0 | A:162236409;C:136907675;G:141538730;T:158902520;N:14274 | 75 | 0 | 162236409 | 136907675 | 141538730 | 158902520 | 14274 | ERX3292993 | ERS3358376 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95404 | 0.05923 | 0.69737 | 0.48627 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9692 | 9692 | ERR3266353 | ERX3292993 | ERS3358376 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp negative rep2 | SAMEA5556336 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556336|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp negative rep2 s | sponge ccn gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_8neg_S5_L002_R1_001.fastq.gz | fastq | 600057776.0 | 7976438.0 | E MTAB 7846:sponge ccn gfp negative rep2 lane2 | 0:75.23 1:0 | A:162367410;C:136994919;G:141577782;T:159102194;N:15471 | 75 | 0 | 162367410 | 136994919 | 141577782 | 159102194 | 15471 | ERX3292993 | ERS3358376 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.953 | 0.06085 | 0.6952 | 0.48868 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9693 | 9693 | ERR3266354 | ERX3292993 | ERS3358376 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp negative rep2 | SAMEA5556336 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556336|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp negative rep2 s | sponge ccn gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_8neg_S5_L003_R1_001.fastq.gz | fastq | 607089697.0 | 8069901.0 | E MTAB 7846:sponge ccn gfp negative rep2 lane3 | 0:75.23 1:0 | A:164235344;C:138684000;G:143335680;T:160819270;N:15403 | 75 | 0 | 164235344 | 138684000 | 143335680 | 160819270 | 15403 | ERX3292993 | ERS3358376 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95245 | 0.06055 | 0.69589 | 0.48813 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9694 | 9694 | ERR3266355 | ERX3292993 | ERS3358376 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp negative rep2 | SAMEA5556336 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556336|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp negative rep2 s | sponge ccn gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_8neg_S5_L004_R1_001.fastq.gz | fastq | 598098243.0 | 7950223.0 | E MTAB 7846:sponge ccn gfp negative rep2 lane4 | 0:75.23 1:0 | A:161836808;C:136564804;G:141157424;T:158521860;N:17347 | 75 | 0 | 161836808 | 136564804 | 141157424 | 158521860 | 17347 | ERX3292993 | ERS3358376 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95299 | 0.06032 | 0.69501 | 0.48928 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9695 | 9695 | ERR3266348 | ERX3292992 | ERS3358375 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp negative rep1 | SAMEA5556335 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556335|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp negative rep1 s | sponge ccn gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_7neg_S7_L001_R1_001.fastq.gz | fastq | 668175990.0 | 8872549.0 | E MTAB 7846:sponge ccn gfp negative rep1 lane1 | 0:75.31 1:0 | A:179859350;C:153483169;G:158360605;T:176462088;N:10778 | 75 | 0 | 179859350 | 153483169 | 158360605 | 176462088 | 10778 | ERX3292992 | ERS3358375 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95955 | 0.07154 | 0.69696 | 0.46425 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9696 | 9696 | ERR3266349 | ERX3292992 | ERS3358375 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp negative rep1 | SAMEA5556335 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556335|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp negative rep1 s | sponge ccn gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_7neg_S7_L002_R1_001.fastq.gz | fastq | 668154755.0 | 8872093.0 | E MTAB 7846:sponge ccn gfp negative rep1 lane2 | 0:75.31 1:0 | A:179811687;C:153454931;G:158314391;T:176560936;N:12810 | 75 | 0 | 179811687 | 153454931 | 158314391 | 176560936 | 12810 | ERX3292992 | ERS3358375 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.96029 | 0.06969 | 0.69684 | 0.46725 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9697 | 9697 | ERR3266350 | ERX3292992 | ERS3358375 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp negative rep1 | SAMEA5556335 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556335|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp negative rep1 s | sponge ccn gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_7neg_S7_L003_R1_001.fastq.gz | fastq | 676984426.0 | 8989004.0 | E MTAB 7846:sponge ccn gfp negative rep1 lane3 | 0:75.31 1:0 | A:182159685;C:155578195;G:160511499;T:178722363;N:12684 | 75 | 0 | 182159685 | 155578195 | 160511499 | 178722363 | 12684 | ERX3292992 | ERS3358375 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.96012 | 0.07159 | 0.69554 | 0.46811 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9698 | 9698 | ERR3266351 | ERX3292992 | ERS3358375 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp negative rep1 | SAMEA5556335 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556335|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp negative rep1 s | sponge ccn gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_7neg_S7_L004_R1_001.fastq.gz | fastq | 666031892.0 | 8843695.0 | E MTAB 7846:sponge ccn gfp negative rep1 lane4 | 0:75.31 1:0 | A:179243298;C:152946459;G:157873912;T:175953752;N:14471 | 75 | 0 | 179243298 | 152946459 | 157873912 | 175953752 | 14471 | ERX3292992 | ERS3358375 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.96014 | 0.07169 | 0.69493 | 0.47058 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9898 | 9898 | ERR4194114 | ERX4155254 | ERS4601292 | ERP122151 | PRJEB38705 | Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | E-MTAB-9193 | Transcriptome Analysis | TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately. | ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 | Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. | Sample 2 | SAMEA6873729 | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada | ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873729|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 2|age:8|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 2|scientific name:Danio rerio|sex:mixed | Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | E MTAB 9193:Sample 2 s | Sample 2 s | Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. | Experimental Factor: age:8|Experimental Factor: RNA interference:n1 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | PolyA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP122151 | Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 | cDNA8h_1_S2_L001.bam | bam | 10087287534.0 | 99874134.0 | E MTAB 9193:cDNA8h 1 S2 L001 | 0:101 | A:2892833391;C:2022466595;G:2198646699;T:2962268446;N:11072403 | 101 | 2892833391 | 2022466595 | 2198646699 | 2962268446 | 11072403 | ERX4155254 | ERS4601292 | ERA2667966 | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive | 1 | 0.93609 | 0.12902 | 0.82158 | 0.5062 | 101 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | sc | single_cell_droplet | 10x | Canada | 2020-06-04 | Multi-stage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 9899 | 9899 | ERR4194115 | ERX4155254 | ERS4601292 | ERP122151 | PRJEB38705 | Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | E-MTAB-9193 | Transcriptome Analysis | TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately. | ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 | Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. | Sample 2 | SAMEA6873729 | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada | ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873729|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 2|age:8|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 2|scientific name:Danio rerio|sex:mixed | Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | E MTAB 9193:Sample 2 s | Sample 2 s | Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. | Experimental Factor: age:8|Experimental Factor: RNA interference:n1 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | PolyA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP122151 | Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 | cDNA8h_1_S2_L002.bam | bam | 10191911414.0 | 100910014.0 | E MTAB 9193:cDNA8h 1 S2 L002 | 0:101 | A:2923216190;C:2043975715;G:2221734566;T:2992798366;N:10186577 | 101 | 2923216190 | 2043975715 | 2221734566 | 2992798366 | 10186577 | ERX4155254 | ERS4601292 | ERA2667966 | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive | 1 | 0.93445 | 0.13038 | 0.824 | 0.49774 | 101 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | sc | single_cell_droplet | 10x | Canada | 2020-06-04 | Multi-stage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 9900 | 9900 | ERR4194112 | ERX4155253 | ERS4601291 | ERP122151 | PRJEB38705 | Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | E-MTAB-9193 | Transcriptome Analysis | TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately. | ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 | Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. | Sample 1 | SAMEA6873728 | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada | ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873728|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 1|age:6|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 1|scientific name:Danio rerio|sex:mixed | Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | E MTAB 9193:Sample 1 s | Sample 1 s | Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. | Experimental Factor: age:6|Experimental Factor: RNA interference:n1 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | PolyA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP122151 | Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 | cDNA6h_1_S1_L001.bam | bam | 7181772357.0 | 71106657.0 | E MTAB 9193:cDNA6h 1 S1 L001 | 0:101 | A:2074032710;C:1415439071;G:1544274166;T:2140112533;N:7913877 | 101 | 2074032710 | 1415439071 | 1544274166 | 2140112533 | 7913877 | ERX4155253 | ERS4601291 | ERA2667966 | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive | 1 | 0.9297 | 0.12156 | 0.8117 | 0.51457 | 101 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | sc | single_cell_droplet | 10x | Canada | 2020-06-04 | Multi-stage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 9901 | 9901 | ERR4194113 | ERX4155253 | ERS4601291 | ERP122151 | PRJEB38705 | Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | E-MTAB-9193 | Transcriptome Analysis | TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately. | ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 | Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. | Sample 1 | SAMEA6873728 | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada | ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873728|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 1|age:6|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 1|scientific name:Danio rerio|sex:mixed | Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | E MTAB 9193:Sample 1 s | Sample 1 s | Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. | Experimental Factor: age:6|Experimental Factor: RNA interference:n1 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | PolyA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP122151 | Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 | cDNA6h_1_S1_L002.bam | bam | 7256542253.0 | 71846953.0 | E MTAB 9193:cDNA6h 1 S1 L002 | 0:101 | A:2096163385;C:1430325700;G:1560530043;T:2162265616;N:7257509 | 101 | 2096163385 | 1430325700 | 1560530043 | 2162265616 | 7257509 | ERX4155253 | ERS4601291 | ERA2667966 | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive | 1 | 0.92882 | 0.12127 | 0.81162 | 0.51457 | 101 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | sc | single_cell_droplet | 10x | Canada | 2020-06-04 | Multi-stage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 9902 | 9902 | ERR4194128 | ERX4155256 | ERS4601294 | ERP122151 | PRJEB38705 | Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | E-MTAB-9193 | Transcriptome Analysis | TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately. | ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 | Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. | Sample 4 | SAMEA6873731 | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada | ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873731|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 4|age:13|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 4|scientific name:Danio rerio|sex:mixed | Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | E MTAB 9193:Sample 4 s | Sample 4 s | Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. | Experimental Factor: age:13|Experimental Factor: RNA interference:n1 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | PolyA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP122151 | Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 | cDNA13h_1_control_S1_L001.bam | bam | 10785974123.0 | 106791823.0 | E MTAB 9193:cDNA13h 1 control S1 L001 | 0:101 | A:3007305661;C:2241057062;G:2505494392;T:2986021199;N:46095809 | 101 | 3007305661 | 2241057062 | 2505494392 | 2986021199 | 46095809 | ERX4155256 | ERS4601294 | ERA2667966 | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive | 1 | 0.67094 | 0.07571 | 0.92951 | 0.5272 | 101 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | sc | single_cell_droplet | 10x | Canada | 2020-06-04 | Multi-stage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 9903 | 9903 | ERR4194129 | ERX4155256 | ERS4601294 | ERP122151 | PRJEB38705 | Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | E-MTAB-9193 | Transcriptome Analysis | TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately. | ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 | Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. | Sample 4 | SAMEA6873731 | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada | ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873731|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 4|age:13|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 4|scientific name:Danio rerio|sex:mixed | Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | E MTAB 9193:Sample 4 s | Sample 4 s | Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. | Experimental Factor: age:13|Experimental Factor: RNA interference:n1 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | PolyA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP122151 | Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 | cDNA13h_1_control_S1_L002.bam | bam | 10595192294.0 | 104902894.0 | E MTAB 9193:cDNA13h 1 control S1 L002 | 0:101 | A:2971916419;C:2204229263;G:2390854035;T:2949877754;N:78314823 | 101 | 2971916419 | 2204229263 | 2390854035 | 2949877754 | 78314823 | ERX4155256 | ERS4601294 | ERA2667966 | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive | 1 | 0.67255 | 0.08054 | 0.91583 | 0.52661 | 101 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | sc | single_cell_droplet | 10x | Canada | 2020-06-04 | Multi-stage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 9904 | 9904 | ERR4194116 | ERX4155255 | ERS4601293 | ERP122151 | PRJEB38705 | Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | E-MTAB-9193 | Transcriptome Analysis | TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately. | ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 | Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. | Sample 3 | SAMEA6873730 | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada | ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873730|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 3|age:10|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 3|scientific name:Danio rerio|sex:mixed | Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | E MTAB 9193:Sample 3 s | Sample 3 s | Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. | Experimental Factor: age:10|Experimental Factor: RNA interference:n1 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | PolyA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP122151 | Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 | cDNA10h_1_S3_L001.bam | bam | 1622536412.0 | 16556494.0 | E MTAB 9193:cDNA10h 1 S3 L001 | 0:98 | A:491141175;C:317161060;G:354179755;T:459976409;N:78013 | 98 | 491141175 | 317161060 | 354179755 | 459976409 | 78013 | ERX4155255 | ERS4601293 | ERA2667966 | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive | 1 | 0.93238 | 0.13033 | 0.89132 | 0.47076 | 98 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | sc | single_cell_droplet | 10x | Canada | 2020-06-04 | Multi-stage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 9905 | 9905 | ERR4194117 | ERX4155255 | ERS4601293 | ERP122151 | PRJEB38705 | Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | E-MTAB-9193 | Transcriptome Analysis | TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately. | ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 | Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. | Sample 3 | SAMEA6873730 | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada | ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873730|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 3|age:10|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 3|scientific name:Danio rerio|sex:mixed | Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | E MTAB 9193:Sample 3 s | Sample 3 s | Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. | Experimental Factor: age:10|Experimental Factor: RNA interference:n1 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | PolyA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP122151 | Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 | cDNA10h_1_S3_L002.bam | bam | 1484328776.0 | 15146212.0 | E MTAB 9193:cDNA10h 1 S3 L002 | 0:98 | A:450782055;C:290088574;G:322801188;T:420570801;N:86158 | 98 | 450782055 | 290088574 | 322801188 | 420570801 | 86158 | ERX4155255 | ERS4601293 | ERA2667966 | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive | 1 | 0.92846 | 0.13128 | 0.89923 | 0.46879 | 98 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | sc | single_cell_droplet | 10x | Canada | 2020-06-04 | Multi-stage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 9906 | 9906 | ERR4194118 | ERX4155255 | ERS4601293 | ERP122151 | PRJEB38705 | Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | E-MTAB-9193 | Transcriptome Analysis | TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately. | ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 | Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. | Sample 3 | SAMEA6873730 | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada | ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873730|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 3|age:10|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 3|scientific name:Danio rerio|sex:mixed | Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | E MTAB 9193:Sample 3 s | Sample 3 s | Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. | Experimental Factor: age:10|Experimental Factor: RNA interference:n1 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | PolyA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP122151 | Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 | cDNA10h_1_S3_L003.bam | bam | 1578833116.0 | 16110542.0 | E MTAB 9193:cDNA10h 1 S3 L003 | 0:98 | A:477600666;C:308260969;G:347303289;T:445467384;N:200808 | 98 | 477600666 | 308260969 | 347303289 | 445467384 | 200808 | ERX4155255 | ERS4601293 | ERA2667966 | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive | 1 | 0.93107 | 0.12965 | 0.91265 | 0.47375 | 98 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | sc | single_cell_droplet | 10x | Canada | 2020-06-04 | Multi-stage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 9907 | 9907 | ERR4194119 | ERX4155255 | ERS4601293 | ERP122151 | PRJEB38705 | Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | E-MTAB-9193 | Transcriptome Analysis | TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately. | ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 | Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. | Sample 3 | SAMEA6873730 | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada | ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873730|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 3|age:10|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 3|scientific name:Danio rerio|sex:mixed | Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | E MTAB 9193:Sample 3 s | Sample 3 s | Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. | Experimental Factor: age:10|Experimental Factor: RNA interference:n1 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | PolyA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP122151 | Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 | cDNA10h_1_S3_L004.bam | bam | 1859564994.0 | 18975153.0 | E MTAB 9193:cDNA10h 1 S3 L004 | 0:98 | A:562936790;C:364057256;G:406607636;T:525811595;N:151717 | 98 | 562936790 | 364057256 | 406607636 | 525811595 | 151717 | ERX4155255 | ERS4601293 | ERA2667966 | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive | 1 | 0.93453 | 0.1266 | 0.87714 | 0.46957 | 98 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | sc | single_cell_droplet | 10x | Canada | 2020-06-04 | Multi-stage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 9908 | 9908 | ERR4194120 | ERX4155255 | ERS4601293 | ERP122151 | PRJEB38705 | Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | E-MTAB-9193 | Transcriptome Analysis | TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately. | ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 | Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. | Sample 3 | SAMEA6873730 | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada | ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873730|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 3|age:10|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 3|scientific name:Danio rerio|sex:mixed | Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | E MTAB 9193:Sample 3 s | Sample 3 s | Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. | Experimental Factor: age:10|Experimental Factor: RNA interference:n1 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | PolyA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP122151 | Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 | cDNA10h_2_S3_L001.bam | bam | 1156341102.0 | 11799399.0 | E MTAB 9193:cDNA10h 2 S3 L001 | 0:98 | A:345857612;C:224453195;G:257551986;T:327969064;N:509245 | 98 | 345857612 | 224453195 | 257551986 | 327969064 | 509245 | ERX4155255 | ERS4601293 | ERA2667966 | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive | 1 | 0.93863 | 0.10744 | 0.81984 | 0.501 | 98 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | sc | single_cell_droplet | 10x | Canada | 2020-06-04 | Multi-stage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 9909 | 9909 | ERR4194121 | ERX4155255 | ERS4601293 | ERP122151 | PRJEB38705 | Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | E-MTAB-9193 | Transcriptome Analysis | TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately. | ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 | Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. | Sample 3 | SAMEA6873730 | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada | ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873730|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 3|age:10|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 3|scientific name:Danio rerio|sex:mixed | Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | E MTAB 9193:Sample 3 s | Sample 3 s | Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. | Experimental Factor: age:10|Experimental Factor: RNA interference:n1 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | PolyA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP122151 | Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 | cDNA10h_2_S3_L002.bam | bam | 1105219696.0 | 11277752.0 | E MTAB 9193:cDNA10h 2 S3 L002 | 0:98 | A:331051973;C:214369903;G:246546338;T:312897773;N:353709 | 98 | 331051973 | 214369903 | 246546338 | 312897773 | 353709 | ERX4155255 | ERS4601293 | ERA2667966 | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive | 1 | 0.93941 | 0.10818 | 0.82211 | 0.50079 | 98 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | sc | single_cell_droplet | 10x | Canada | 2020-06-04 | Multi-stage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 9910 | 9910 | ERR4194122 | ERX4155255 | ERS4601293 | ERP122151 | PRJEB38705 | Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | E-MTAB-9193 | Transcriptome Analysis | TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately. | ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 | Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. | Sample 3 | SAMEA6873730 | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada | ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873730|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 3|age:10|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 3|scientific name:Danio rerio|sex:mixed | Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | E MTAB 9193:Sample 3 s | Sample 3 s | Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. | Experimental Factor: age:10|Experimental Factor: RNA interference:n1 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | PolyA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP122151 | Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 | cDNA10h_2_S3_L003.bam | bam | 1105199606.0 | 11277547.0 | E MTAB 9193:cDNA10h 2 S3 L003 | 0:98 | A:331158619;C:214305131;G:246465559;T:312930408;N:339889 | 98 | 331158619 | 214305131 | 246465559 | 312930408 | 339889 | ERX4155255 | ERS4601293 | ERA2667966 | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive | 1 | 0.93767 | 0.10645 | 0.82329 | 0.50057 | 98 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | sc | single_cell_droplet | 10x | Canada | 2020-06-04 | Multi-stage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 9911 | 9911 | ERR4194123 | ERX4155255 | ERS4601293 | ERP122151 | PRJEB38705 | Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | E-MTAB-9193 | Transcriptome Analysis | TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately. | ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 | Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. | Sample 3 | SAMEA6873730 | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada | ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873730|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 3|age:10|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 3|scientific name:Danio rerio|sex:mixed | Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | E MTAB 9193:Sample 3 s | Sample 3 s | Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. | Experimental Factor: age:10|Experimental Factor: RNA interference:n1 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | PolyA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP122151 | Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 | cDNA10h_2_S3_L004.bam | bam | 1108707712.0 | 11313344.0 | E MTAB 9193:cDNA10h 2 S3 L004 | 0:98 | A:331374433;C:215925150;G:247131942;T:313865174;N:411013 | 98 | 331374433 | 215925150 | 247131942 | 313865174 | 411013 | ERX4155255 | ERS4601293 | ERA2667966 | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive | 1 | 0.93827 | 0.10842 | 0.82031 | 0.49241 | 98 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | sc | single_cell_droplet | 10x | Canada | 2020-06-04 | Multi-stage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 9912 | 9912 | ERR4194124 | ERX4155255 | ERS4601293 | ERP122151 | PRJEB38705 | Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | E-MTAB-9193 | Transcriptome Analysis | TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately. | ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 | Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. | Sample 3 | SAMEA6873730 | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada | ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873730|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 3|age:10|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 3|scientific name:Danio rerio|sex:mixed | Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | E MTAB 9193:Sample 3 s | Sample 3 s | Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. | Experimental Factor: age:10|Experimental Factor: RNA interference:n1 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | PolyA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP122151 | Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 | cDNA10h_2_S3_L005.bam | bam | 1110084612.0 | 11327394.0 | E MTAB 9193:cDNA10h 2 S3 L005 | 0:98 | A:332881960;C:215360330;G:247563319;T:313842331;N:436672 | 98 | 332881960 | 215360330 | 247563319 | 313842331 | 436672 | ERX4155255 | ERS4601293 | ERA2667966 | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive | 1 | 0.93827 | 0.10719 | 0.8238 | 0.50406 | 98 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | sc | single_cell_droplet | 10x | Canada | 2020-06-04 | Multi-stage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 9913 | 9913 | ERR4194125 | ERX4155255 | ERS4601293 | ERP122151 | PRJEB38705 | Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | E-MTAB-9193 | Transcriptome Analysis | TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately. | ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 | Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. | Sample 3 | SAMEA6873730 | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada | ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873730|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 3|age:10|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 3|scientific name:Danio rerio|sex:mixed | Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | E MTAB 9193:Sample 3 s | Sample 3 s | Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. | Experimental Factor: age:10|Experimental Factor: RNA interference:n1 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | PolyA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP122151 | Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 | cDNA10h_2_S3_L006.bam | bam | 1113812728.0 | 11365436.0 | E MTAB 9193:cDNA10h 2 S3 L006 | 0:98 | A:333112288;C:216649152;G:248341020;T:315338848;N:371420 | 98 | 333112288 | 216649152 | 248341020 | 315338848 | 371420 | ERX4155255 | ERS4601293 | ERA2667966 | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive | 1 | 0.93843 | 0.10675 | 0.82079 | 0.49284 | 98 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | sc | single_cell_droplet | 10x | Canada | 2020-06-04 | Multi-stage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 9914 | 9914 | ERR4194126 | ERX4155255 | ERS4601293 | ERP122151 | PRJEB38705 | Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | E-MTAB-9193 | Transcriptome Analysis | TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately. | ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 | Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. | Sample 3 | SAMEA6873730 | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada | ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873730|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 3|age:10|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 3|scientific name:Danio rerio|sex:mixed | Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | E MTAB 9193:Sample 3 s | Sample 3 s | Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. | Experimental Factor: age:10|Experimental Factor: RNA interference:n1 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | PolyA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP122151 | Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 | cDNA10h_2_S3_L007.bam | bam | 1119495748.0 | 11423426.0 | E MTAB 9193:cDNA10h 2 S3 L007 | 0:98 | A:335288339;C:217283719;G:249624836;T:316900388;N:398466 | 98 | 335288339 | 217283719 | 249624836 | 316900388 | 398466 | ERX4155255 | ERS4601293 | ERA2667966 | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive | 1 | 0.93711 | 0.10749 | 0.82266 | 0.49382 | 98 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | sc | single_cell_droplet | 10x | Canada | 2020-06-04 | Multi-stage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 9915 | 9915 | ERR4194127 | ERX4155255 | ERS4601293 | ERP122151 | PRJEB38705 | Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | E-MTAB-9193 | Transcriptome Analysis | TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately. | ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 | Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. | Sample 3 | SAMEA6873730 | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada | ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873730|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 3|age:10|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 3|scientific name:Danio rerio|sex:mixed | Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | E MTAB 9193:Sample 3 s | Sample 3 s | Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. | Experimental Factor: age:10|Experimental Factor: RNA interference:n1 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | PolyA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP122151 | Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 | cDNA10h_2_S3_L008.bam | bam | 1175946688.0 | 11999456.0 | E MTAB 9193:cDNA10h 2 S3 L008 | 0:98 | A:351364169;C:228318193;G:261971072;T:333863943;N:429311 | 98 | 351364169 | 228318193 | 261971072 | 333863943 | 429311 | ERX4155255 | ERS4601293 | ERA2667966 | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive | 1 | 0.93851 | 0.10755 | 0.82158 | 0.49895 | 98 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | sc | single_cell_droplet | 10x | Canada | 2020-06-04 | Multi-stage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 9916 | 9916 | ERR4194130 | ERX4155257 | ERS4601295 | ERP122151 | PRJEB38705 | Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | E-MTAB-9193 | Transcriptome Analysis | TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately. | ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 | Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. | Sample 5 | SAMEA6873732 | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada | ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873732|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 5|age:13|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 5|scientific name:Danio rerio|sex:mixed | Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | E MTAB 9193:Sample 5 s | Sample 5 s | Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. | Experimental Factor: age:13|Experimental Factor: RNA interference:morpholino mediated Gata5/6 knockdown | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | PolyA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP122151 | Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 | cDNA13h_2_gata56KD_S2_L001.bam | bam | 7791309377.0 | 77141677.0 | E MTAB 9193:cDNA13h 2 gata56KD S2 L001 | 0:101 | A:2198242220;C:1593746618;G:1784167452;T:2181979820;N:33173267 | 101 | 2198242220 | 1593746618 | 1784167452 | 2181979820 | 33173267 | ERX4155257 | ERS4601295 | ERA2667966 | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive | 1 | 0.66736 | 0.08039 | 0.93026 | 0.50796 | 101 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | sc | single_cell_droplet | 10x | Canada | 2020-06-04 | Multi-stage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 9917 | 9917 | ERR4194131 | ERX4155257 | ERS4601295 | ERP122151 | PRJEB38705 | Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | E-MTAB-9193 | Transcriptome Analysis | TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately. | ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 | Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. | Sample 5 | SAMEA6873732 | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada | ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873732|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 5|age:13|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 5|scientific name:Danio rerio|sex:mixed | Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | E MTAB 9193:Sample 5 s | Sample 5 s | Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. | Experimental Factor: age:13|Experimental Factor: RNA interference:morpholino mediated Gata5/6 knockdown | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | PolyA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP122151 | Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish | ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 | cDNA13h_2_gata56KD_S2_L002.bam | bam | 7658149967.0 | 75823267.0 | E MTAB 9193:cDNA13h 2 gata56KD S2 L002 | 0:101 | A:2172230233;C:1568805100;G:1703587704;T:2157181071;N:56345859 | 101 | 2172230233 | 1568805100 | 1703587704 | 2157181071 | 56345859 | ERX4155257 | ERS4601295 | ERA2667966 | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive | Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive | 1 | 0.66565 | 0.08597 | 0.91804 | 0.51772 | 101 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | sc | single_cell_droplet | 10x | Canada | 2020-06-04 | Multi-stage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 10060 | 10060 | ERR4795364 | ERX4665135 | ERS5281176 | ERP124847 | PRJEB41113 | Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | E-MTAB-9727 | Transcriptome Analysis | The mesothelium forms epithelial membranes that line the bodies cavities and surround the internal organs. Mesothelia widely contribute to organ homeostasis and regeneration and their dysregulation can result in congenital anomalies of the viscera ventral wall defects and mesothelioma tumors. Nonetheless the embryonic ontogeny and developmental regulation of mesothelium formation has remained uncharted. Here we combine genetic lineage tracing in toto live imaging and single cell transcriptomics in zebrafish to track mesothelial progenitor origins from the lateral plate mesoderm LPM. Our single cell analysis uncovers a post gastrulation gene expression signature centered on hand2 that delineates distinct progenitor populations within the forming LPM. Combining gene expression analysis and imaging of transgenic reporter zebrafish embryos we chart the origin of mesothelial progenitors to the lateral most hand2 expressing LPM and confirm evolutionary conservation in mouse. Our time lapse imaging of transgenic hand2 reporter embryos captures zebrafish mesothelium formation documenting the coordinated cell movements that form pericardium and visceral and parietal peritoneum. We establish that the primordial germ cells migrate associated with the forming mesothelium as ventral migration boundary. Functionally hand2 mutants fail to close the ventral mesothelium due to perturbed migration of mesothelium progenitors. Analyzing mouse and human mesothelioma tumors hypothesized to emerge from transformed mesothelium we find de novo expression of LPM associated transcription factors and in particular of Hand2 indicating the re initiation of a developmental transcriptional program in mesothelioma. Taken together our work outlines a genetic and developmental signature of mesothelial origins centered around Hand2 contributing to our understanding of mesothelial pathologies and mesothelioma. | ENA FIRST PUBLIC:2022 01 14|ENA LAST UPDATE:2022 01 14 | Protocols: Wildtype stain and drl:mCherry positive zebrafish embryos were grown until tailbud stage and chorions were removed by incubating in 1 mg/mL Pronase Roche followed by washing in E3 medium. Around 300 embryos were used to generate the sample. The E3 medium was replaced by 1X PBS and the embryos were stored on ice until further processing. The embryos were dissociated using 2 mg/mL collagenase IV Worthington in DMEM high glucose 4.5g/l and NaHCO3 without xxx glutamine and sodium pyruvate Sigma Aldrich and incubated for 5 min in a water bath at 37oC. The embryonic tissues were triturated into a single cell suspension by pipetting carefully up and down. When the embryos were not yet dissociated sufficiently they were incubated for another 5 min. Cells were filtered through a 35 μm cell strainer Falcon round bottom tubes with cell strainer cap and centrifuged at 6000 rpm for 30 sec. Cell pellets were resuspended in 1X HBSS Gibco containing 2% FBS and subjected to an additional round of centrifugation and resuspension. post washing the cells were resuspended in 1X PBS. drl:mCherry positive cells were sorted using a FACS Aria III cell sorter BD Bioscience. Cells were gated based on size and forward scattering to exclude debris and doublets. The gating for the negative population was determined based on wildtype tailbud staged embryos. See also Figure S2 for gate setting. The SORTseq single cell RNA sequencing protocol was carried out as described previously Muraro et al. 2016. Live mCherry positive single cells were sorted in four 384 well plates BioRad containing 5 μl of CEL Seq2 primer solution in mineral oil 24 bp polyT stretch a 4 bp random molecular barcode UMI a cell specific barcode the 5′Illumina TruSeq small RNA kit adaptor and a T7 promoter provided by Single Cell Discoveries. post sorting the plates were immediately placed on ice and stored at −80°C. In brief ERCC Spike in RNA 0.02 μL of 1:50000 dilution was added to each well before cell lysis with heat shocking. Reverse trans… | Sample 4 | E MTAB 9727:Sample 4 | isolate:not applicable|organism:Danio rerio|sex:mixed|age:10|developmental stage:tailbud stage|organism part:lateral plate mesoderm plate|genotype:drl:mCherry|ENA FIRST PUBLIC:2021 04 01|ENA LAST UPDATE:2021 09 01 | NextSeq 500 sequencing; Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | E MTAB 9727:Sample 4 s | Sample 4 s | Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | Wildtype stain and drl:mCherry positive zebrafish embryos were grown until tailbud stage and chorions were removed by incubating in 1 mg/mL Pronase Roche followed by washing in E3 medium. Around 300 embryos were used to generate the sample. The E3 medium was replaced by 1X PBS and the embryos were stored on ice until further processing. The embryos were dissociated using 2 mg/mL collagenase IV Worthington in DMEM high glucose 4.5g/l and NaHCO3 without xxx glutamine and sodium pyruvate Sigma Aldrich and incubated for 5 min in a water bath at 37oC. The embryonic tissues were triturated into a single cell suspension by pipetting carefully up and down. When the embryos were not yet dissociated sufficiently they were incubated for another 5 min. Cells were filtered through a 35 μm cell strainer Falcon round bottom tubes with cell strainer cap and centrifuged at 6000 rpm for 30 sec. Cell pellets were resuspended in 1X HBSS Gibco containing 2% FBS and subjected to an additional round of centrifugation and resuspension. post washing the cells were resuspended in 1X PBS. drl:mCherry positive cells were sorted using a FACS Aria III cell sorter BD Bioscience. Cells were gated based on size and forward scattering to exclude debris and doublets. The gating for the negative population was determined based on wildtype tailbud staged embryos. See also Figure S2 for gate setting. The SORTseq single cell RNA sequencing protocol was carried out as described previously Muraro et al. 2016. Live mCherry positive single cells were sorted in four 384 well plates BioRad containing 5 μl of CEL Seq2 primer solution in mineral oil 24 bp polyT stretch a 4 bp random molecular barcode UMI a cell specific barcode the 5′Illumina TruSeq small RNA kit adaptor and a T7 promoter provided by Single Cell Discoveries. post sorting the plates were immediately placed on ice and stored at −80°C. In brief ERCC Spike in RNA 0.02 μL of 1:50000 dilution was added to each well before cell lysis with heat shocking. Reverse transcription an… | Experimental Factor: replicate:lateral plate mesoderm plate 4 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | RANDOM | SINGLE | ILLUMINA | NextSeq 500 | ERP124847 | NextSeq 500 sequencing; Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | ENA FIRST PUBLIC:2022 01 14|ENA LAST UPDATE:2022 01 14 | SN4_AH2TW3BGX5_S1_R1_cat.fastq.gz | fastq | 5410723202.0 | 71707309.0 | E MTAB 9727:Sample 4 | 0:75.46 1:0 | A:1330416803;C:531269504;G:734031980;T:2814959249;N:45666 | 75 | 0 | 1330416803 | 531269504 | 734031980 | 2814959249 | 45666 | ERX4665135 | ERS5281176 | ERA3048543 | University of Zurich|European Nucleotide Archive | University of Zurich|European Nucleotide Archive | 1 | 0.33614 | 0.21532 | 0.99019 | 0.41002 | 76 | B | usable mapping rate | illumina | nextseq | unknown | random_priming | trueseq | sc | single_cell_plate | celseq | Switzerland | 2021-04-01 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 10061 | 10061 | ERR4795365 | ERX4665135 | ERS5281176 | ERP124847 | PRJEB41113 | Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | E-MTAB-9727 | Transcriptome Analysis | The mesothelium forms epithelial membranes that line the bodies cavities and surround the internal organs. Mesothelia widely contribute to organ homeostasis and regeneration and their dysregulation can result in congenital anomalies of the viscera ventral wall defects and mesothelioma tumors. Nonetheless the embryonic ontogeny and developmental regulation of mesothelium formation has remained uncharted. Here we combine genetic lineage tracing in toto live imaging and single cell transcriptomics in zebrafish to track mesothelial progenitor origins from the lateral plate mesoderm LPM. Our single cell analysis uncovers a post gastrulation gene expression signature centered on hand2 that delineates distinct progenitor populations within the forming LPM. Combining gene expression analysis and imaging of transgenic reporter zebrafish embryos we chart the origin of mesothelial progenitors to the lateral most hand2 expressing LPM and confirm evolutionary conservation in mouse. Our time lapse imaging of transgenic hand2 reporter embryos captures zebrafish mesothelium formation documenting the coordinated cell movements that form pericardium and visceral and parietal peritoneum. We establish that the primordial germ cells migrate associated with the forming mesothelium as ventral migration boundary. Functionally hand2 mutants fail to close the ventral mesothelium due to perturbed migration of mesothelium progenitors. Analyzing mouse and human mesothelioma tumors hypothesized to emerge from transformed mesothelium we find de novo expression of LPM associated transcription factors and in particular of Hand2 indicating the re initiation of a developmental transcriptional program in mesothelioma. Taken together our work outlines a genetic and developmental signature of mesothelial origins centered around Hand2 contributing to our understanding of mesothelial pathologies and mesothelioma. | ENA FIRST PUBLIC:2022 01 14|ENA LAST UPDATE:2022 01 14 | Protocols: Wildtype stain and drl:mCherry positive zebrafish embryos were grown until tailbud stage and chorions were removed by incubating in 1 mg/mL Pronase Roche followed by washing in E3 medium. Around 300 embryos were used to generate the sample. The E3 medium was replaced by 1X PBS and the embryos were stored on ice until further processing. The embryos were dissociated using 2 mg/mL collagenase IV Worthington in DMEM high glucose 4.5g/l and NaHCO3 without xxx glutamine and sodium pyruvate Sigma Aldrich and incubated for 5 min in a water bath at 37oC. The embryonic tissues were triturated into a single cell suspension by pipetting carefully up and down. When the embryos were not yet dissociated sufficiently they were incubated for another 5 min. Cells were filtered through a 35 μm cell strainer Falcon round bottom tubes with cell strainer cap and centrifuged at 6000 rpm for 30 sec. Cell pellets were resuspended in 1X HBSS Gibco containing 2% FBS and subjected to an additional round of centrifugation and resuspension. post washing the cells were resuspended in 1X PBS. drl:mCherry positive cells were sorted using a FACS Aria III cell sorter BD Bioscience. Cells were gated based on size and forward scattering to exclude debris and doublets. The gating for the negative population was determined based on wildtype tailbud staged embryos. See also Figure S2 for gate setting. The SORTseq single cell RNA sequencing protocol was carried out as described previously Muraro et al. 2016. Live mCherry positive single cells were sorted in four 384 well plates BioRad containing 5 μl of CEL Seq2 primer solution in mineral oil 24 bp polyT stretch a 4 bp random molecular barcode UMI a cell specific barcode the 5′Illumina TruSeq small RNA kit adaptor and a T7 promoter provided by Single Cell Discoveries. post sorting the plates were immediately placed on ice and stored at −80°C. In brief ERCC Spike in RNA 0.02 μL of 1:50000 dilution was added to each well before cell lysis with heat shocking. Reverse trans… | Sample 4 | E MTAB 9727:Sample 4 | isolate:not applicable|organism:Danio rerio|sex:mixed|age:10|developmental stage:tailbud stage|organism part:lateral plate mesoderm plate|genotype:drl:mCherry|ENA FIRST PUBLIC:2021 04 01|ENA LAST UPDATE:2021 09 01 | NextSeq 500 sequencing; Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | E MTAB 9727:Sample 4 s | Sample 4 s | Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | Wildtype stain and drl:mCherry positive zebrafish embryos were grown until tailbud stage and chorions were removed by incubating in 1 mg/mL Pronase Roche followed by washing in E3 medium. Around 300 embryos were used to generate the sample. The E3 medium was replaced by 1X PBS and the embryos were stored on ice until further processing. The embryos were dissociated using 2 mg/mL collagenase IV Worthington in DMEM high glucose 4.5g/l and NaHCO3 without xxx glutamine and sodium pyruvate Sigma Aldrich and incubated for 5 min in a water bath at 37oC. The embryonic tissues were triturated into a single cell suspension by pipetting carefully up and down. When the embryos were not yet dissociated sufficiently they were incubated for another 5 min. Cells were filtered through a 35 μm cell strainer Falcon round bottom tubes with cell strainer cap and centrifuged at 6000 rpm for 30 sec. Cell pellets were resuspended in 1X HBSS Gibco containing 2% FBS and subjected to an additional round of centrifugation and resuspension. post washing the cells were resuspended in 1X PBS. drl:mCherry positive cells were sorted using a FACS Aria III cell sorter BD Bioscience. Cells were gated based on size and forward scattering to exclude debris and doublets. The gating for the negative population was determined based on wildtype tailbud staged embryos. See also Figure S2 for gate setting. The SORTseq single cell RNA sequencing protocol was carried out as described previously Muraro et al. 2016. Live mCherry positive single cells were sorted in four 384 well plates BioRad containing 5 μl of CEL Seq2 primer solution in mineral oil 24 bp polyT stretch a 4 bp random molecular barcode UMI a cell specific barcode the 5′Illumina TruSeq small RNA kit adaptor and a T7 promoter provided by Single Cell Discoveries. post sorting the plates were immediately placed on ice and stored at −80°C. In brief ERCC Spike in RNA 0.02 μL of 1:50000 dilution was added to each well before cell lysis with heat shocking. Reverse transcription an… | Experimental Factor: replicate:lateral plate mesoderm plate 4 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | RANDOM | SINGLE | ILLUMINA | NextSeq 500 | ERP124847 | NextSeq 500 sequencing; Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | ENA FIRST PUBLIC:2022 01 14|ENA LAST UPDATE:2022 01 14 | SN4_AH2TW3BGX5_S1_R2_cat.fastq.gz | fastq | 5414184547.0 | 71707309.0 | E MTAB 9727:Sample 4 1 | 0:0 1:75.50 | A:1582938104;C:1052565419;G:1177180395;T:1600161662;N:1338967 | 0 | 75 | 1582938104 | 1052565419 | 1177180395 | 1600161662 | 1338967 | ERX4665135 | ERS5281176 | ERA3048543 | University of Zurich|European Nucleotide Archive | University of Zurich|European Nucleotide Archive | 1 | 0.84976 | 0.28521 | 0.85038 | 0.5124 | 75 | B | usable mapping rate | illumina | nextseq | unknown | random_priming | trueseq | sc | single_cell_plate | celseq | Switzerland | 2021-04-01 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 10062 | 10062 | ERR4795362 | ERX4665134 | ERS5281175 | ERP124847 | PRJEB41113 | Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | E-MTAB-9727 | Transcriptome Analysis | The mesothelium forms epithelial membranes that line the bodies cavities and surround the internal organs. Mesothelia widely contribute to organ homeostasis and regeneration and their dysregulation can result in congenital anomalies of the viscera ventral wall defects and mesothelioma tumors. Nonetheless the embryonic ontogeny and developmental regulation of mesothelium formation has remained uncharted. Here we combine genetic lineage tracing in toto live imaging and single cell transcriptomics in zebrafish to track mesothelial progenitor origins from the lateral plate mesoderm LPM. Our single cell analysis uncovers a post gastrulation gene expression signature centered on hand2 that delineates distinct progenitor populations within the forming LPM. Combining gene expression analysis and imaging of transgenic reporter zebrafish embryos we chart the origin of mesothelial progenitors to the lateral most hand2 expressing LPM and confirm evolutionary conservation in mouse. Our time lapse imaging of transgenic hand2 reporter embryos captures zebrafish mesothelium formation documenting the coordinated cell movements that form pericardium and visceral and parietal peritoneum. We establish that the primordial germ cells migrate associated with the forming mesothelium as ventral migration boundary. Functionally hand2 mutants fail to close the ventral mesothelium due to perturbed migration of mesothelium progenitors. Analyzing mouse and human mesothelioma tumors hypothesized to emerge from transformed mesothelium we find de novo expression of LPM associated transcription factors and in particular of Hand2 indicating the re initiation of a developmental transcriptional program in mesothelioma. Taken together our work outlines a genetic and developmental signature of mesothelial origins centered around Hand2 contributing to our understanding of mesothelial pathologies and mesothelioma. | ENA FIRST PUBLIC:2022 01 14|ENA LAST UPDATE:2022 01 14 | Protocols: Wildtype stain and drl:mCherry positive zebrafish embryos were grown until tailbud stage and chorions were removed by incubating in 1 mg/mL Pronase Roche followed by washing in E3 medium. Around 300 embryos were used to generate the sample. The E3 medium was replaced by 1X PBS and the embryos were stored on ice until further processing. The embryos were dissociated using 2 mg/mL collagenase IV Worthington in DMEM high glucose 4.5g/l and NaHCO3 without xxx glutamine and sodium pyruvate Sigma Aldrich and incubated for 5 min in a water bath at 37oC. The embryonic tissues were triturated into a single cell suspension by pipetting carefully up and down. When the embryos were not yet dissociated sufficiently they were incubated for another 5 min. Cells were filtered through a 35 μm cell strainer Falcon round bottom tubes with cell strainer cap and centrifuged at 6000 rpm for 30 sec. Cell pellets were resuspended in 1X HBSS Gibco containing 2% FBS and subjected to an additional round of centrifugation and resuspension. post washing the cells were resuspended in 1X PBS. drl:mCherry positive cells were sorted using a FACS Aria III cell sorter BD Bioscience. Cells were gated based on size and forward scattering to exclude debris and doublets. The gating for the negative population was determined based on wildtype tailbud staged embryos. See also Figure S2 for gate setting. The SORTseq single cell RNA sequencing protocol was carried out as described previously Muraro et al. 2016. Live mCherry positive single cells were sorted in four 384 well plates BioRad containing 5 μl of CEL Seq2 primer solution in mineral oil 24 bp polyT stretch a 4 bp random molecular barcode UMI a cell specific barcode the 5′Illumina TruSeq small RNA kit adaptor and a T7 promoter provided by Single Cell Discoveries. post sorting the plates were immediately placed on ice and stored at −80°C. In brief ERCC Spike in RNA 0.02 μL of 1:50000 dilution was added to each well before cell lysis with heat shocking. Reverse trans… | Sample 3 | E MTAB 9727:Sample 3 | isolate:not applicable|organism:Danio rerio|sex:mixed|age:10|developmental stage:tailbud stage|organism part:lateral plate mesoderm plate|genotype:drl:mCherry|ENA FIRST PUBLIC:2021 04 01|ENA LAST UPDATE:2021 09 01 | NextSeq 500 sequencing; Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | E MTAB 9727:Sample 3 s | Sample 3 s | Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | Wildtype stain and drl:mCherry positive zebrafish embryos were grown until tailbud stage and chorions were removed by incubating in 1 mg/mL Pronase Roche followed by washing in E3 medium. Around 300 embryos were used to generate the sample. The E3 medium was replaced by 1X PBS and the embryos were stored on ice until further processing. The embryos were dissociated using 2 mg/mL collagenase IV Worthington in DMEM high glucose 4.5g/l and NaHCO3 without xxx glutamine and sodium pyruvate Sigma Aldrich and incubated for 5 min in a water bath at 37oC. The embryonic tissues were triturated into a single cell suspension by pipetting carefully up and down. When the embryos were not yet dissociated sufficiently they were incubated for another 5 min. Cells were filtered through a 35 μm cell strainer Falcon round bottom tubes with cell strainer cap and centrifuged at 6000 rpm for 30 sec. Cell pellets were resuspended in 1X HBSS Gibco containing 2% FBS and subjected to an additional round of centrifugation and resuspension. post washing the cells were resuspended in 1X PBS. drl:mCherry positive cells were sorted using a FACS Aria III cell sorter BD Bioscience. Cells were gated based on size and forward scattering to exclude debris and doublets. The gating for the negative population was determined based on wildtype tailbud staged embryos. See also Figure S2 for gate setting. The SORTseq single cell RNA sequencing protocol was carried out as described previously Muraro et al. 2016. Live mCherry positive single cells were sorted in four 384 well plates BioRad containing 5 μl of CEL Seq2 primer solution in mineral oil 24 bp polyT stretch a 4 bp random molecular barcode UMI a cell specific barcode the 5′Illumina TruSeq small RNA kit adaptor and a T7 promoter provided by Single Cell Discoveries. post sorting the plates were immediately placed on ice and stored at −80°C. In brief ERCC Spike in RNA 0.02 μL of 1:50000 dilution was added to each well before cell lysis with heat shocking. Reverse transcription an… | Experimental Factor: replicate:lateral plate mesoderm plate 3 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | RANDOM | SINGLE | ILLUMINA | NextSeq 500 | ERP124847 | NextSeq 500 sequencing; Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | ENA FIRST PUBLIC:2022 01 14|ENA LAST UPDATE:2022 01 14 | SN3_AHY3WGBGX3_S7_R1_cat.fastq.gz | fastq | 4823193891.0 | 63965519.0 | E MTAB 9727:Sample 3 | 0:75.40 1:0 | A:1323978162;C:446831209;G:581746343;T:2470114091;N:524086 | 75 | 0 | 1323978162 | 446831209 | 581746343 | 2470114091 | 524086 | ERX4665134 | ERS5281175 | ERA3048543 | University of Zurich|European Nucleotide Archive | University of Zurich|European Nucleotide Archive | 1 | 0.36549 | 0.19722 | 0.95552 | 0.4702 | 76 | B | usable mapping rate | illumina | nextseq | unknown | random_priming | trueseq | sc | single_cell_plate | celseq | Switzerland | 2021-04-01 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 10063 | 10063 | ERR4795363 | ERX4665134 | ERS5281175 | ERP124847 | PRJEB41113 | Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | E-MTAB-9727 | Transcriptome Analysis | The mesothelium forms epithelial membranes that line the bodies cavities and surround the internal organs. Mesothelia widely contribute to organ homeostasis and regeneration and their dysregulation can result in congenital anomalies of the viscera ventral wall defects and mesothelioma tumors. Nonetheless the embryonic ontogeny and developmental regulation of mesothelium formation has remained uncharted. Here we combine genetic lineage tracing in toto live imaging and single cell transcriptomics in zebrafish to track mesothelial progenitor origins from the lateral plate mesoderm LPM. Our single cell analysis uncovers a post gastrulation gene expression signature centered on hand2 that delineates distinct progenitor populations within the forming LPM. Combining gene expression analysis and imaging of transgenic reporter zebrafish embryos we chart the origin of mesothelial progenitors to the lateral most hand2 expressing LPM and confirm evolutionary conservation in mouse. Our time lapse imaging of transgenic hand2 reporter embryos captures zebrafish mesothelium formation documenting the coordinated cell movements that form pericardium and visceral and parietal peritoneum. We establish that the primordial germ cells migrate associated with the forming mesothelium as ventral migration boundary. Functionally hand2 mutants fail to close the ventral mesothelium due to perturbed migration of mesothelium progenitors. Analyzing mouse and human mesothelioma tumors hypothesized to emerge from transformed mesothelium we find de novo expression of LPM associated transcription factors and in particular of Hand2 indicating the re initiation of a developmental transcriptional program in mesothelioma. Taken together our work outlines a genetic and developmental signature of mesothelial origins centered around Hand2 contributing to our understanding of mesothelial pathologies and mesothelioma. | ENA FIRST PUBLIC:2022 01 14|ENA LAST UPDATE:2022 01 14 | Protocols: Wildtype stain and drl:mCherry positive zebrafish embryos were grown until tailbud stage and chorions were removed by incubating in 1 mg/mL Pronase Roche followed by washing in E3 medium. Around 300 embryos were used to generate the sample. The E3 medium was replaced by 1X PBS and the embryos were stored on ice until further processing. The embryos were dissociated using 2 mg/mL collagenase IV Worthington in DMEM high glucose 4.5g/l and NaHCO3 without xxx glutamine and sodium pyruvate Sigma Aldrich and incubated for 5 min in a water bath at 37oC. The embryonic tissues were triturated into a single cell suspension by pipetting carefully up and down. When the embryos were not yet dissociated sufficiently they were incubated for another 5 min. Cells were filtered through a 35 μm cell strainer Falcon round bottom tubes with cell strainer cap and centrifuged at 6000 rpm for 30 sec. Cell pellets were resuspended in 1X HBSS Gibco containing 2% FBS and subjected to an additional round of centrifugation and resuspension. post washing the cells were resuspended in 1X PBS. drl:mCherry positive cells were sorted using a FACS Aria III cell sorter BD Bioscience. Cells were gated based on size and forward scattering to exclude debris and doublets. The gating for the negative population was determined based on wildtype tailbud staged embryos. See also Figure S2 for gate setting. The SORTseq single cell RNA sequencing protocol was carried out as described previously Muraro et al. 2016. Live mCherry positive single cells were sorted in four 384 well plates BioRad containing 5 μl of CEL Seq2 primer solution in mineral oil 24 bp polyT stretch a 4 bp random molecular barcode UMI a cell specific barcode the 5′Illumina TruSeq small RNA kit adaptor and a T7 promoter provided by Single Cell Discoveries. post sorting the plates were immediately placed on ice and stored at −80°C. In brief ERCC Spike in RNA 0.02 μL of 1:50000 dilution was added to each well before cell lysis with heat shocking. Reverse trans… | Sample 3 | E MTAB 9727:Sample 3 | isolate:not applicable|organism:Danio rerio|sex:mixed|age:10|developmental stage:tailbud stage|organism part:lateral plate mesoderm plate|genotype:drl:mCherry|ENA FIRST PUBLIC:2021 04 01|ENA LAST UPDATE:2021 09 01 | NextSeq 500 sequencing; Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | E MTAB 9727:Sample 3 s | Sample 3 s | Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | Wildtype stain and drl:mCherry positive zebrafish embryos were grown until tailbud stage and chorions were removed by incubating in 1 mg/mL Pronase Roche followed by washing in E3 medium. Around 300 embryos were used to generate the sample. The E3 medium was replaced by 1X PBS and the embryos were stored on ice until further processing. The embryos were dissociated using 2 mg/mL collagenase IV Worthington in DMEM high glucose 4.5g/l and NaHCO3 without xxx glutamine and sodium pyruvate Sigma Aldrich and incubated for 5 min in a water bath at 37oC. The embryonic tissues were triturated into a single cell suspension by pipetting carefully up and down. When the embryos were not yet dissociated sufficiently they were incubated for another 5 min. Cells were filtered through a 35 μm cell strainer Falcon round bottom tubes with cell strainer cap and centrifuged at 6000 rpm for 30 sec. Cell pellets were resuspended in 1X HBSS Gibco containing 2% FBS and subjected to an additional round of centrifugation and resuspension. post washing the cells were resuspended in 1X PBS. drl:mCherry positive cells were sorted using a FACS Aria III cell sorter BD Bioscience. Cells were gated based on size and forward scattering to exclude debris and doublets. The gating for the negative population was determined based on wildtype tailbud staged embryos. See also Figure S2 for gate setting. The SORTseq single cell RNA sequencing protocol was carried out as described previously Muraro et al. 2016. Live mCherry positive single cells were sorted in four 384 well plates BioRad containing 5 μl of CEL Seq2 primer solution in mineral oil 24 bp polyT stretch a 4 bp random molecular barcode UMI a cell specific barcode the 5′Illumina TruSeq small RNA kit adaptor and a T7 promoter provided by Single Cell Discoveries. post sorting the plates were immediately placed on ice and stored at −80°C. In brief ERCC Spike in RNA 0.02 μL of 1:50000 dilution was added to each well before cell lysis with heat shocking. Reverse transcription an… | Experimental Factor: replicate:lateral plate mesoderm plate 3 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | RANDOM | SINGLE | ILLUMINA | NextSeq 500 | ERP124847 | NextSeq 500 sequencing; Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | ENA FIRST PUBLIC:2022 01 14|ENA LAST UPDATE:2022 01 14 | SN3_AHY3WGBGX3_S7_R2_cat.fastq.gz | fastq | 4828889391.0 | 63965519.0 | E MTAB 9727:Sample 3 1 | 0:0 1:75.49 | A:1434099697;C:964508763;G:893584575;T:1534727600;N:1968756 | 0 | 75 | 1434099697 | 964508763 | 893584575 | 1534727600 | 1968756 | ERX4665134 | ERS5281175 | ERA3048543 | University of Zurich|European Nucleotide Archive | University of Zurich|European Nucleotide Archive | 1 | 0.85811 | 0.26231 | 0.82731 | 0.48618 | 76 | B | usable mapping rate | illumina | nextseq | unknown | random_priming | trueseq | sc | single_cell_plate | celseq | Switzerland | 2021-04-01 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 10064 | 10064 | ERR4795360 | ERX4665133 | ERS5281174 | ERP124847 | PRJEB41113 | Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | E-MTAB-9727 | Transcriptome Analysis | The mesothelium forms epithelial membranes that line the bodies cavities and surround the internal organs. Mesothelia widely contribute to organ homeostasis and regeneration and their dysregulation can result in congenital anomalies of the viscera ventral wall defects and mesothelioma tumors. Nonetheless the embryonic ontogeny and developmental regulation of mesothelium formation has remained uncharted. Here we combine genetic lineage tracing in toto live imaging and single cell transcriptomics in zebrafish to track mesothelial progenitor origins from the lateral plate mesoderm LPM. Our single cell analysis uncovers a post gastrulation gene expression signature centered on hand2 that delineates distinct progenitor populations within the forming LPM. Combining gene expression analysis and imaging of transgenic reporter zebrafish embryos we chart the origin of mesothelial progenitors to the lateral most hand2 expressing LPM and confirm evolutionary conservation in mouse. Our time lapse imaging of transgenic hand2 reporter embryos captures zebrafish mesothelium formation documenting the coordinated cell movements that form pericardium and visceral and parietal peritoneum. We establish that the primordial germ cells migrate associated with the forming mesothelium as ventral migration boundary. Functionally hand2 mutants fail to close the ventral mesothelium due to perturbed migration of mesothelium progenitors. Analyzing mouse and human mesothelioma tumors hypothesized to emerge from transformed mesothelium we find de novo expression of LPM associated transcription factors and in particular of Hand2 indicating the re initiation of a developmental transcriptional program in mesothelioma. Taken together our work outlines a genetic and developmental signature of mesothelial origins centered around Hand2 contributing to our understanding of mesothelial pathologies and mesothelioma. | ENA FIRST PUBLIC:2022 01 14|ENA LAST UPDATE:2022 01 14 | Protocols: Wildtype stain and drl:mCherry positive zebrafish embryos were grown until tailbud stage and chorions were removed by incubating in 1 mg/mL Pronase Roche followed by washing in E3 medium. Around 300 embryos were used to generate the sample. The E3 medium was replaced by 1X PBS and the embryos were stored on ice until further processing. The embryos were dissociated using 2 mg/mL collagenase IV Worthington in DMEM high glucose 4.5g/l and NaHCO3 without xxx glutamine and sodium pyruvate Sigma Aldrich and incubated for 5 min in a water bath at 37oC. The embryonic tissues were triturated into a single cell suspension by pipetting carefully up and down. When the embryos were not yet dissociated sufficiently they were incubated for another 5 min. Cells were filtered through a 35 μm cell strainer Falcon round bottom tubes with cell strainer cap and centrifuged at 6000 rpm for 30 sec. Cell pellets were resuspended in 1X HBSS Gibco containing 2% FBS and subjected to an additional round of centrifugation and resuspension. post washing the cells were resuspended in 1X PBS. drl:mCherry positive cells were sorted using a FACS Aria III cell sorter BD Bioscience. Cells were gated based on size and forward scattering to exclude debris and doublets. The gating for the negative population was determined based on wildtype tailbud staged embryos. See also Figure S2 for gate setting. The SORTseq single cell RNA sequencing protocol was carried out as described previously Muraro et al. 2016. Live mCherry positive single cells were sorted in four 384 well plates BioRad containing 5 μl of CEL Seq2 primer solution in mineral oil 24 bp polyT stretch a 4 bp random molecular barcode UMI a cell specific barcode the 5′Illumina TruSeq small RNA kit adaptor and a T7 promoter provided by Single Cell Discoveries. post sorting the plates were immediately placed on ice and stored at −80°C. In brief ERCC Spike in RNA 0.02 μL of 1:50000 dilution was added to each well before cell lysis with heat shocking. Reverse trans… | Sample 2 | E MTAB 9727:Sample 2 | isolate:not applicable|organism:Danio rerio|sex:mixed|age:10|developmental stage:tailbud stage|organism part:lateral plate mesoderm plate|genotype:drl:mCherry|ENA FIRST PUBLIC:2021 04 01|ENA LAST UPDATE:2021 09 01 | NextSeq 500 sequencing; Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | E MTAB 9727:Sample 2 s | Sample 2 s | Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | Wildtype stain and drl:mCherry positive zebrafish embryos were grown until tailbud stage and chorions were removed by incubating in 1 mg/mL Pronase Roche followed by washing in E3 medium. Around 300 embryos were used to generate the sample. The E3 medium was replaced by 1X PBS and the embryos were stored on ice until further processing. The embryos were dissociated using 2 mg/mL collagenase IV Worthington in DMEM high glucose 4.5g/l and NaHCO3 without xxx glutamine and sodium pyruvate Sigma Aldrich and incubated for 5 min in a water bath at 37oC. The embryonic tissues were triturated into a single cell suspension by pipetting carefully up and down. When the embryos were not yet dissociated sufficiently they were incubated for another 5 min. Cells were filtered through a 35 μm cell strainer Falcon round bottom tubes with cell strainer cap and centrifuged at 6000 rpm for 30 sec. Cell pellets were resuspended in 1X HBSS Gibco containing 2% FBS and subjected to an additional round of centrifugation and resuspension. post washing the cells were resuspended in 1X PBS. drl:mCherry positive cells were sorted using a FACS Aria III cell sorter BD Bioscience. Cells were gated based on size and forward scattering to exclude debris and doublets. The gating for the negative population was determined based on wildtype tailbud staged embryos. See also Figure S2 for gate setting. The SORTseq single cell RNA sequencing protocol was carried out as described previously Muraro et al. 2016. Live mCherry positive single cells were sorted in four 384 well plates BioRad containing 5 μl of CEL Seq2 primer solution in mineral oil 24 bp polyT stretch a 4 bp random molecular barcode UMI a cell specific barcode the 5′Illumina TruSeq small RNA kit adaptor and a T7 promoter provided by Single Cell Discoveries. post sorting the plates were immediately placed on ice and stored at −80°C. In brief ERCC Spike in RNA 0.02 μL of 1:50000 dilution was added to each well before cell lysis with heat shocking. Reverse transcription an… | Experimental Factor: replicate:lateral plate mesoderm plate 2 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | RANDOM | SINGLE | ILLUMINA | NextSeq 500 | ERP124847 | NextSeq 500 sequencing; Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | ENA FIRST PUBLIC:2022 01 14|ENA LAST UPDATE:2022 01 14 | SN2_AHY3WGBGX3_S6_R1_cat.fastq.gz | fastq | 5598371393.0 | 74235388.0 | E MTAB 9727:Sample 2 | 0:75.41 1:0 | A:1526486973;C:558020193;G:717587491;T:2795646081;N:630655 | 75 | 0 | 1526486973 | 558020193 | 717587491 | 2795646081 | 630655 | ERX4665133 | ERS5281174 | ERA3048543 | University of Zurich|European Nucleotide Archive | University of Zurich|European Nucleotide Archive | 1 | 0.28059 | 0.19252 | 0.96404 | 0.4874 | 75 | B | usable mapping rate | illumina | nextseq | unknown | random_priming | trueseq | sc | single_cell_plate | celseq | Switzerland | 2021-04-01 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 10065 | 10065 | ERR4795361 | ERX4665133 | ERS5281174 | ERP124847 | PRJEB41113 | Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | E-MTAB-9727 | Transcriptome Analysis | The mesothelium forms epithelial membranes that line the bodies cavities and surround the internal organs. Mesothelia widely contribute to organ homeostasis and regeneration and their dysregulation can result in congenital anomalies of the viscera ventral wall defects and mesothelioma tumors. Nonetheless the embryonic ontogeny and developmental regulation of mesothelium formation has remained uncharted. Here we combine genetic lineage tracing in toto live imaging and single cell transcriptomics in zebrafish to track mesothelial progenitor origins from the lateral plate mesoderm LPM. Our single cell analysis uncovers a post gastrulation gene expression signature centered on hand2 that delineates distinct progenitor populations within the forming LPM. Combining gene expression analysis and imaging of transgenic reporter zebrafish embryos we chart the origin of mesothelial progenitors to the lateral most hand2 expressing LPM and confirm evolutionary conservation in mouse. Our time lapse imaging of transgenic hand2 reporter embryos captures zebrafish mesothelium formation documenting the coordinated cell movements that form pericardium and visceral and parietal peritoneum. We establish that the primordial germ cells migrate associated with the forming mesothelium as ventral migration boundary. Functionally hand2 mutants fail to close the ventral mesothelium due to perturbed migration of mesothelium progenitors. Analyzing mouse and human mesothelioma tumors hypothesized to emerge from transformed mesothelium we find de novo expression of LPM associated transcription factors and in particular of Hand2 indicating the re initiation of a developmental transcriptional program in mesothelioma. Taken together our work outlines a genetic and developmental signature of mesothelial origins centered around Hand2 contributing to our understanding of mesothelial pathologies and mesothelioma. | ENA FIRST PUBLIC:2022 01 14|ENA LAST UPDATE:2022 01 14 | Protocols: Wildtype stain and drl:mCherry positive zebrafish embryos were grown until tailbud stage and chorions were removed by incubating in 1 mg/mL Pronase Roche followed by washing in E3 medium. Around 300 embryos were used to generate the sample. The E3 medium was replaced by 1X PBS and the embryos were stored on ice until further processing. The embryos were dissociated using 2 mg/mL collagenase IV Worthington in DMEM high glucose 4.5g/l and NaHCO3 without xxx glutamine and sodium pyruvate Sigma Aldrich and incubated for 5 min in a water bath at 37oC. The embryonic tissues were triturated into a single cell suspension by pipetting carefully up and down. When the embryos were not yet dissociated sufficiently they were incubated for another 5 min. Cells were filtered through a 35 μm cell strainer Falcon round bottom tubes with cell strainer cap and centrifuged at 6000 rpm for 30 sec. Cell pellets were resuspended in 1X HBSS Gibco containing 2% FBS and subjected to an additional round of centrifugation and resuspension. post washing the cells were resuspended in 1X PBS. drl:mCherry positive cells were sorted using a FACS Aria III cell sorter BD Bioscience. Cells were gated based on size and forward scattering to exclude debris and doublets. The gating for the negative population was determined based on wildtype tailbud staged embryos. See also Figure S2 for gate setting. The SORTseq single cell RNA sequencing protocol was carried out as described previously Muraro et al. 2016. Live mCherry positive single cells were sorted in four 384 well plates BioRad containing 5 μl of CEL Seq2 primer solution in mineral oil 24 bp polyT stretch a 4 bp random molecular barcode UMI a cell specific barcode the 5′Illumina TruSeq small RNA kit adaptor and a T7 promoter provided by Single Cell Discoveries. post sorting the plates were immediately placed on ice and stored at −80°C. In brief ERCC Spike in RNA 0.02 μL of 1:50000 dilution was added to each well before cell lysis with heat shocking. Reverse trans… | Sample 2 | E MTAB 9727:Sample 2 | isolate:not applicable|organism:Danio rerio|sex:mixed|age:10|developmental stage:tailbud stage|organism part:lateral plate mesoderm plate|genotype:drl:mCherry|ENA FIRST PUBLIC:2021 04 01|ENA LAST UPDATE:2021 09 01 | NextSeq 500 sequencing; Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | E MTAB 9727:Sample 2 s | Sample 2 s | Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | Wildtype stain and drl:mCherry positive zebrafish embryos were grown until tailbud stage and chorions were removed by incubating in 1 mg/mL Pronase Roche followed by washing in E3 medium. Around 300 embryos were used to generate the sample. The E3 medium was replaced by 1X PBS and the embryos were stored on ice until further processing. The embryos were dissociated using 2 mg/mL collagenase IV Worthington in DMEM high glucose 4.5g/l and NaHCO3 without xxx glutamine and sodium pyruvate Sigma Aldrich and incubated for 5 min in a water bath at 37oC. The embryonic tissues were triturated into a single cell suspension by pipetting carefully up and down. When the embryos were not yet dissociated sufficiently they were incubated for another 5 min. Cells were filtered through a 35 μm cell strainer Falcon round bottom tubes with cell strainer cap and centrifuged at 6000 rpm for 30 sec. Cell pellets were resuspended in 1X HBSS Gibco containing 2% FBS and subjected to an additional round of centrifugation and resuspension. post washing the cells were resuspended in 1X PBS. drl:mCherry positive cells were sorted using a FACS Aria III cell sorter BD Bioscience. Cells were gated based on size and forward scattering to exclude debris and doublets. The gating for the negative population was determined based on wildtype tailbud staged embryos. See also Figure S2 for gate setting. The SORTseq single cell RNA sequencing protocol was carried out as described previously Muraro et al. 2016. Live mCherry positive single cells were sorted in four 384 well plates BioRad containing 5 μl of CEL Seq2 primer solution in mineral oil 24 bp polyT stretch a 4 bp random molecular barcode UMI a cell specific barcode the 5′Illumina TruSeq small RNA kit adaptor and a T7 promoter provided by Single Cell Discoveries. post sorting the plates were immediately placed on ice and stored at −80°C. In brief ERCC Spike in RNA 0.02 μL of 1:50000 dilution was added to each well before cell lysis with heat shocking. Reverse transcription an… | Experimental Factor: replicate:lateral plate mesoderm plate 2 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | RANDOM | SINGLE | ILLUMINA | NextSeq 500 | ERP124847 | NextSeq 500 sequencing; Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | ENA FIRST PUBLIC:2022 01 14|ENA LAST UPDATE:2022 01 14 | SN2_AHY3WGBGX3_S6_R2_cat.fastq.gz | fastq | 5600151371.0 | 74235388.0 | E MTAB 9727:Sample 2 1 | 0:0 1:75.44 | A:1850568176;C:1035622971;G:1071138281;T:1640475883;N:2346060 | 0 | 75 | 1850568176 | 1035622971 | 1071138281 | 1640475883 | 2346060 | ERX4665133 | ERS5281174 | ERA3048543 | University of Zurich|European Nucleotide Archive | University of Zurich|European Nucleotide Archive | 1 | 0.7679 | 0.30371 | 0.82651 | 0.43401 | 75 | B | usable mapping rate | illumina | nextseq | unknown | random_priming | trueseq | sc | single_cell_plate | celseq | Switzerland | 2021-04-01 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 10066 | 10066 | ERR4795358 | ERX4665132 | ERS5281173 | ERP124847 | PRJEB41113 | Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | E-MTAB-9727 | Transcriptome Analysis | The mesothelium forms epithelial membranes that line the bodies cavities and surround the internal organs. Mesothelia widely contribute to organ homeostasis and regeneration and their dysregulation can result in congenital anomalies of the viscera ventral wall defects and mesothelioma tumors. Nonetheless the embryonic ontogeny and developmental regulation of mesothelium formation has remained uncharted. Here we combine genetic lineage tracing in toto live imaging and single cell transcriptomics in zebrafish to track mesothelial progenitor origins from the lateral plate mesoderm LPM. Our single cell analysis uncovers a post gastrulation gene expression signature centered on hand2 that delineates distinct progenitor populations within the forming LPM. Combining gene expression analysis and imaging of transgenic reporter zebrafish embryos we chart the origin of mesothelial progenitors to the lateral most hand2 expressing LPM and confirm evolutionary conservation in mouse. Our time lapse imaging of transgenic hand2 reporter embryos captures zebrafish mesothelium formation documenting the coordinated cell movements that form pericardium and visceral and parietal peritoneum. We establish that the primordial germ cells migrate associated with the forming mesothelium as ventral migration boundary. Functionally hand2 mutants fail to close the ventral mesothelium due to perturbed migration of mesothelium progenitors. Analyzing mouse and human mesothelioma tumors hypothesized to emerge from transformed mesothelium we find de novo expression of LPM associated transcription factors and in particular of Hand2 indicating the re initiation of a developmental transcriptional program in mesothelioma. Taken together our work outlines a genetic and developmental signature of mesothelial origins centered around Hand2 contributing to our understanding of mesothelial pathologies and mesothelioma. | ENA FIRST PUBLIC:2022 01 14|ENA LAST UPDATE:2022 01 14 | Protocols: Wildtype stain and drl:mCherry positive zebrafish embryos were grown until tailbud stage and chorions were removed by incubating in 1 mg/mL Pronase Roche followed by washing in E3 medium. Around 300 embryos were used to generate the sample. The E3 medium was replaced by 1X PBS and the embryos were stored on ice until further processing. The embryos were dissociated using 2 mg/mL collagenase IV Worthington in DMEM high glucose 4.5g/l and NaHCO3 without xxx glutamine and sodium pyruvate Sigma Aldrich and incubated for 5 min in a water bath at 37oC. The embryonic tissues were triturated into a single cell suspension by pipetting carefully up and down. When the embryos were not yet dissociated sufficiently they were incubated for another 5 min. Cells were filtered through a 35 μm cell strainer Falcon round bottom tubes with cell strainer cap and centrifuged at 6000 rpm for 30 sec. Cell pellets were resuspended in 1X HBSS Gibco containing 2% FBS and subjected to an additional round of centrifugation and resuspension. post washing the cells were resuspended in 1X PBS. drl:mCherry positive cells were sorted using a FACS Aria III cell sorter BD Bioscience. Cells were gated based on size and forward scattering to exclude debris and doublets. The gating for the negative population was determined based on wildtype tailbud staged embryos. See also Figure S2 for gate setting. The SORTseq single cell RNA sequencing protocol was carried out as described previously Muraro et al. 2016. Live mCherry positive single cells were sorted in four 384 well plates BioRad containing 5 μl of CEL Seq2 primer solution in mineral oil 24 bp polyT stretch a 4 bp random molecular barcode UMI a cell specific barcode the 5′Illumina TruSeq small RNA kit adaptor and a T7 promoter provided by Single Cell Discoveries. post sorting the plates were immediately placed on ice and stored at −80°C. In brief ERCC Spike in RNA 0.02 μL of 1:50000 dilution was added to each well before cell lysis with heat shocking. Reverse trans… | Sample 1 | E MTAB 9727:Sample 1 | isolate:not applicable|organism:Danio rerio|sex:mixed|age:10|developmental stage:tailbud stage|organism part:lateral plate mesoderm plate|genotype:drl:mCherry|ENA FIRST PUBLIC:2021 04 01|ENA LAST UPDATE:2021 09 01 | NextSeq 500 sequencing; Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | E MTAB 9727:Sample 1 s | Sample 1 s | Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | Wildtype stain and drl:mCherry positive zebrafish embryos were grown until tailbud stage and chorions were removed by incubating in 1 mg/mL Pronase Roche followed by washing in E3 medium. Around 300 embryos were used to generate the sample. The E3 medium was replaced by 1X PBS and the embryos were stored on ice until further processing. The embryos were dissociated using 2 mg/mL collagenase IV Worthington in DMEM high glucose 4.5g/l and NaHCO3 without xxx glutamine and sodium pyruvate Sigma Aldrich and incubated for 5 min in a water bath at 37oC. The embryonic tissues were triturated into a single cell suspension by pipetting carefully up and down. When the embryos were not yet dissociated sufficiently they were incubated for another 5 min. Cells were filtered through a 35 μm cell strainer Falcon round bottom tubes with cell strainer cap and centrifuged at 6000 rpm for 30 sec. Cell pellets were resuspended in 1X HBSS Gibco containing 2% FBS and subjected to an additional round of centrifugation and resuspension. post washing the cells were resuspended in 1X PBS. drl:mCherry positive cells were sorted using a FACS Aria III cell sorter BD Bioscience. Cells were gated based on size and forward scattering to exclude debris and doublets. The gating for the negative population was determined based on wildtype tailbud staged embryos. See also Figure S2 for gate setting. The SORTseq single cell RNA sequencing protocol was carried out as described previously Muraro et al. 2016. Live mCherry positive single cells were sorted in four 384 well plates BioRad containing 5 μl of CEL Seq2 primer solution in mineral oil 24 bp polyT stretch a 4 bp random molecular barcode UMI a cell specific barcode the 5′Illumina TruSeq small RNA kit adaptor and a T7 promoter provided by Single Cell Discoveries. post sorting the plates were immediately placed on ice and stored at −80°C. In brief ERCC Spike in RNA 0.02 μL of 1:50000 dilution was added to each well before cell lysis with heat shocking. Reverse transcription an… | Experimental Factor: replicate:lateral plate mesoderm plate 1 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | RANDOM | SINGLE | ILLUMINA | NextSeq 500 | ERP124847 | NextSeq 500 sequencing; Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | ENA FIRST PUBLIC:2022 01 14|ENA LAST UPDATE:2022 01 14 | SN1_AHY3WGBGX3_S5_R1_cat.fastq.gz | fastq | 4996502316.0 | 66258508.0 | E MTAB 9727:Sample 1 | 0:75.41 1:0 | A:1330744174;C:451622042;G:591151500;T:2622422664;N:561936 | 75 | 0 | 1330744174 | 451622042 | 591151500 | 2622422664 | 561936 | ERX4665132 | ERS5281173 | ERA3048543 | University of Zurich|European Nucleotide Archive | University of Zurich|European Nucleotide Archive | 1 | 0.29754 | 0.17671 | 0.9669 | 0.45463 | 75 | B | usable mapping rate | illumina | nextseq | unknown | random_priming | trueseq | sc | single_cell_plate | celseq | Switzerland | 2021-04-01 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 10067 | 10067 | ERR4795359 | ERX4665132 | ERS5281173 | ERP124847 | PRJEB41113 | Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | E-MTAB-9727 | Transcriptome Analysis | The mesothelium forms epithelial membranes that line the bodies cavities and surround the internal organs. Mesothelia widely contribute to organ homeostasis and regeneration and their dysregulation can result in congenital anomalies of the viscera ventral wall defects and mesothelioma tumors. Nonetheless the embryonic ontogeny and developmental regulation of mesothelium formation has remained uncharted. Here we combine genetic lineage tracing in toto live imaging and single cell transcriptomics in zebrafish to track mesothelial progenitor origins from the lateral plate mesoderm LPM. Our single cell analysis uncovers a post gastrulation gene expression signature centered on hand2 that delineates distinct progenitor populations within the forming LPM. Combining gene expression analysis and imaging of transgenic reporter zebrafish embryos we chart the origin of mesothelial progenitors to the lateral most hand2 expressing LPM and confirm evolutionary conservation in mouse. Our time lapse imaging of transgenic hand2 reporter embryos captures zebrafish mesothelium formation documenting the coordinated cell movements that form pericardium and visceral and parietal peritoneum. We establish that the primordial germ cells migrate associated with the forming mesothelium as ventral migration boundary. Functionally hand2 mutants fail to close the ventral mesothelium due to perturbed migration of mesothelium progenitors. Analyzing mouse and human mesothelioma tumors hypothesized to emerge from transformed mesothelium we find de novo expression of LPM associated transcription factors and in particular of Hand2 indicating the re initiation of a developmental transcriptional program in mesothelioma. Taken together our work outlines a genetic and developmental signature of mesothelial origins centered around Hand2 contributing to our understanding of mesothelial pathologies and mesothelioma. | ENA FIRST PUBLIC:2022 01 14|ENA LAST UPDATE:2022 01 14 | Protocols: Wildtype stain and drl:mCherry positive zebrafish embryos were grown until tailbud stage and chorions were removed by incubating in 1 mg/mL Pronase Roche followed by washing in E3 medium. Around 300 embryos were used to generate the sample. The E3 medium was replaced by 1X PBS and the embryos were stored on ice until further processing. The embryos were dissociated using 2 mg/mL collagenase IV Worthington in DMEM high glucose 4.5g/l and NaHCO3 without xxx glutamine and sodium pyruvate Sigma Aldrich and incubated for 5 min in a water bath at 37oC. The embryonic tissues were triturated into a single cell suspension by pipetting carefully up and down. When the embryos were not yet dissociated sufficiently they were incubated for another 5 min. Cells were filtered through a 35 μm cell strainer Falcon round bottom tubes with cell strainer cap and centrifuged at 6000 rpm for 30 sec. Cell pellets were resuspended in 1X HBSS Gibco containing 2% FBS and subjected to an additional round of centrifugation and resuspension. post washing the cells were resuspended in 1X PBS. drl:mCherry positive cells were sorted using a FACS Aria III cell sorter BD Bioscience. Cells were gated based on size and forward scattering to exclude debris and doublets. The gating for the negative population was determined based on wildtype tailbud staged embryos. See also Figure S2 for gate setting. The SORTseq single cell RNA sequencing protocol was carried out as described previously Muraro et al. 2016. Live mCherry positive single cells were sorted in four 384 well plates BioRad containing 5 μl of CEL Seq2 primer solution in mineral oil 24 bp polyT stretch a 4 bp random molecular barcode UMI a cell specific barcode the 5′Illumina TruSeq small RNA kit adaptor and a T7 promoter provided by Single Cell Discoveries. post sorting the plates were immediately placed on ice and stored at −80°C. In brief ERCC Spike in RNA 0.02 μL of 1:50000 dilution was added to each well before cell lysis with heat shocking. Reverse trans… | Sample 1 | E MTAB 9727:Sample 1 | isolate:not applicable|organism:Danio rerio|sex:mixed|age:10|developmental stage:tailbud stage|organism part:lateral plate mesoderm plate|genotype:drl:mCherry|ENA FIRST PUBLIC:2021 04 01|ENA LAST UPDATE:2021 09 01 | NextSeq 500 sequencing; Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | E MTAB 9727:Sample 1 s | Sample 1 s | Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | Wildtype stain and drl:mCherry positive zebrafish embryos were grown until tailbud stage and chorions were removed by incubating in 1 mg/mL Pronase Roche followed by washing in E3 medium. Around 300 embryos were used to generate the sample. The E3 medium was replaced by 1X PBS and the embryos were stored on ice until further processing. The embryos were dissociated using 2 mg/mL collagenase IV Worthington in DMEM high glucose 4.5g/l and NaHCO3 without xxx glutamine and sodium pyruvate Sigma Aldrich and incubated for 5 min in a water bath at 37oC. The embryonic tissues were triturated into a single cell suspension by pipetting carefully up and down. When the embryos were not yet dissociated sufficiently they were incubated for another 5 min. Cells were filtered through a 35 μm cell strainer Falcon round bottom tubes with cell strainer cap and centrifuged at 6000 rpm for 30 sec. Cell pellets were resuspended in 1X HBSS Gibco containing 2% FBS and subjected to an additional round of centrifugation and resuspension. post washing the cells were resuspended in 1X PBS. drl:mCherry positive cells were sorted using a FACS Aria III cell sorter BD Bioscience. Cells were gated based on size and forward scattering to exclude debris and doublets. The gating for the negative population was determined based on wildtype tailbud staged embryos. See also Figure S2 for gate setting. The SORTseq single cell RNA sequencing protocol was carried out as described previously Muraro et al. 2016. Live mCherry positive single cells were sorted in four 384 well plates BioRad containing 5 μl of CEL Seq2 primer solution in mineral oil 24 bp polyT stretch a 4 bp random molecular barcode UMI a cell specific barcode the 5′Illumina TruSeq small RNA kit adaptor and a T7 promoter provided by Single Cell Discoveries. post sorting the plates were immediately placed on ice and stored at −80°C. In brief ERCC Spike in RNA 0.02 μL of 1:50000 dilution was added to each well before cell lysis with heat shocking. Reverse transcription an… | Experimental Factor: replicate:lateral plate mesoderm plate 1 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | RANDOM | SINGLE | ILLUMINA | NextSeq 500 | ERP124847 | NextSeq 500 sequencing; Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | ENA FIRST PUBLIC:2022 01 14|ENA LAST UPDATE:2022 01 14 | SN1_AHY3WGBGX3_S5_R2_cat.fastq.gz | fastq | 4999908389.0 | 66258508.0 | E MTAB 9727:Sample 1 1 | 0:0 1:75.46 | A:1591945117;C:933968124;G:986108614;T:1485824022;N:2062512 | 0 | 75 | 1591945117 | 933968124 | 986108614 | 1485824022 | 2062512 | ERX4665132 | ERS5281173 | ERA3048543 | University of Zurich|European Nucleotide Archive | University of Zurich|European Nucleotide Archive | 1 | 0.81333 | 0.2466 | 0.83027 | 0.51572 | 75 | B | usable mapping rate | illumina | nextseq | unknown | random_priming | trueseq | sc | single_cell_plate | celseq | Switzerland | 2021-04-01 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 11041 | 11041 | ERR9995536 | ERX9536682 | ERS12521224 | ERP138294 | PRJEB53494 | Nano3P seq: transcriptome wide analysis of gene expression and tail dynamics using end capture nanopore cDNA sequencing | 94bf5509-4622-4d5f-b7c5-6a14bdfac340 | Other | RNA polyadenylation plays a central role in RNA maturation fate and stability. In response to developmental cues polyA tail lengths can vary affecting the translation efficiency and stability of mRNAs. Here we develop Nanopore three prime end capture sequencing Nano3P seq a novel method that relies on nanopore cDNA sequencing to simultaneously quantify RNA abundance tail composition and tail length dynamics at per read resolution. By employing a template switching based sequencing protocol Nano3P seq can sequence any given RNA molecule from its three prime end regardless of its polyadenylation status without xxx need for PCR amplification or ligation of RNA adapters. We demonstrate that Nano3P seq captures a wide diversity of RNA biotypes providing quantitative estimates of RNA abundance and tail lengths in mRNA lncRNA sn/snoRNA scaRNA and rRNA molecules. We find that in addition to mRNA and lncRNA polyA tails can be identified in 16S mitochondrial rRNA in both mouse and zebrafish models. Moreover we show that mRNA tail lengths are dynamically regulated during vertebrate embryogenesis at an isoform specific level correlating with mRNA decay. Finally we identify non A bases within polyA tails of various lengths and reveal their distribution during vertebrate embryogenesis. Overall Nano3P seq is a simple and robust method for accurately estimating transcript levels tail lengths and tail composition heterogeneity in individual reads with minimal library preparation biases both in the coding and non coding transcriptome. | ENA FIRST PUBLIC:2022 10 10|ENA LAST UPDATE:2022 10 10 | dRNA seq of 4hpf Zebrafish embryos | Zebrafish dRNA 4hpf | SAMEA110422854 | CENTER FOR GENOMIC REGULATION (CRG) | ENA FIRST PUBLIC:2022 10 10|ENA LAST UPDATE:2022 10 10|External Id:SAMEA110422854|INSDC center alias:CENTER FOR GENOMIC REGULATION CRG|INSDC center name:CENTER FOR GENOMIC REGULATION CRG|INSDC first public:2022 10 10T00:21:01Z|INSDC last update:2022 10 10T00:21:01Z|INSDC status:public|Submitter Id:Zebrafish dRNA 4hpf|common name:zebrafish|sample name:Zebrafish dRNA 4hpf | MinION sequencing | ena EXPERIMENT TAB 27 07 2022 11:41:43:673 3 | Zebrafish dRNA 4hpf | 1 | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | OXFORD_NANOPORE | MinION | ERP138294 | MinION sequencing | ENA FIRST PUBLIC:2022 10 10|ENA LAST UPDATE:2022 10 10|instrument model:PromethION | PDBN042841_dRNA_4hpf.tar.gz | nanopore | 772304625.0 | 897768.0 | ena RUN TAB 27 07 2022 11:41:43:690 4 | 0:860.25 | A:224977035;C:165273397;G:156659356;T:225394837;N:0 | 860 | 224977035 | 165273397 | 156659356 | 225394837 | 0 | ERX9536682 | ERS12521224 | ERA16500713 | CENTER FOR GENOMIC REGULATION (CRG)|European Nucleotide Archive | CENTER FOR GENOMIC REGULATION (CRG) | ont | ont | 3prime | poly_a | unknown | bulk | unknown | unknown | Spain | 2022-10-10 | Blastula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||||||
| 15070 | 15070 | ERR12476466 | ERX11852287 | ERS17743541 | ERP156655 | PRJEB71869 | Effects of paternal starvation in the offspring development of zebrafish | 33b9d14c-4211-4249-aede-f0f021d197e6 | Other | Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother. | ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15 | 24 hpf embryo collected at 1219 from a cross with a starved father | 1219 Starved | 1219S | organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden | NextSeq 500 sequencing | ena EXPERIMENT TAB 15 01 2024 21:42:36:193 277029 | 1219S | 1 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | ERP156655 | NextSeq 500 sequencing | ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22 | 1219S_S12_L003_R1_001.fastq.gz | fastq | 97592891.0 | 1298822.0 | ena RUN TAB 15 01 2024 21:42:36:193 277030 | 0:75.14 | A:34708924;C:19086989;G:21325291;T:22442527;N:29160 | 75 | 34708924 | 19086989 | 21325291 | 22442527 | 29160 | ERX11852287 | ERS17743541 | ERA27788968 | University of Birmingham|European Nucleotide Archive | University of Birmingham | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2024-01-15 | Pharyngula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||||
| 15071 | 15071 | ERR12476447 | ERX11852268 | ERS17743536 | ERP156655 | PRJEB71869 | Effects of paternal starvation in the offspring development of zebrafish | 33b9d14c-4211-4249-aede-f0f021d197e6 | Other | Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother. | ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15 | 24 hpf embryo collected at 1203 from a cross with a fed father | 1203 Fed | 1203F | organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden | NextSeq 500 sequencing | ena EXPERIMENT TAB 15 01 2024 21:42:36:179 276991 | 1203F | 1 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | ERP156655 | NextSeq 500 sequencing | ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22 | 1203F_S5_L004_R1_001.fastq.gz | fastq | 92134036.0 | 1226106.0 | ena RUN TAB 15 01 2024 21:42:36:179 276992 | 0:75.14 | A:33032252;C:17497320;G:19713134;T:21873197;N:18133 | 75 | 33032252 | 17497320 | 19713134 | 21873197 | 18133 | ERX11852268 | ERS17743536 | ERA27788968 | University of Birmingham|European Nucleotide Archive | University of Birmingham | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2024-01-15 | Pharyngula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||||
| 15072 | 15072 | ERR12476437 | ERX11852258 | ERS17743534 | ERP156655 | PRJEB71869 | Effects of paternal starvation in the offspring development of zebrafish | 33b9d14c-4211-4249-aede-f0f021d197e6 | Other | Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother. | ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15 | 24 hpf embryo collected at 1118 from a cross with a fed father | 1118 Fed | 1118F | organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden | NextSeq 500 sequencing | ena EXPERIMENT TAB 15 01 2024 21:42:36:172 276971 | 1118F | 1 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | ERP156655 | NextSeq 500 sequencing | ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22 | 1118F_S9_L002_R1_001.fastq.gz | fastq | 98606332.0 | 1311676.0 | ena RUN TAB 15 01 2024 21:42:36:172 276972 | 0:75.18 | A:35097475;C:19013865;G:21072825;T:23400976;N:21191 | 75 | 35097475 | 19013865 | 21072825 | 23400976 | 21191 | ERX11852258 | ERS17743534 | ERA27788968 | University of Birmingham|European Nucleotide Archive | University of Birmingham | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2024-01-15 | Pharyngula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||||
| 15073 | 15073 | ERR12476468 | ERX11852289 | ERS17743542 | ERP156655 | PRJEB71869 | Effects of paternal starvation in the offspring development of zebrafish | 33b9d14c-4211-4249-aede-f0f021d197e6 | Other | Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother. | ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15 | 24 hpf embryo collected at 1242 from a cross with a fed father | 1242D Fed | 1242FD | organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden | NextSeq 500 sequencing | ena EXPERIMENT TAB 15 01 2024 21:42:36:194 277033 | 1242FD | 1 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | ERP156655 | NextSeq 500 sequencing | ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22 | 1242FD_S13_L001_R1_001.fastq.gz | fastq | 89342488.0 | 1186885.0 | ena RUN TAB 15 01 2024 21:42:36:194 277034 | 0:75.27 | A:31174342;C:17129181;G:18704493;T:22323017;N:11455 | 75 | 31174342 | 17129181 | 18704493 | 22323017 | 11455 | ERX11852289 | ERS17743542 | ERA27788968 | University of Birmingham|European Nucleotide Archive | University of Birmingham | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2024-01-15 | Pharyngula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||||
| 15074 | 15074 | ERR12476438 | ERX11852259 | ERS17743534 | ERP156655 | PRJEB71869 | Effects of paternal starvation in the offspring development of zebrafish | 33b9d14c-4211-4249-aede-f0f021d197e6 | Other | Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother. | ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15 | 24 hpf embryo collected at 1118 from a cross with a fed father | 1118 Fed | 1118F | organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden | NextSeq 500 sequencing | ena EXPERIMENT TAB 15 01 2024 21:42:36:173 276973 | 1118F | 1 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | ERP156655 | NextSeq 500 sequencing | ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22 | 1118F_S9_L003_R1_001.fastq.gz | fastq | 98443412.0 | 1309747.0 | ena RUN TAB 15 01 2024 21:42:36:173 276974 | 0:75.16 | A:35171021;C:18991511;G:20974950;T:23280285;N:25645 | 75 | 35171021 | 18991511 | 20974950 | 23280285 | 25645 | ERX11852259 | ERS17743534 | ERA27788968 | University of Birmingham|European Nucleotide Archive | University of Birmingham | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2024-01-15 | Pharyngula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||||
| 15075 | 15075 | ERR12476442 | ERX11852263 | ERS17743535 | ERP156655 | PRJEB71869 | Effects of paternal starvation in the offspring development of zebrafish | 33b9d14c-4211-4249-aede-f0f021d197e6 | Other | Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother. | ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15 | 24 hpf embryo collected at 1118 from a cross with a starved father | 1118 Starved | 1118S | organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden | NextSeq 500 sequencing | ena EXPERIMENT TAB 15 01 2024 21:42:36:176 276981 | 1118S | 1 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | ERP156655 | NextSeq 500 sequencing | ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22 | 1118S_S10_L003_R1_001.fastq.gz | fastq | 98865255.0 | 1315357.0 | ena RUN TAB 15 01 2024 21:42:36:176 276982 | 0:75.16 | A:34981471;C:19126822;G:21304286;T:23427226;N:25450 | 75 | 34981471 | 19126822 | 21304286 | 23427226 | 25450 | ERX11852263 | ERS17743535 | ERA27788968 | University of Birmingham|European Nucleotide Archive | University of Birmingham | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2024-01-15 | Pharyngula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||||
| 15076 | 15076 | ERR12476467 | ERX11852288 | ERS17743541 | ERP156655 | PRJEB71869 | Effects of paternal starvation in the offspring development of zebrafish | 33b9d14c-4211-4249-aede-f0f021d197e6 | Other | Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother. | ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15 | 24 hpf embryo collected at 1219 from a cross with a starved father | 1219 Starved | 1219S | organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden | NextSeq 500 sequencing | ena EXPERIMENT TAB 15 01 2024 21:42:36:193 277031 | 1219S | 1 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | ERP156655 | NextSeq 500 sequencing | ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22 | 1219S_S12_L004_R1_001.fastq.gz | fastq | 88230016.0 | 1174256.0 | ena RUN TAB 15 01 2024 21:42:36:194 277032 | 0:75.14 | A:31409300;C:17203675;G:19284478;T:20309174;N:23389 | 75 | 31409300 | 17203675 | 19284478 | 20309174 | 23389 | ERX11852288 | ERS17743541 | ERA27788968 | University of Birmingham|European Nucleotide Archive | University of Birmingham | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2024-01-15 | Pharyngula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||||
| 15077 | 15077 | ERR12476470 | ERX11852291 | ERS17743542 | ERP156655 | PRJEB71869 | Effects of paternal starvation in the offspring development of zebrafish | 33b9d14c-4211-4249-aede-f0f021d197e6 | Other | Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother. | ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15 | 24 hpf embryo collected at 1242 from a cross with a fed father | 1242D Fed | 1242FD | organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden | NextSeq 500 sequencing | ena EXPERIMENT TAB 15 01 2024 21:42:36:195 277037 | 1242FD | 1 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | ERP156655 | NextSeq 500 sequencing | ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22 | 1242FD_S13_L003_R1_001.fastq.gz | fastq | 93375090.0 | 1240903.0 | ena RUN TAB 15 01 2024 21:42:36:196 277038 | 0:75.25 | A:32510114;C:17950920;G:19575617;T:23324862;N:13577 | 75 | 32510114 | 17950920 | 19575617 | 23324862 | 13577 | ERX11852291 | ERS17743542 | ERA27788968 | University of Birmingham|European Nucleotide Archive | University of Birmingham | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2024-01-15 | Pharyngula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||||
| 15078 | 15078 | ERR12476436 | ERX11852257 | ERS17743534 | ERP156655 | PRJEB71869 | Effects of paternal starvation in the offspring development of zebrafish | 33b9d14c-4211-4249-aede-f0f021d197e6 | Other | Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother. | ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15 | 24 hpf embryo collected at 1118 from a cross with a fed father | 1118 Fed | 1118F | organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden | NextSeq 500 sequencing | ena EXPERIMENT TAB 15 01 2024 21:42:36:171 276969 | 1118F | 1 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | ERP156655 | NextSeq 500 sequencing | ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22 | 1118F_S9_L001_R1_001.fastq.gz | fastq | 94258948.0 | 1253428.0 | ena RUN TAB 15 01 2024 21:42:36:171 276970 | 0:75.20 | A:33713614;C:18157124;G:20086205;T:22277451;N:24554 | 75 | 33713614 | 18157124 | 20086205 | 22277451 | 24554 | ERX11852257 | ERS17743534 | ERA27788968 | University of Birmingham|European Nucleotide Archive | University of Birmingham | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2024-01-15 | Pharyngula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||||
| 15079 | 15079 | ERR12476452 | ERX11852273 | ERS17743538 | ERP156655 | PRJEB71869 | Effects of paternal starvation in the offspring development of zebrafish | 33b9d14c-4211-4249-aede-f0f021d197e6 | Other | Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother. | ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15 | 24 hpf embryo collected at 1210 from a cross with a fed father | 1210 Fed | 1210F | organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden | NextSeq 500 sequencing | ena EXPERIMENT TAB 15 01 2024 21:42:36:183 277001 | 1210F | 1 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | ERP156655 | NextSeq 500 sequencing | ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22 | 1210F_S7_L001_R1_001.fastq.gz | fastq | 96414625.0 | 1283672.0 | ena RUN TAB 15 01 2024 21:42:36:183 277002 | 0:75.11 | A:35605799;C:18366729;G:20807908;T:21594044;N:40145 | 75 | 35605799 | 18366729 | 20807908 | 21594044 | 40145 | ERX11852273 | ERS17743538 | ERA27788968 | University of Birmingham|European Nucleotide Archive | University of Birmingham | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2024-01-15 | Pharyngula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||||
| 15080 | 15080 | ERR12476475 | ERX11852296 | ERS17743544 | ERP156655 | PRJEB71869 | Effects of paternal starvation in the offspring development of zebrafish | 33b9d14c-4211-4249-aede-f0f021d197e6 | Other | Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother. | ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15 | 24 hpf embryo collected at 1242 from a cross with a fed father | 1242E Fed | 1242FE | organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden | NextSeq 500 sequencing | ena EXPERIMENT TAB 15 01 2024 21:42:36:199 277047 | 1242FE | 1 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | ERP156655 | NextSeq 500 sequencing | ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22 | 1242FE_S15_L004_R1_001.fastq.gz | fastq | 99581325.0 | 1325945.0 | ena RUN TAB 15 01 2024 21:42:36:199 277048 | 0:75.10 | A:36802442;C:18868511;G:20958294;T:22926783;N:25295 | 75 | 36802442 | 18868511 | 20958294 | 22926783 | 25295 | ERX11852296 | ERS17743544 | ERA27788968 | University of Birmingham|European Nucleotide Archive | University of Birmingham | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2024-01-15 | Pharyngula | Embryo | Embryo Imprecise | All anatomical structures |
Advanced export
JSON shape: default, array, newline-delimited
CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;