run_metadata
595 rows where experiment.library_layout = "SINGLE", technology = "smartseq" and tissue_curation_coarse = "All anatomical structures"
This data as json, CSV (advanced)
| Link | rowid ▼ | run.accession | experiment.accession | sample.accession | study.accession | bioproject | study.title | study.alias | study.type | study.abstract | study.attributes | study.PMIDs | sample.description | sample.title | sample.alias | sample.centername | sample.attributes | GEOsample.title | GEOsample.dataprocessing | GEOsample.source | GEOsample.treatmentprotocol | GEOsample.extractprotocol | GEOsample.growthprotocol | GEOsample.characteristics | GEOsample.accession | experiment.title | experiment.alias | experiment.library_name | experiment.design_description | experiment.library_construction_protocol | experiment.attributes | experiment.library_strategy | experiment.library_source | experiment.library_selection | experiment.library_layout | experiment.platform | experiment.instrument_model | experiment.spot_descriptor | experiment.study_ref | run.title | run.attributes | run.filename | run.semantic_name | run.total_bases | run.total_spots | run.alias | run.read_lengths | run.base_counts | run.r1_length | run.r2_length | run.r3_length | run.r4_length | run.Acount | run.Ccount | run.Gcount | run.Tcount | run.Ncount | run.experiment | run.pool_member | submission.accession | submission.srasource | submission.bioprojectsource | seqdetective.n_mates | seqdetective.mapping_rate.mate1 | seqdetective.mapping_rate.mate2 | seqdetective.nofeature_rate.mate1 | seqdetective.nofeature_rate.mate2 | seqdetective.sparsity.mate1 | seqdetective.sparsity.mate2 | seqdetective.pos_strand_rate.mate1 | seqdetective.pos_strand_rate.mate2 | seqdetective.readlen.mate1 | seqdetective.readlen.mate2 | seqdetective.judgement.mate1 | seqdetective.judgement.mate2 | seqdetective.judgement.reason | platform_family | instrument_generation | read_bias | selection_class | prep_kit | sc_or_bulk | tech_class | technology | tech_variant | submission.bioprojectsource.country | earliest_date | devstage_curation | devstage_curation_coarse | tissue_curation | tissue_curation_coarse |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 9651 | 9651 | ERR3266392 | ERX3293003 | ERS3358386 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp positive rep2 | SAMEA5556346 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp positive rep2 s | sponge tdr gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_9pos_S2_L001_R1_001.fastq.gz | fastq | 603238067.0 | 8014716.0 | E MTAB 7846:sponge tdr gfp positive rep2 lane1 | 0:75.27 1:0 | A:164797697;C:136552121;G:141138007;T:160737152;N:13090 | 75 | 0 | 164797697 | 136552121 | 141138007 | 160737152 | 13090 | ERX3293003 | ERS3358386 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95083 | 0.06432 | 0.71532 | 0.50098 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9652 | 9652 | ERR3266393 | ERX3293003 | ERS3358386 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp positive rep2 | SAMEA5556346 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp positive rep2 s | sponge tdr gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_9pos_S2_L002_R1_001.fastq.gz | fastq | 603749720.0 | 8021069.0 | E MTAB 7846:sponge tdr gfp positive rep2 lane2 | 0:75.27 1:0 | A:164972969;C:136661417;G:141205792;T:160896264;N:13278 | 75 | 0 | 164972969 | 136661417 | 141205792 | 160896264 | 13278 | ERX3293003 | ERS3358386 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.951 | 0.06542 | 0.71768 | 0.50051 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9653 | 9653 | ERR3266394 | ERX3293003 | ERS3358386 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp positive rep2 | SAMEA5556346 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp positive rep2 s | sponge tdr gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_9pos_S2_L003_R1_001.fastq.gz | fastq | 608154053.0 | 8079704.0 | E MTAB 7846:sponge tdr gfp positive rep2 lane3 | 0:75.27 1:0 | A:166117918;C:137731172;G:142320339;T:161970092;N:14532 | 75 | 0 | 166117918 | 137731172 | 142320339 | 161970092 | 14532 | ERX3293003 | ERS3358386 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95155 | 0.0657 | 0.71634 | 0.49493 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9654 | 9654 | ERR3266395 | ERX3293003 | ERS3358386 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp positive rep2 | SAMEA5556346 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp positive rep2 s | sponge tdr gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_9pos_S2_L004_R1_001.fastq.gz | fastq | 599143392.0 | 7959897.0 | E MTAB 7846:sponge tdr gfp positive rep2 lane4 | 0:75.27 1:0 | A:163706904;C:135622453;G:140192351;T:159605249;N:16435 | 75 | 0 | 163706904 | 135622453 | 140192351 | 159605249 | 16435 | ERX3293003 | ERS3358386 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95061 | 0.06431 | 0.71764 | 0.50166 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9655 | 9655 | ERR3266388 | ERX3293002 | ERS3358385 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp positive rep1 | SAMEA5556345 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp positive rep1 s | sponge tdr gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_6pos_S4_L001_R1_001.fastq.gz | fastq | 616761505.0 | 8202480.0 | E MTAB 7846:sponge tdr gfp positive rep1 lane1 | 0:75.19 1:0 | A:168679238;C:139548565;G:143969797;T:164545362;N:18543 | 75 | 0 | 168679238 | 139548565 | 143969797 | 164545362 | 18543 | ERX3293002 | ERS3358385 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95019 | 0.06806 | 0.7097 | 0.50337 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9656 | 9656 | ERR3266389 | ERX3293002 | ERS3358385 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp positive rep1 | SAMEA5556345 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp positive rep1 s | sponge tdr gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_6pos_S4_L002_R1_001.fastq.gz | fastq | 617529482.0 | 8212485.0 | E MTAB 7846:sponge tdr gfp positive rep1 lane2 | 0:75.19 1:0 | A:168925757;C:139655387;G:144096837;T:164831236;N:20265 | 75 | 0 | 168925757 | 139655387 | 144096837 | 164831236 | 20265 | ERX3293002 | ERS3358385 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.9492 | 0.06753 | 0.712 | 0.49881 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9657 | 9657 | ERR3266390 | ERX3293002 | ERS3358385 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp positive rep1 | SAMEA5556345 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp positive rep1 s | sponge tdr gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_6pos_S4_L003_R1_001.fastq.gz | fastq | 624156883.0 | 8300861.0 | E MTAB 7846:sponge tdr gfp positive rep1 lane3 | 0:75.19 1:0 | A:170696950;C:141302376;G:145759286;T:166377781;N:20490 | 75 | 0 | 170696950 | 141302376 | 145759286 | 166377781 | 20490 | ERX3293002 | ERS3358385 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94917 | 0.06724 | 0.71291 | 0.50783 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9658 | 9658 | ERR3266391 | ERX3293002 | ERS3358385 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp positive rep1 | SAMEA5556345 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp positive rep1 s | sponge tdr gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_6pos_S4_L004_R1_001.fastq.gz | fastq | 615013615.0 | 8179180.0 | E MTAB 7846:sponge tdr gfp positive rep1 lane4 | 0:75.19 1:0 | A:168237742;C:139106952;G:143535658;T:164110735;N:22528 | 75 | 0 | 168237742 | 139106952 | 143535658 | 164110735 | 22528 | ERX3293002 | ERS3358385 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94892 | 0.06723 | 0.71206 | 0.50775 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9659 | 9659 | ERR3266384 | ERX3293001 | ERS3358384 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp negative rep2 | SAMEA5556344 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556344|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp negative rep2 s | sponge tdr gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_9neg_S1_L001_R1_001.fastq.gz | fastq | 659562366.0 | 8762947.0 | E MTAB 7846:sponge tdr gfp negative rep2 lane1 | 0:75.27 1:0 | A:178744772;C:150091912;G:155092318;T:175619332;N:14032 | 75 | 0 | 178744772 | 150091912 | 155092318 | 175619332 | 14032 | ERX3293001 | ERS3358384 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.9517 | 0.06908 | 0.70822 | 0.48025 | 73 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9660 | 9660 | ERR3266385 | ERX3293001 | ERS3358384 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp negative rep2 | SAMEA5556344 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556344|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp negative rep2 s | sponge tdr gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_9neg_S1_L002_R1_001.fastq.gz | fastq | 658688825.0 | 8751176.0 | E MTAB 7846:sponge tdr gfp negative rep2 lane2 | 0:75.27 1:0 | A:178540155;C:149844100;G:154850294;T:175438757;N:15519 | 75 | 0 | 178540155 | 149844100 | 154850294 | 175438757 | 15519 | ERX3293001 | ERS3358384 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95059 | 0.06748 | 0.70806 | 0.48177 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9661 | 9661 | ERR3266386 | ERX3293001 | ERS3358384 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp negative rep2 | SAMEA5556344 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556344|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp negative rep2 s | sponge tdr gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_9neg_S1_L003_R1_001.fastq.gz | fastq | 665901310.0 | 8846927.0 | E MTAB 7846:sponge tdr gfp negative rep2 lane3 | 0:75.27 1:0 | A:180412445;C:151589489;G:156677030;T:177206192;N:16154 | 75 | 0 | 180412445 | 151589489 | 156677030 | 177206192 | 16154 | ERX3293001 | ERS3358384 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95095 | 0.06855 | 0.7082 | 0.4787 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9662 | 9662 | ERR3266387 | ERX3293001 | ERS3358384 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp negative rep2 | SAMEA5556344 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556344|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp negative rep2 s | sponge tdr gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_9neg_S1_L004_R1_001.fastq.gz | fastq | 655674573.0 | 8711278.0 | E MTAB 7846:sponge tdr gfp negative rep2 lane4 | 0:75.27 1:0 | A:177658097;C:149188009;G:154201531;T:174609176;N:17760 | 75 | 0 | 177658097 | 149188009 | 154201531 | 174609176 | 17760 | ERX3293001 | ERS3358384 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.9503 | 0.06838 | 0.70926 | 0.47475 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9663 | 9663 | ERR3266380 | ERX3293000 | ERS3358383 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp negative rep1 | SAMEA5556343 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556343|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp negative rep1 s | sponge tdr gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_6neg_S3_L001_R1_001.fastq.gz | fastq | 634491637.0 | 8440052.0 | E MTAB 7846:sponge tdr gfp negative rep1 lane1 | 0:75.18 1:0 | A:170881257;C:145535643;G:150561786;T:167495156;N:17795 | 75 | 0 | 170881257 | 145535643 | 150561786 | 167495156 | 17795 | ERX3293000 | ERS3358383 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94996 | 0.05672 | 0.70571 | 0.48691 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9664 | 9664 | ERR3266381 | ERX3293000 | ERS3358383 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp negative rep1 | SAMEA5556343 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556343|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp negative rep1 s | sponge tdr gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_6neg_S3_L002_R1_001.fastq.gz | fastq | 632900752.0 | 8418846.0 | E MTAB 7846:sponge tdr gfp negative rep1 lane2 | 0:75.18 1:0 | A:170454908;C:145141392;G:150172752;T:167112562;N:19138 | 75 | 0 | 170454908 | 145141392 | 150172752 | 167112562 | 19138 | ERX3293000 | ERS3358383 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94905 | 0.05627 | 0.70457 | 0.4865 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9665 | 9665 | ERR3266382 | ERX3293000 | ERS3358383 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp negative rep1 | SAMEA5556343 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556343|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp negative rep1 s | sponge tdr gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_6neg_S3_L003_R1_001.fastq.gz | fastq | 638530115.0 | 8494045.0 | E MTAB 7846:sponge tdr gfp negative rep1 lane3 | 0:75.17 1:0 | A:171907482;C:146526309;G:151612209;T:168464163;N:19952 | 75 | 0 | 171907482 | 146526309 | 151612209 | 168464163 | 19952 | ERX3293000 | ERS3358383 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94919 | 0.05578 | 0.70849 | 0.48073 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9666 | 9666 | ERR3266383 | ERX3293000 | ERS3358383 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp negative rep1 | SAMEA5556343 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556343|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp negative rep1 s | sponge tdr gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_6neg_S3_L004_R1_001.fastq.gz | fastq | 627433322.0 | 8346505.0 | E MTAB 7846:sponge tdr gfp negative rep1 lane4 | 0:75.17 1:0 | A:169016383;C:143886824;G:148914725;T:165593528;N:21862 | 75 | 0 | 169016383 | 143886824 | 148914725 | 165593528 | 21862 | ERX3293000 | ERS3358383 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94993 | 0.05721 | 0.7052 | 0.48878 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9667 | 9667 | ERR3266376 | ERX3292999 | ERS3358382 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp positive rep2 | SAMEA5556342 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556342|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp positive rep2 s | sponge isl gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_7pos_S10_L001_R1_001.fastq.gz | fastq | 618672195.0 | 8218047.0 | E MTAB 7846:sponge isl gfp positive rep2 lane1 | 0:75.28 1:0 | A:166422886;C:142212204;G:146857539;T:163167819;N:11747 | 75 | 0 | 166422886 | 142212204 | 146857539 | 163167819 | 11747 | ERX3292999 | ERS3358382 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94979 | 0.08351 | 0.70863 | 0.47581 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9668 | 9668 | ERR3266377 | ERX3292999 | ERS3358382 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp positive rep2 | SAMEA5556342 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556342|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp positive rep2 s | sponge isl gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_7pos_S10_L002_R1_001.fastq.gz | fastq | 618709102.0 | 8218295.0 | E MTAB 7846:sponge isl gfp positive rep2 lane2 | 0:75.28 1:0 | A:166470432;C:142189977;G:146819280;T:163216323;N:13090 | 75 | 0 | 166470432 | 142189977 | 146819280 | 163216323 | 13090 | ERX3292999 | ERS3358382 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94977 | 0.08255 | 0.70644 | 0.47228 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9669 | 9669 | ERR3266378 | ERX3292999 | ERS3358382 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp positive rep2 | SAMEA5556342 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556342|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp positive rep2 s | sponge isl gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_7pos_S10_L003_R1_001.fastq.gz | fastq | 625353059.0 | 8306375.0 | E MTAB 7846:sponge isl gfp positive rep2 lane3 | 0:75.29 1:0 | A:168233274;C:143793178;G:148510556;T:164802476;N:13575 | 75 | 0 | 168233274 | 143793178 | 148510556 | 164802476 | 13575 | ERX3292999 | ERS3358382 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95014 | 0.08368 | 0.70743 | 0.47846 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9670 | 9670 | ERR3266379 | ERX3292999 | ERS3358382 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp positive rep2 | SAMEA5556342 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556342|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp positive rep2 s | sponge isl gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_7pos_S10_L004_R1_001.fastq.gz | fastq | 615204990.0 | 8171748.0 | E MTAB 7846:sponge isl gfp positive rep2 lane4 | 0:75.28 1:0 | A:165565861;C:141380152;G:146028839;T:162214263;N:15875 | 75 | 0 | 165565861 | 141380152 | 146028839 | 162214263 | 15875 | ERX3292999 | ERS3358382 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94954 | 0.08233 | 0.70834 | 0.48166 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9671 | 9671 | ERR3266372 | ERX3292998 | ERS3358381 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp positive rep1 | SAMEA5556341 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556341|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp positive rep1 s | sponge isl gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_6pos_S12_L001_R1_001.fastq.gz | fastq | 626474467.0 | 8318996.0 | E MTAB 7846:sponge isl gfp positive rep1 lane1 | 0:75.31 1:0 | A:170186220;C:142441110;G:147048643;T:166786401;N:12093 | 75 | 0 | 170186220 | 142441110 | 147048643 | 166786401 | 12093 | ERX3292998 | ERS3358381 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94907 | 0.08132 | 0.69684 | 0.4736 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9672 | 9672 | ERR3266373 | ERX3292998 | ERS3358381 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp positive rep1 | SAMEA5556341 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556341|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp positive rep1 s | sponge isl gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_6pos_S12_L002_R1_001.fastq.gz | fastq | 626477579.0 | 8318750.0 | E MTAB 7846:sponge isl gfp positive rep1 lane2 | 0:75.31 1:0 | A:170185337;C:142396801;G:147032265;T:166850532;N:12644 | 75 | 0 | 170185337 | 142396801 | 147032265 | 166850532 | 12644 | ERX3292998 | ERS3358381 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94941 | 0.08253 | 0.6957 | 0.47554 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9673 | 9673 | ERR3266374 | ERX3292998 | ERS3358381 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp positive rep1 | SAMEA5556341 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556341|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp positive rep1 s | sponge isl gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_6pos_S12_L003_R1_001.fastq.gz | fastq | 632098509.0 | 8393388.0 | E MTAB 7846:sponge isl gfp positive rep1 lane3 | 0:75.31 1:0 | A:171699353;C:143766296;G:148442110;T:168177264;N:13486 | 75 | 0 | 171699353 | 143766296 | 148442110 | 168177264 | 13486 | ERX3292998 | ERS3358381 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94866 | 0.08247 | 0.69601 | 0.48009 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9674 | 9674 | ERR3266375 | ERX3292998 | ERS3358381 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp positive rep1 | SAMEA5556341 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556341|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp positive rep1 s | sponge isl gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_6pos_S12_L004_R1_001.fastq.gz | fastq | 622997479.0 | 8272752.0 | E MTAB 7846:sponge isl gfp positive rep1 lane4 | 0:75.31 1:0 | A:169306677;C:141586415;G:146241288;T:165847752;N:15347 | 75 | 0 | 169306677 | 141586415 | 146241288 | 165847752 | 15347 | ERX3292998 | ERS3358381 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.9483 | 0.08034 | 0.69662 | 0.47868 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9675 | 9675 | ERR3266368 | ERX3292997 | ERS3358380 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp negative rep2 | SAMEA5556340 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556340|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp negative rep2 s | sponge isl gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_7neg_S9_L001_R1_001.fastq.gz | fastq | 707454819.0 | 9395082.0 | E MTAB 7846:sponge isl gfp negative rep2 lane1 | 0:75.30 1:0 | A:194991862;C:157927850;G:163280639;T:191241488;N:12980 | 75 | 0 | 194991862 | 157927850 | 163280639 | 191241488 | 12980 | ERX3292997 | ERS3358380 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.93871 | 0.08926 | 0.70806 | 0.46501 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9676 | 9676 | ERR3266369 | ERX3292997 | ERS3358380 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp negative rep2 | SAMEA5556340 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556340|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp negative rep2 s | sponge isl gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_7neg_S9_L002_R1_001.fastq.gz | fastq | 704791838.0 | 9359668.0 | E MTAB 7846:sponge isl gfp negative rep2 lane2 | 0:75.30 1:0 | A:194317422;C:157276895;G:162624670;T:190558322;N:14529 | 75 | 0 | 194317422 | 157276895 | 162624670 | 190558322 | 14529 | ERX3292997 | ERS3358380 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.93816 | 0.08859 | 0.70999 | 0.4661 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9677 | 9677 | ERR3266370 | ERX3292997 | ERS3358380 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp negative rep2 | SAMEA5556340 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556340|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp negative rep2 s | sponge isl gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_7neg_S9_L003_R1_001.fastq.gz | fastq | 715991833.0 | 9508323.0 | E MTAB 7846:sponge isl gfp negative rep2 lane3 | 0:75.30 1:0 | A:197297222;C:159913026;G:165363927;T:193402765;N:14893 | 75 | 0 | 197297222 | 159913026 | 165363927 | 193402765 | 14893 | ERX3292997 | ERS3358380 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.93844 | 0.08854 | 0.70828 | 0.46042 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9678 | 9678 | ERR3266371 | ERX3292997 | ERS3358380 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp negative rep2 | SAMEA5556340 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556340|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp negative rep2 s | sponge isl gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_7neg_S9_L004_R1_001.fastq.gz | fastq | 703723869.0 | 9345669.0 | E MTAB 7846:sponge isl gfp negative rep2 lane4 | 0:75.30 1:0 | A:194029886;C:157050176;G:162432310;T:190193608;N:17889 | 75 | 0 | 194029886 | 157050176 | 162432310 | 190193608 | 17889 | ERX3292997 | ERS3358380 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.93897 | 0.08993 | 0.70863 | 0.45707 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9679 | 9679 | ERR3266364 | ERX3292996 | ERS3358379 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp negative rep1 | SAMEA5556339 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556339|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp negative rep1 s | sponge isl gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_6neg_S11_L001_R1_001.fastq.gz | fastq | 676581458.0 | 8983758.0 | E MTAB 7846:sponge isl gfp negative rep1 lane1 | 0:75.31 1:0 | A:184297337;C:153352193;G:158268476;T:180651038;N:12414 | 75 | 0 | 184297337 | 153352193 | 158268476 | 180651038 | 12414 | ERX3292996 | ERS3358379 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94981 | 0.07715 | 0.69138 | 0.47243 | 74 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9680 | 9680 | ERR3266365 | ERX3292996 | ERS3358379 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp negative rep1 | SAMEA5556339 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556339|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp negative rep1 s | sponge isl gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_6neg_S11_L002_R1_001.fastq.gz | fastq | 676876555.0 | 8987445.0 | E MTAB 7846:sponge isl gfp negative rep1 lane2 | 0:75.31 1:0 | A:184435129;C:153332402;G:158323789;T:180770978;N:14257 | 75 | 0 | 184435129 | 153332402 | 158323789 | 180770978 | 14257 | ERX3292996 | ERS3358379 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94901 | 0.07805 | 0.69179 | 0.47182 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9681 | 9681 | ERR3266366 | ERX3292996 | ERS3358379 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp negative rep1 | SAMEA5556339 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556339|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp negative rep1 s | sponge isl gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_6neg_S11_L003_R1_001.fastq.gz | fastq | 681771213.0 | 9052615.0 | E MTAB 7846:sponge isl gfp negative rep1 lane3 | 0:75.31 1:0 | A:185717696;C:154552039;G:159567102;T:181919781;N:14595 | 75 | 0 | 185717696 | 154552039 | 159567102 | 181919781 | 14595 | ERX3292996 | ERS3358379 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94923 | 0.07768 | 0.69167 | 0.47219 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9682 | 9682 | ERR3266367 | ERX3292996 | ERS3358379 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp negative rep1 | SAMEA5556339 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556339|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp negative rep1 s | sponge isl gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_6neg_S11_L004_R1_001.fastq.gz | fastq | 671169917.0 | 8911624.0 | E MTAB 7846:sponge isl gfp negative rep1 lane4 | 0:75.31 1:0 | A:182910490;C:152045814;G:157010053;T:179186548;N:17012 | 75 | 0 | 182910490 | 152045814 | 157010053 | 179186548 | 17012 | ERX3292996 | ERS3358379 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94941 | 0.07612 | 0.69106 | 0.47736 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9683 | 9683 | ERR3266360 | ERX3292995 | ERS3358378 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp positive rep2 | SAMEA5556338 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556338|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp positive rep2 s | sponge ccn gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_8pos_S6_L001_R1_001.fastq.gz | fastq | 745666738.0 | 9917771.0 | E MTAB 7846:sponge ccn gfp positive rep2 lane1 | 0:75.18 1:0 | A:207714377;C:163732420;G:169037726;T:205161925;N:20290 | 75 | 0 | 207714377 | 163732420 | 169037726 | 205161925 | 20290 | ERX3292995 | ERS3358378 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94006 | 0.17809 | 0.68166 | 0.48912 | 74 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9684 | 9684 | ERR3266361 | ERX3292995 | ERS3358378 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp positive rep2 | SAMEA5556338 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556338|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp positive rep2 s | sponge ccn gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_8pos_S6_L002_R1_001.fastq.gz | fastq | 747693645.0 | 9944395.0 | E MTAB 7846:sponge ccn gfp positive rep2 lane2 | 0:75.19 1:0 | A:208257288;C:164106384;G:169478025;T:205830399;N:21549 | 75 | 0 | 208257288 | 164106384 | 169478025 | 205830399 | 21549 | ERX3292995 | ERS3358378 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.93873 | 0.17738 | 0.68296 | 0.49656 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9685 | 9685 | ERR3266362 | ERX3292995 | ERS3358378 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp positive rep2 | SAMEA5556338 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556338|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp positive rep2 s | sponge ccn gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_8pos_S6_L003_R1_001.fastq.gz | fastq | 756134124.0 | 10056818.0 | E MTAB 7846:sponge ccn gfp positive rep2 lane3 | 0:75.19 1:0 | A:210573012;C:166089133;G:171475300;T:207973232;N:23447 | 75 | 0 | 210573012 | 166089133 | 171475300 | 207973232 | 23447 | ERX3292995 | ERS3358378 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94077 | 0.18001 | 0.68004 | 0.49812 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9686 | 9686 | ERR3266363 | ERX3292995 | ERS3358378 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp positive rep2 | SAMEA5556338 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556338|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp positive rep2 s | sponge ccn gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_8pos_S6_L004_R1_001.fastq.gz | fastq | 747687619.0 | 9944417.0 | E MTAB 7846:sponge ccn gfp positive rep2 lane4 | 0:75.19 1:0 | A:208315943;C:164104155;G:169484250;T:205757712;N:25559 | 75 | 0 | 208315943 | 164104155 | 169484250 | 205757712 | 25559 | ERX3292995 | ERS3358378 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94025 | 0.17965 | 0.68124 | 0.49249 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9687 | 9687 | ERR3266356 | ERX3292994 | ERS3358377 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp positive rep1 | SAMEA5556337 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556337|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp positive rep1 s | sponge ccn gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_7pos_S8_L001_R1_001.fastq.gz | fastq | 600153564.0 | 7972767.0 | E MTAB 7846:sponge ccn gfp positive rep1 lane1 | 0:75.28 1:0 | A:165075878;C:133961511;G:138306424;T:162797903;N:11848 | 75 | 0 | 165075878 | 133961511 | 138306424 | 162797903 | 11848 | ERX3292994 | ERS3358377 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95367 | 0.14146 | 0.69154 | 0.46621 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9688 | 9688 | ERR3266357 | ERX3292994 | ERS3358377 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp positive rep1 | SAMEA5556337 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556337|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp positive rep1 s | sponge ccn gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_7pos_S8_L002_R1_001.fastq.gz | fastq | 600790169.0 | 7981038.0 | E MTAB 7846:sponge ccn gfp positive rep1 lane2 | 0:75.28 1:0 | A:165262968;C:133988329;G:138458635;T:163066854;N:13383 | 75 | 0 | 165262968 | 133988329 | 138458635 | 163066854 | 13383 | ERX3292994 | ERS3358377 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95365 | 0.14116 | 0.69301 | 0.46836 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9689 | 9689 | ERR3266358 | ERX3292994 | ERS3358377 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp positive rep1 | SAMEA5556337 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556337|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp positive rep1 s | sponge ccn gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_7pos_S8_L003_R1_001.fastq.gz | fastq | 608611085.0 | 8084904.0 | E MTAB 7846:sponge ccn gfp positive rep1 lane3 | 0:75.28 1:0 | A:167402055;C:135871708;G:140314669;T:165009252;N:13401 | 75 | 0 | 167402055 | 135871708 | 140314669 | 165009252 | 13401 | ERX3292994 | ERS3358377 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95403 | 0.14167 | 0.69311 | 0.4702 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9690 | 9690 | ERR3266359 | ERX3292994 | ERS3358377 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp positive rep1 | SAMEA5556337 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556337|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp positive rep1 s | sponge ccn gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_7pos_S8_L004_R1_001.fastq.gz | fastq | 599558663.0 | 7964718.0 | E MTAB 7846:sponge ccn gfp positive rep1 lane4 | 0:75.28 1:0 | A:164965131;C:133749666;G:138194884;T:162633558;N:15424 | 75 | 0 | 164965131 | 133749666 | 138194884 | 162633558 | 15424 | ERX3292994 | ERS3358377 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95285 | 0.14085 | 0.69037 | 0.47345 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9691 | 9691 | ERR3266352 | ERX3292993 | ERS3358376 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp negative rep2 | SAMEA5556336 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556336|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp negative rep2 s | sponge ccn gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_8neg_S5_L001_R1_001.fastq.gz | fastq | 599599608.0 | 7970460.0 | E MTAB 7846:sponge ccn gfp negative rep2 lane1 | 0:75.23 1:0 | A:162236409;C:136907675;G:141538730;T:158902520;N:14274 | 75 | 0 | 162236409 | 136907675 | 141538730 | 158902520 | 14274 | ERX3292993 | ERS3358376 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95404 | 0.05923 | 0.69737 | 0.48627 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9692 | 9692 | ERR3266353 | ERX3292993 | ERS3358376 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp negative rep2 | SAMEA5556336 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556336|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp negative rep2 s | sponge ccn gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_8neg_S5_L002_R1_001.fastq.gz | fastq | 600057776.0 | 7976438.0 | E MTAB 7846:sponge ccn gfp negative rep2 lane2 | 0:75.23 1:0 | A:162367410;C:136994919;G:141577782;T:159102194;N:15471 | 75 | 0 | 162367410 | 136994919 | 141577782 | 159102194 | 15471 | ERX3292993 | ERS3358376 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.953 | 0.06085 | 0.6952 | 0.48868 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9693 | 9693 | ERR3266354 | ERX3292993 | ERS3358376 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp negative rep2 | SAMEA5556336 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556336|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp negative rep2 s | sponge ccn gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_8neg_S5_L003_R1_001.fastq.gz | fastq | 607089697.0 | 8069901.0 | E MTAB 7846:sponge ccn gfp negative rep2 lane3 | 0:75.23 1:0 | A:164235344;C:138684000;G:143335680;T:160819270;N:15403 | 75 | 0 | 164235344 | 138684000 | 143335680 | 160819270 | 15403 | ERX3292993 | ERS3358376 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95245 | 0.06055 | 0.69589 | 0.48813 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9694 | 9694 | ERR3266355 | ERX3292993 | ERS3358376 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp negative rep2 | SAMEA5556336 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556336|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp negative rep2 s | sponge ccn gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_8neg_S5_L004_R1_001.fastq.gz | fastq | 598098243.0 | 7950223.0 | E MTAB 7846:sponge ccn gfp negative rep2 lane4 | 0:75.23 1:0 | A:161836808;C:136564804;G:141157424;T:158521860;N:17347 | 75 | 0 | 161836808 | 136564804 | 141157424 | 158521860 | 17347 | ERX3292993 | ERS3358376 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95299 | 0.06032 | 0.69501 | 0.48928 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9695 | 9695 | ERR3266348 | ERX3292992 | ERS3358375 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp negative rep1 | SAMEA5556335 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556335|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp negative rep1 s | sponge ccn gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_7neg_S7_L001_R1_001.fastq.gz | fastq | 668175990.0 | 8872549.0 | E MTAB 7846:sponge ccn gfp negative rep1 lane1 | 0:75.31 1:0 | A:179859350;C:153483169;G:158360605;T:176462088;N:10778 | 75 | 0 | 179859350 | 153483169 | 158360605 | 176462088 | 10778 | ERX3292992 | ERS3358375 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95955 | 0.07154 | 0.69696 | 0.46425 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9696 | 9696 | ERR3266349 | ERX3292992 | ERS3358375 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp negative rep1 | SAMEA5556335 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556335|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp negative rep1 s | sponge ccn gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_7neg_S7_L002_R1_001.fastq.gz | fastq | 668154755.0 | 8872093.0 | E MTAB 7846:sponge ccn gfp negative rep1 lane2 | 0:75.31 1:0 | A:179811687;C:153454931;G:158314391;T:176560936;N:12810 | 75 | 0 | 179811687 | 153454931 | 158314391 | 176560936 | 12810 | ERX3292992 | ERS3358375 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.96029 | 0.06969 | 0.69684 | 0.46725 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9697 | 9697 | ERR3266350 | ERX3292992 | ERS3358375 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp negative rep1 | SAMEA5556335 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556335|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp negative rep1 s | sponge ccn gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_7neg_S7_L003_R1_001.fastq.gz | fastq | 676984426.0 | 8989004.0 | E MTAB 7846:sponge ccn gfp negative rep1 lane3 | 0:75.31 1:0 | A:182159685;C:155578195;G:160511499;T:178722363;N:12684 | 75 | 0 | 182159685 | 155578195 | 160511499 | 178722363 | 12684 | ERX3292992 | ERS3358375 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.96012 | 0.07159 | 0.69554 | 0.46811 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9698 | 9698 | ERR3266351 | ERX3292992 | ERS3358375 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp negative rep1 | SAMEA5556335 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556335|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp negative rep1 s | sponge ccn gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_7neg_S7_L004_R1_001.fastq.gz | fastq | 666031892.0 | 8843695.0 | E MTAB 7846:sponge ccn gfp negative rep1 lane4 | 0:75.31 1:0 | A:179243298;C:152946459;G:157873912;T:175953752;N:14471 | 75 | 0 | 179243298 | 152946459 | 157873912 | 175953752 | 14471 | ERX3292992 | ERS3358375 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.96014 | 0.07169 | 0.69493 | 0.47058 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 44532 | 44532 | SRR6268133 | SRX3374301 | SRS2671528 | SRP124607 | PRJNA417594 | From pioneer to repressor: Bimodal foxd3 activity dynamically remodels neural crest regulatory landscape in vivo | GSE106676 | Other | The neural crest NC is a transient embryonic stem cell population characterised by its multipotency and broad developmental potential. Here we perform NC specific transcriptional and epigenomic profiling of foxd3 mutant versus wild type cells in vivo to define the gene regulatory circuits controlling NC specification. Together with global binding analysis obtained by foxd3 biotin ChIP and single cell profiles of foxd3 expressing premigratory NC our analysis shows that during early steps of NC formation foxd3 acts globally as a pioneer factor to prime the onset of genes regulating NC specification and migration by re arranging the chromatin landscape opening cis regulatory elements and reshuffling nucleosomes. Strikingly foxd3 then gradually switches from an activator to its previously well described role as a transcriptional repressor. Taken together these results demonstrate that foxd3 acts bimodally in the neural crest as a switch from 'permissive' to 'repressive' nucleosome/chromatin organisation to maintain multipotency and define cell fates. Overall design: Examination of RNA seq ATAC seq histone ChIP seq Biotin ChIP seq in wild type and foxd3 mutant context at epib stages and in neural crest cells; single cell RNA seq | pubmed:30513303;pubmed:33111104 | scRNA seq FoxD3 Citrine 94 | GSM2845287 | source name:Citrine reporter expressing cells from 5 6ss embryos|strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | scRNA seq FoxD3 Citrine 94 | ChIP seq Biotin ChIP seq and ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using a enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a Genome build: danRer10 | Citrine reporter expressing cells from 5 6ss embryos | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | GSM2845287 | GSM2845287: scRNA seq FoxD3 Citrine 94; Danio rerio; RNA Seq | GSM2845287 | 1 | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | GEO Accession:GSM2845287 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP124607 | WTCHG_181146_712508_1.fastq.gz | fastq | 436462488.0 | 8558088.0 | GSM2845287 r1 | 0:51 | A:119967571;C:98729743;G:99474152;T:118258280;N:32742 | 51 | 119967571 | 98729743 | 99474152 | 118258280 | 32742 | SRX3374301 | SRS2671528 | SRA629218 | GEO | Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine | 1 | 0.92469 | 0.09452 | 0.91788 | 0.53498 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United Kingdom | 2017-11-08 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 44533 | 44533 | SRR6268132 | SRX3374300 | SRS2671530 | SRP124607 | PRJNA417594 | From pioneer to repressor: Bimodal foxd3 activity dynamically remodels neural crest regulatory landscape in vivo | GSE106676 | Other | The neural crest NC is a transient embryonic stem cell population characterised by its multipotency and broad developmental potential. Here we perform NC specific transcriptional and epigenomic profiling of foxd3 mutant versus wild type cells in vivo to define the gene regulatory circuits controlling NC specification. Together with global binding analysis obtained by foxd3 biotin ChIP and single cell profiles of foxd3 expressing premigratory NC our analysis shows that during early steps of NC formation foxd3 acts globally as a pioneer factor to prime the onset of genes regulating NC specification and migration by re arranging the chromatin landscape opening cis regulatory elements and reshuffling nucleosomes. Strikingly foxd3 then gradually switches from an activator to its previously well described role as a transcriptional repressor. Taken together these results demonstrate that foxd3 acts bimodally in the neural crest as a switch from 'permissive' to 'repressive' nucleosome/chromatin organisation to maintain multipotency and define cell fates. Overall design: Examination of RNA seq ATAC seq histone ChIP seq Biotin ChIP seq in wild type and foxd3 mutant context at epib stages and in neural crest cells; single cell RNA seq | pubmed:30513303;pubmed:33111104 | scRNA seq FoxD3 Citrine 93 | GSM2845286 | source name:Citrine reporter expressing cells from 5 6ss embryos|strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | scRNA seq FoxD3 Citrine 93 | ChIP seq Biotin ChIP seq and ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using a enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a Genome build: danRer10 | Citrine reporter expressing cells from 5 6ss embryos | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | GSM2845286 | GSM2845286: scRNA seq FoxD3 Citrine 93; Danio rerio; RNA Seq | GSM2845286 | 1 | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | GEO Accession:GSM2845286 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP124607 | WTCHG_181146_712507_1.fastq.gz | fastq | 407416458.0 | 7988558.0 | GSM2845286 r1 | 0:51 | A:111016015;C:92787191;G:93237485;T:110344415;N:31352 | 51 | 111016015 | 92787191 | 93237485 | 110344415 | 31352 | SRX3374300 | SRS2671530 | SRA629218 | GEO | Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine | 1 | 0.91707 | 0.0849 | 0.9022 | 0.5242 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United Kingdom | 2017-11-08 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 44534 | 44534 | SRR6268131 | SRX3374299 | SRS2671529 | SRP124607 | PRJNA417594 | From pioneer to repressor: Bimodal foxd3 activity dynamically remodels neural crest regulatory landscape in vivo | GSE106676 | Other | The neural crest NC is a transient embryonic stem cell population characterised by its multipotency and broad developmental potential. Here we perform NC specific transcriptional and epigenomic profiling of foxd3 mutant versus wild type cells in vivo to define the gene regulatory circuits controlling NC specification. Together with global binding analysis obtained by foxd3 biotin ChIP and single cell profiles of foxd3 expressing premigratory NC our analysis shows that during early steps of NC formation foxd3 acts globally as a pioneer factor to prime the onset of genes regulating NC specification and migration by re arranging the chromatin landscape opening cis regulatory elements and reshuffling nucleosomes. Strikingly foxd3 then gradually switches from an activator to its previously well described role as a transcriptional repressor. Taken together these results demonstrate that foxd3 acts bimodally in the neural crest as a switch from 'permissive' to 'repressive' nucleosome/chromatin organisation to maintain multipotency and define cell fates. Overall design: Examination of RNA seq ATAC seq histone ChIP seq Biotin ChIP seq in wild type and foxd3 mutant context at epib stages and in neural crest cells; single cell RNA seq | pubmed:30513303;pubmed:33111104 | scRNA seq FoxD3 Citrine 92 | GSM2845285 | source name:Citrine reporter expressing cells from 5 6ss embryos|strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | scRNA seq FoxD3 Citrine 92 | ChIP seq Biotin ChIP seq and ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using a enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a Genome build: danRer10 | Citrine reporter expressing cells from 5 6ss embryos | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | GSM2845285 | GSM2845285: scRNA seq FoxD3 Citrine 92; Danio rerio; RNA Seq | GSM2845285 | 1 | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | GEO Accession:GSM2845285 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP124607 | WTCHG_181146_712506_1.fastq.gz | fastq | 617657226.0 | 12110926.0 | GSM2845285 r1 | 0:51 | A:168011263;C:140888890;G:141626701;T:167082438;N:47934 | 51 | 168011263 | 140888890 | 141626701 | 167082438 | 47934 | SRX3374299 | SRS2671529 | SRA629218 | GEO | Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine | 1 | 0.91435 | 0.08626 | 0.92953 | 0.5371 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United Kingdom | 2017-11-08 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 44535 | 44535 | SRR6268130 | SRX3374298 | SRS2671527 | SRP124607 | PRJNA417594 | From pioneer to repressor: Bimodal foxd3 activity dynamically remodels neural crest regulatory landscape in vivo | GSE106676 | Other | The neural crest NC is a transient embryonic stem cell population characterised by its multipotency and broad developmental potential. Here we perform NC specific transcriptional and epigenomic profiling of foxd3 mutant versus wild type cells in vivo to define the gene regulatory circuits controlling NC specification. Together with global binding analysis obtained by foxd3 biotin ChIP and single cell profiles of foxd3 expressing premigratory NC our analysis shows that during early steps of NC formation foxd3 acts globally as a pioneer factor to prime the onset of genes regulating NC specification and migration by re arranging the chromatin landscape opening cis regulatory elements and reshuffling nucleosomes. Strikingly foxd3 then gradually switches from an activator to its previously well described role as a transcriptional repressor. Taken together these results demonstrate that foxd3 acts bimodally in the neural crest as a switch from 'permissive' to 'repressive' nucleosome/chromatin organisation to maintain multipotency and define cell fates. Overall design: Examination of RNA seq ATAC seq histone ChIP seq Biotin ChIP seq in wild type and foxd3 mutant context at epib stages and in neural crest cells; single cell RNA seq | pubmed:30513303;pubmed:33111104 | scRNA seq FoxD3 Citrine 91 | GSM2845284 | source name:Citrine reporter expressing cells from 5 6ss embryos|strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | scRNA seq FoxD3 Citrine 91 | ChIP seq Biotin ChIP seq and ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using a enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a Genome build: danRer10 | Citrine reporter expressing cells from 5 6ss embryos | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | GSM2845284 | GSM2845284: scRNA seq FoxD3 Citrine 91; Danio rerio; RNA Seq | GSM2845284 | 1 | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | GEO Accession:GSM2845284 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP124607 | WTCHG_181146_712505_1.fastq.gz | fastq | 272187255.0 | 5337005.0 | GSM2845284 r1 | 0:51 | A:74501233;C:61466233;G:61896148;T:74302512;N:21129 | 51 | 74501233 | 61466233 | 61896148 | 74302512 | 21129 | SRX3374298 | SRS2671527 | SRA629218 | GEO | Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine | 1 | 0.91255 | 0.10044 | 0.92088 | 0.53565 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United Kingdom | 2017-11-08 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 44536 | 44536 | SRR6268129 | SRX3374297 | SRS2671524 | SRP124607 | PRJNA417594 | From pioneer to repressor: Bimodal foxd3 activity dynamically remodels neural crest regulatory landscape in vivo | GSE106676 | Other | The neural crest NC is a transient embryonic stem cell population characterised by its multipotency and broad developmental potential. Here we perform NC specific transcriptional and epigenomic profiling of foxd3 mutant versus wild type cells in vivo to define the gene regulatory circuits controlling NC specification. Together with global binding analysis obtained by foxd3 biotin ChIP and single cell profiles of foxd3 expressing premigratory NC our analysis shows that during early steps of NC formation foxd3 acts globally as a pioneer factor to prime the onset of genes regulating NC specification and migration by re arranging the chromatin landscape opening cis regulatory elements and reshuffling nucleosomes. Strikingly foxd3 then gradually switches from an activator to its previously well described role as a transcriptional repressor. Taken together these results demonstrate that foxd3 acts bimodally in the neural crest as a switch from 'permissive' to 'repressive' nucleosome/chromatin organisation to maintain multipotency and define cell fates. Overall design: Examination of RNA seq ATAC seq histone ChIP seq Biotin ChIP seq in wild type and foxd3 mutant context at epib stages and in neural crest cells; single cell RNA seq | pubmed:30513303;pubmed:33111104 | scRNA seq FoxD3 Citrine 90 | GSM2845283 | source name:Citrine reporter expressing cells from 5 6ss embryos|strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | scRNA seq FoxD3 Citrine 90 | ChIP seq Biotin ChIP seq and ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using a enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a Genome build: danRer10 | Citrine reporter expressing cells from 5 6ss embryos | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | GSM2845283 | GSM2845283: scRNA seq FoxD3 Citrine 90; Danio rerio; RNA Seq | GSM2845283 | 1 | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | GEO Accession:GSM2845283 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP124607 | WTCHG_181146_712504_1.fastq.gz | fastq | 179964822.0 | 3528722.0 | GSM2845283 r1 | 0:51 | A:49308205;C:40738384;G:41071889;T:48832363;N:13981 | 51 | 49308205 | 40738384 | 41071889 | 48832363 | 13981 | SRX3374297 | SRS2671524 | SRA629218 | GEO | Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine | 1 | 0.91845 | 0.09227 | 0.89396 | 0.51306 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United Kingdom | 2017-11-08 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 44537 | 44537 | SRR6268128 | SRX3374296 | SRS2671526 | SRP124607 | PRJNA417594 | From pioneer to repressor: Bimodal foxd3 activity dynamically remodels neural crest regulatory landscape in vivo | GSE106676 | Other | The neural crest NC is a transient embryonic stem cell population characterised by its multipotency and broad developmental potential. Here we perform NC specific transcriptional and epigenomic profiling of foxd3 mutant versus wild type cells in vivo to define the gene regulatory circuits controlling NC specification. Together with global binding analysis obtained by foxd3 biotin ChIP and single cell profiles of foxd3 expressing premigratory NC our analysis shows that during early steps of NC formation foxd3 acts globally as a pioneer factor to prime the onset of genes regulating NC specification and migration by re arranging the chromatin landscape opening cis regulatory elements and reshuffling nucleosomes. Strikingly foxd3 then gradually switches from an activator to its previously well described role as a transcriptional repressor. Taken together these results demonstrate that foxd3 acts bimodally in the neural crest as a switch from 'permissive' to 'repressive' nucleosome/chromatin organisation to maintain multipotency and define cell fates. Overall design: Examination of RNA seq ATAC seq histone ChIP seq Biotin ChIP seq in wild type and foxd3 mutant context at epib stages and in neural crest cells; single cell RNA seq | pubmed:30513303;pubmed:33111104 | scRNA seq FoxD3 Citrine 89 | GSM2845282 | source name:Citrine reporter expressing cells from 5 6ss embryos|strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | scRNA seq FoxD3 Citrine 89 | ChIP seq Biotin ChIP seq and ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using a enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a Genome build: danRer10 | Citrine reporter expressing cells from 5 6ss embryos | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | GSM2845282 | GSM2845282: scRNA seq FoxD3 Citrine 89; Danio rerio; RNA Seq | GSM2845282 | 1 | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | GEO Accession:GSM2845282 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP124607 | WTCHG_181146_712503_1.fastq.gz | fastq | 340944792.0 | 6685192.0 | GSM2845282 r1 | 0:51 | A:92760608;C:77952704;G:78551893;T:91654628;N:24959 | 51 | 92760608 | 77952704 | 78551893 | 91654628 | 24959 | SRX3374296 | SRS2671526 | SRA629218 | GEO | Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine | 1 | 0.91713 | 0.08973 | 0.91827 | 0.46129 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United Kingdom | 2017-11-08 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 44538 | 44538 | SRR6268127 | SRX3374295 | SRS2671525 | SRP124607 | PRJNA417594 | From pioneer to repressor: Bimodal foxd3 activity dynamically remodels neural crest regulatory landscape in vivo | GSE106676 | Other | The neural crest NC is a transient embryonic stem cell population characterised by its multipotency and broad developmental potential. Here we perform NC specific transcriptional and epigenomic profiling of foxd3 mutant versus wild type cells in vivo to define the gene regulatory circuits controlling NC specification. Together with global binding analysis obtained by foxd3 biotin ChIP and single cell profiles of foxd3 expressing premigratory NC our analysis shows that during early steps of NC formation foxd3 acts globally as a pioneer factor to prime the onset of genes regulating NC specification and migration by re arranging the chromatin landscape opening cis regulatory elements and reshuffling nucleosomes. Strikingly foxd3 then gradually switches from an activator to its previously well described role as a transcriptional repressor. Taken together these results demonstrate that foxd3 acts bimodally in the neural crest as a switch from 'permissive' to 'repressive' nucleosome/chromatin organisation to maintain multipotency and define cell fates. Overall design: Examination of RNA seq ATAC seq histone ChIP seq Biotin ChIP seq in wild type and foxd3 mutant context at epib stages and in neural crest cells; single cell RNA seq | pubmed:30513303;pubmed:33111104 | scRNA seq FoxD3 Citrine 88 | GSM2845281 | source name:Citrine reporter expressing cells from 5 6ss embryos|strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | scRNA seq FoxD3 Citrine 88 | ChIP seq Biotin ChIP seq and ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using a enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a Genome build: danRer10 | Citrine reporter expressing cells from 5 6ss embryos | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | GSM2845281 | GSM2845281: scRNA seq FoxD3 Citrine 88; Danio rerio; RNA Seq | GSM2845281 | 1 | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | GEO Accession:GSM2845281 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP124607 | WTCHG_181146_712502_1.fastq.gz | fastq | 481880232.0 | 9448632.0 | GSM2845281 r1 | 0:51 | A:129714079;C:111689213;G:111987297;T:128454427;N:35216 | 51 | 129714079 | 111689213 | 111987297 | 128454427 | 35216 | SRX3374295 | SRS2671525 | SRA629218 | GEO | Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine | 1 | 0.92043 | 0.08269 | 0.91202 | 0.45298 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United Kingdom | 2017-11-08 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 44539 | 44539 | SRR6268126 | SRX3374294 | SRS2671523 | SRP124607 | PRJNA417594 | From pioneer to repressor: Bimodal foxd3 activity dynamically remodels neural crest regulatory landscape in vivo | GSE106676 | Other | The neural crest NC is a transient embryonic stem cell population characterised by its multipotency and broad developmental potential. Here we perform NC specific transcriptional and epigenomic profiling of foxd3 mutant versus wild type cells in vivo to define the gene regulatory circuits controlling NC specification. Together with global binding analysis obtained by foxd3 biotin ChIP and single cell profiles of foxd3 expressing premigratory NC our analysis shows that during early steps of NC formation foxd3 acts globally as a pioneer factor to prime the onset of genes regulating NC specification and migration by re arranging the chromatin landscape opening cis regulatory elements and reshuffling nucleosomes. Strikingly foxd3 then gradually switches from an activator to its previously well described role as a transcriptional repressor. Taken together these results demonstrate that foxd3 acts bimodally in the neural crest as a switch from 'permissive' to 'repressive' nucleosome/chromatin organisation to maintain multipotency and define cell fates. Overall design: Examination of RNA seq ATAC seq histone ChIP seq Biotin ChIP seq in wild type and foxd3 mutant context at epib stages and in neural crest cells; single cell RNA seq | pubmed:30513303;pubmed:33111104 | scRNA seq FoxD3 Citrine 87 | GSM2845280 | source name:Citrine reporter expressing cells from 5 6ss embryos|strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | scRNA seq FoxD3 Citrine 87 | ChIP seq Biotin ChIP seq and ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using a enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a Genome build: danRer10 | Citrine reporter expressing cells from 5 6ss embryos | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | GSM2845280 | GSM2845280: scRNA seq FoxD3 Citrine 87; Danio rerio; RNA Seq | GSM2845280 | 1 | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | GEO Accession:GSM2845280 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP124607 | WTCHG_181146_712501_1.fastq.gz | fastq | 51076755.0 | 1001505.0 | GSM2845280 r1 | 0:51 | A:14181075;C:11433663;G:11753698;T:13705748;N:2571 | 51 | 14181075 | 11433663 | 11753698 | 13705748 | 2571 | SRX3374294 | SRS2671523 | SRA629218 | GEO | Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine | 1 | 0.74274 | 0.11307 | 0.89063 | 0.53743 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United Kingdom | 2017-11-08 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 44540 | 44540 | SRR6268125 | SRX3374293 | SRS2671531 | SRP124607 | PRJNA417594 | From pioneer to repressor: Bimodal foxd3 activity dynamically remodels neural crest regulatory landscape in vivo | GSE106676 | Other | The neural crest NC is a transient embryonic stem cell population characterised by its multipotency and broad developmental potential. Here we perform NC specific transcriptional and epigenomic profiling of foxd3 mutant versus wild type cells in vivo to define the gene regulatory circuits controlling NC specification. Together with global binding analysis obtained by foxd3 biotin ChIP and single cell profiles of foxd3 expressing premigratory NC our analysis shows that during early steps of NC formation foxd3 acts globally as a pioneer factor to prime the onset of genes regulating NC specification and migration by re arranging the chromatin landscape opening cis regulatory elements and reshuffling nucleosomes. Strikingly foxd3 then gradually switches from an activator to its previously well described role as a transcriptional repressor. Taken together these results demonstrate that foxd3 acts bimodally in the neural crest as a switch from 'permissive' to 'repressive' nucleosome/chromatin organisation to maintain multipotency and define cell fates. Overall design: Examination of RNA seq ATAC seq histone ChIP seq Biotin ChIP seq in wild type and foxd3 mutant context at epib stages and in neural crest cells; single cell RNA seq | pubmed:30513303;pubmed:33111104 | scRNA seq FoxD3 Citrine 86 | GSM2845279 | source name:Citrine reporter expressing cells from 5 6ss embryos|strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | scRNA seq FoxD3 Citrine 86 | ChIP seq Biotin ChIP seq and ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using a enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a Genome build: danRer10 | Citrine reporter expressing cells from 5 6ss embryos | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | GSM2845279 | GSM2845279: scRNA seq FoxD3 Citrine 86; Danio rerio; RNA Seq | GSM2845279 | 1 | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | GEO Accession:GSM2845279 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP124607 | WTCHG_181146_711508_1.fastq.gz | fastq | 278266608.0 | 5456208.0 | GSM2845279 r1 | 0:51 | A:76527843;C:62646934;G:62633363;T:76438032;N:20436 | 51 | 76527843 | 62646934 | 62633363 | 76438032 | 20436 | SRX3374293 | SRS2671531 | SRA629218 | GEO | Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine | 1 | 0.90727 | 0.08952 | 0.9161 | 0.53473 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United Kingdom | 2017-11-08 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 44541 | 44541 | SRR6268124 | SRX3374292 | SRS2671521 | SRP124607 | PRJNA417594 | From pioneer to repressor: Bimodal foxd3 activity dynamically remodels neural crest regulatory landscape in vivo | GSE106676 | Other | The neural crest NC is a transient embryonic stem cell population characterised by its multipotency and broad developmental potential. Here we perform NC specific transcriptional and epigenomic profiling of foxd3 mutant versus wild type cells in vivo to define the gene regulatory circuits controlling NC specification. Together with global binding analysis obtained by foxd3 biotin ChIP and single cell profiles of foxd3 expressing premigratory NC our analysis shows that during early steps of NC formation foxd3 acts globally as a pioneer factor to prime the onset of genes regulating NC specification and migration by re arranging the chromatin landscape opening cis regulatory elements and reshuffling nucleosomes. Strikingly foxd3 then gradually switches from an activator to its previously well described role as a transcriptional repressor. Taken together these results demonstrate that foxd3 acts bimodally in the neural crest as a switch from 'permissive' to 'repressive' nucleosome/chromatin organisation to maintain multipotency and define cell fates. Overall design: Examination of RNA seq ATAC seq histone ChIP seq Biotin ChIP seq in wild type and foxd3 mutant context at epib stages and in neural crest cells; single cell RNA seq | pubmed:30513303;pubmed:33111104 | scRNA seq FoxD3 Citrine 85 | GSM2845278 | source name:Citrine reporter expressing cells from 5 6ss embryos|strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | scRNA seq FoxD3 Citrine 85 | ChIP seq Biotin ChIP seq and ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using a enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a Genome build: danRer10 | Citrine reporter expressing cells from 5 6ss embryos | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | GSM2845278 | GSM2845278: scRNA seq FoxD3 Citrine 85; Danio rerio; RNA Seq | GSM2845278 | 1 | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | GEO Accession:GSM2845278 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP124607 | WTCHG_181146_711507_1.fastq.gz | fastq | 380426850.0 | 7459350.0 | GSM2845278 r1 | 0:51 | A:103962595;C:86240311;G:86672469;T:103522036;N:29439 | 51 | 103962595 | 86240311 | 86672469 | 103522036 | 29439 | SRX3374292 | SRS2671521 | SRA629218 | GEO | Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine | 1 | 0.9159 | 0.08419 | 0.91494 | 0.53438 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United Kingdom | 2017-11-08 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 44542 | 44542 | SRR6268123 | SRX3374291 | SRS2671522 | SRP124607 | PRJNA417594 | From pioneer to repressor: Bimodal foxd3 activity dynamically remodels neural crest regulatory landscape in vivo | GSE106676 | Other | The neural crest NC is a transient embryonic stem cell population characterised by its multipotency and broad developmental potential. Here we perform NC specific transcriptional and epigenomic profiling of foxd3 mutant versus wild type cells in vivo to define the gene regulatory circuits controlling NC specification. Together with global binding analysis obtained by foxd3 biotin ChIP and single cell profiles of foxd3 expressing premigratory NC our analysis shows that during early steps of NC formation foxd3 acts globally as a pioneer factor to prime the onset of genes regulating NC specification and migration by re arranging the chromatin landscape opening cis regulatory elements and reshuffling nucleosomes. Strikingly foxd3 then gradually switches from an activator to its previously well described role as a transcriptional repressor. Taken together these results demonstrate that foxd3 acts bimodally in the neural crest as a switch from 'permissive' to 'repressive' nucleosome/chromatin organisation to maintain multipotency and define cell fates. Overall design: Examination of RNA seq ATAC seq histone ChIP seq Biotin ChIP seq in wild type and foxd3 mutant context at epib stages and in neural crest cells; single cell RNA seq | pubmed:30513303;pubmed:33111104 | scRNA seq FoxD3 Citrine 84 | GSM2845277 | source name:Citrine reporter expressing cells from 5 6ss embryos|strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | scRNA seq FoxD3 Citrine 84 | ChIP seq Biotin ChIP seq and ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using a enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a Genome build: danRer10 | Citrine reporter expressing cells from 5 6ss embryos | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | GSM2845277 | GSM2845277: scRNA seq FoxD3 Citrine 84; Danio rerio; RNA Seq | GSM2845277 | 1 | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | GEO Accession:GSM2845277 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP124607 | WTCHG_181146_711506_1.fastq.gz | fastq | 469180110.0 | 9199610.0 | GSM2845277 r1 | 0:51 | A:127304246;C:107170349;G:107401747;T:127267542;N:36226 | 51 | 127304246 | 107170349 | 107401747 | 127267542 | 36226 | SRX3374291 | SRS2671522 | SRA629218 | GEO | Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine | 1 | 0.90703 | 0.09923 | 0.92324 | 0.52774 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United Kingdom | 2017-11-08 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 44543 | 44543 | SRR6268122 | SRX3374290 | SRS2671520 | SRP124607 | PRJNA417594 | From pioneer to repressor: Bimodal foxd3 activity dynamically remodels neural crest regulatory landscape in vivo | GSE106676 | Other | The neural crest NC is a transient embryonic stem cell population characterised by its multipotency and broad developmental potential. Here we perform NC specific transcriptional and epigenomic profiling of foxd3 mutant versus wild type cells in vivo to define the gene regulatory circuits controlling NC specification. Together with global binding analysis obtained by foxd3 biotin ChIP and single cell profiles of foxd3 expressing premigratory NC our analysis shows that during early steps of NC formation foxd3 acts globally as a pioneer factor to prime the onset of genes regulating NC specification and migration by re arranging the chromatin landscape opening cis regulatory elements and reshuffling nucleosomes. Strikingly foxd3 then gradually switches from an activator to its previously well described role as a transcriptional repressor. Taken together these results demonstrate that foxd3 acts bimodally in the neural crest as a switch from 'permissive' to 'repressive' nucleosome/chromatin organisation to maintain multipotency and define cell fates. Overall design: Examination of RNA seq ATAC seq histone ChIP seq Biotin ChIP seq in wild type and foxd3 mutant context at epib stages and in neural crest cells; single cell RNA seq | pubmed:30513303;pubmed:33111104 | scRNA seq FoxD3 Citrine 83 | GSM2845276 | source name:Citrine reporter expressing cells from 5 6ss embryos|strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | scRNA seq FoxD3 Citrine 83 | ChIP seq Biotin ChIP seq and ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using a enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a Genome build: danRer10 | Citrine reporter expressing cells from 5 6ss embryos | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | GSM2845276 | GSM2845276: scRNA seq FoxD3 Citrine 83; Danio rerio; RNA Seq | GSM2845276 | 1 | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | GEO Accession:GSM2845276 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP124607 | WTCHG_181146_711505_1.fastq.gz | fastq | 407430840.0 | 7988840.0 | GSM2845276 r1 | 0:51 | A:111897559;C:91674110;G:92124542;T:111702724;N:31905 | 51 | 111897559 | 91674110 | 92124542 | 111702724 | 31905 | SRX3374290 | SRS2671520 | SRA629218 | GEO | Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine | 1 | 0.90458 | 0.10613 | 0.89781 | 0.51286 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United Kingdom | 2017-11-08 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 44544 | 44544 | SRR6268121 | SRX3374289 | SRS2671519 | SRP124607 | PRJNA417594 | From pioneer to repressor: Bimodal foxd3 activity dynamically remodels neural crest regulatory landscape in vivo | GSE106676 | Other | The neural crest NC is a transient embryonic stem cell population characterised by its multipotency and broad developmental potential. Here we perform NC specific transcriptional and epigenomic profiling of foxd3 mutant versus wild type cells in vivo to define the gene regulatory circuits controlling NC specification. Together with global binding analysis obtained by foxd3 biotin ChIP and single cell profiles of foxd3 expressing premigratory NC our analysis shows that during early steps of NC formation foxd3 acts globally as a pioneer factor to prime the onset of genes regulating NC specification and migration by re arranging the chromatin landscape opening cis regulatory elements and reshuffling nucleosomes. Strikingly foxd3 then gradually switches from an activator to its previously well described role as a transcriptional repressor. Taken together these results demonstrate that foxd3 acts bimodally in the neural crest as a switch from 'permissive' to 'repressive' nucleosome/chromatin organisation to maintain multipotency and define cell fates. Overall design: Examination of RNA seq ATAC seq histone ChIP seq Biotin ChIP seq in wild type and foxd3 mutant context at epib stages and in neural crest cells; single cell RNA seq | pubmed:30513303;pubmed:33111104 | scRNA seq FoxD3 Citrine 82 | GSM2845275 | source name:Citrine reporter expressing cells from 5 6ss embryos|strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | scRNA seq FoxD3 Citrine 82 | ChIP seq Biotin ChIP seq and ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using a enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a Genome build: danRer10 | Citrine reporter expressing cells from 5 6ss embryos | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | GSM2845275 | GSM2845275: scRNA seq FoxD3 Citrine 82; Danio rerio; RNA Seq | GSM2845275 | 1 | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | GEO Accession:GSM2845275 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP124607 | WTCHG_181146_711504_1.fastq.gz | fastq | 292691958.0 | 5739058.0 | GSM2845275 r1 | 0:51 | A:79933439;C:66058945;G:66660414;T:80016736;N:22424 | 51 | 79933439 | 66058945 | 66660414 | 80016736 | 22424 | SRX3374289 | SRS2671519 | SRA629218 | GEO | Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine | 1 | 0.89655 | 0.09512 | 0.88988 | 0.52865 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United Kingdom | 2017-11-08 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 44545 | 44545 | SRR6268120 | SRX3374288 | SRS2671518 | SRP124607 | PRJNA417594 | From pioneer to repressor: Bimodal foxd3 activity dynamically remodels neural crest regulatory landscape in vivo | GSE106676 | Other | The neural crest NC is a transient embryonic stem cell population characterised by its multipotency and broad developmental potential. Here we perform NC specific transcriptional and epigenomic profiling of foxd3 mutant versus wild type cells in vivo to define the gene regulatory circuits controlling NC specification. Together with global binding analysis obtained by foxd3 biotin ChIP and single cell profiles of foxd3 expressing premigratory NC our analysis shows that during early steps of NC formation foxd3 acts globally as a pioneer factor to prime the onset of genes regulating NC specification and migration by re arranging the chromatin landscape opening cis regulatory elements and reshuffling nucleosomes. Strikingly foxd3 then gradually switches from an activator to its previously well described role as a transcriptional repressor. Taken together these results demonstrate that foxd3 acts bimodally in the neural crest as a switch from 'permissive' to 'repressive' nucleosome/chromatin organisation to maintain multipotency and define cell fates. Overall design: Examination of RNA seq ATAC seq histone ChIP seq Biotin ChIP seq in wild type and foxd3 mutant context at epib stages and in neural crest cells; single cell RNA seq | pubmed:30513303;pubmed:33111104 | scRNA seq FoxD3 Citrine 81 | GSM2845274 | source name:Citrine reporter expressing cells from 5 6ss embryos|strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | scRNA seq FoxD3 Citrine 81 | ChIP seq Biotin ChIP seq and ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using a enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a Genome build: danRer10 | Citrine reporter expressing cells from 5 6ss embryos | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | GSM2845274 | GSM2845274: scRNA seq FoxD3 Citrine 81; Danio rerio; RNA Seq | GSM2845274 | 1 | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | GEO Accession:GSM2845274 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP124607 | WTCHG_181146_711503_1.fastq.gz | fastq | 249862056.0 | 4899256.0 | GSM2845274 r1 | 0:51 | A:68339732;C:56591015;G:56865573;T:68046620;N:19116 | 51 | 68339732 | 56591015 | 56865573 | 68046620 | 19116 | SRX3374288 | SRS2671518 | SRA629218 | GEO | Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine | 1 | 0.9111 | 0.08745 | 0.90453 | 0.53032 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United Kingdom | 2017-11-08 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 44546 | 44546 | SRR6268119 | SRX3374287 | SRS2671517 | SRP124607 | PRJNA417594 | From pioneer to repressor: Bimodal foxd3 activity dynamically remodels neural crest regulatory landscape in vivo | GSE106676 | Other | The neural crest NC is a transient embryonic stem cell population characterised by its multipotency and broad developmental potential. Here we perform NC specific transcriptional and epigenomic profiling of foxd3 mutant versus wild type cells in vivo to define the gene regulatory circuits controlling NC specification. Together with global binding analysis obtained by foxd3 biotin ChIP and single cell profiles of foxd3 expressing premigratory NC our analysis shows that during early steps of NC formation foxd3 acts globally as a pioneer factor to prime the onset of genes regulating NC specification and migration by re arranging the chromatin landscape opening cis regulatory elements and reshuffling nucleosomes. Strikingly foxd3 then gradually switches from an activator to its previously well described role as a transcriptional repressor. Taken together these results demonstrate that foxd3 acts bimodally in the neural crest as a switch from 'permissive' to 'repressive' nucleosome/chromatin organisation to maintain multipotency and define cell fates. Overall design: Examination of RNA seq ATAC seq histone ChIP seq Biotin ChIP seq in wild type and foxd3 mutant context at epib stages and in neural crest cells; single cell RNA seq | pubmed:30513303;pubmed:33111104 | scRNA seq FoxD3 Citrine 80 | GSM2845273 | source name:Citrine reporter expressing cells from 5 6ss embryos|strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | scRNA seq FoxD3 Citrine 80 | ChIP seq Biotin ChIP seq and ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using a enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a Genome build: danRer10 | Citrine reporter expressing cells from 5 6ss embryos | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | GSM2845273 | GSM2845273: scRNA seq FoxD3 Citrine 80; Danio rerio; RNA Seq | GSM2845273 | 1 | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | GEO Accession:GSM2845273 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP124607 | WTCHG_181146_711502_1.fastq.gz | fastq | 126336792.0 | 2477192.0 | GSM2845273 r1 | 0:51 | A:35151335;C:28434505;G:28697836;T:34046012;N:7104 | 51 | 35151335 | 28434505 | 28697836 | 34046012 | 7104 | SRX3374287 | SRS2671517 | SRA629218 | GEO | Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine | 1 | 0.90513 | 0.09864 | 0.89284 | 0.52754 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United Kingdom | 2017-11-08 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 44547 | 44547 | SRR6268118 | SRX3374286 | SRS2671509 | SRP124607 | PRJNA417594 | From pioneer to repressor: Bimodal foxd3 activity dynamically remodels neural crest regulatory landscape in vivo | GSE106676 | Other | The neural crest NC is a transient embryonic stem cell population characterised by its multipotency and broad developmental potential. Here we perform NC specific transcriptional and epigenomic profiling of foxd3 mutant versus wild type cells in vivo to define the gene regulatory circuits controlling NC specification. Together with global binding analysis obtained by foxd3 biotin ChIP and single cell profiles of foxd3 expressing premigratory NC our analysis shows that during early steps of NC formation foxd3 acts globally as a pioneer factor to prime the onset of genes regulating NC specification and migration by re arranging the chromatin landscape opening cis regulatory elements and reshuffling nucleosomes. Strikingly foxd3 then gradually switches from an activator to its previously well described role as a transcriptional repressor. Taken together these results demonstrate that foxd3 acts bimodally in the neural crest as a switch from 'permissive' to 'repressive' nucleosome/chromatin organisation to maintain multipotency and define cell fates. Overall design: Examination of RNA seq ATAC seq histone ChIP seq Biotin ChIP seq in wild type and foxd3 mutant context at epib stages and in neural crest cells; single cell RNA seq | pubmed:30513303;pubmed:33111104 | scRNA seq FoxD3 Citrine 79 | GSM2845272 | source name:Citrine reporter expressing cells from 5 6ss embryos|strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | scRNA seq FoxD3 Citrine 79 | ChIP seq Biotin ChIP seq and ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using a enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a Genome build: danRer10 | Citrine reporter expressing cells from 5 6ss embryos | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | GSM2845272 | GSM2845272: scRNA seq FoxD3 Citrine 79; Danio rerio; RNA Seq | GSM2845272 | 1 | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | GEO Accession:GSM2845272 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP124607 | WTCHG_181146_711501_1.fastq.gz | fastq | 139757238.0 | 2740338.0 | GSM2845272 r1 | 0:51 | A:38416038;C:31642037;G:31820150;T:37869615;N:9398 | 51 | 38416038 | 31642037 | 31820150 | 37869615 | 9398 | SRX3374286 | SRS2671509 | SRA629218 | GEO | Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine | 1 | 0.9155 | 0.09523 | 0.91664 | 0.52646 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United Kingdom | 2017-11-08 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 44548 | 44548 | SRR6268117 | SRX3374285 | SRS2671513 | SRP124607 | PRJNA417594 | From pioneer to repressor: Bimodal foxd3 activity dynamically remodels neural crest regulatory landscape in vivo | GSE106676 | Other | The neural crest NC is a transient embryonic stem cell population characterised by its multipotency and broad developmental potential. Here we perform NC specific transcriptional and epigenomic profiling of foxd3 mutant versus wild type cells in vivo to define the gene regulatory circuits controlling NC specification. Together with global binding analysis obtained by foxd3 biotin ChIP and single cell profiles of foxd3 expressing premigratory NC our analysis shows that during early steps of NC formation foxd3 acts globally as a pioneer factor to prime the onset of genes regulating NC specification and migration by re arranging the chromatin landscape opening cis regulatory elements and reshuffling nucleosomes. Strikingly foxd3 then gradually switches from an activator to its previously well described role as a transcriptional repressor. Taken together these results demonstrate that foxd3 acts bimodally in the neural crest as a switch from 'permissive' to 'repressive' nucleosome/chromatin organisation to maintain multipotency and define cell fates. Overall design: Examination of RNA seq ATAC seq histone ChIP seq Biotin ChIP seq in wild type and foxd3 mutant context at epib stages and in neural crest cells; single cell RNA seq | pubmed:30513303;pubmed:33111104 | scRNA seq FoxD3 Citrine 78 | GSM2845271 | source name:Citrine reporter expressing cells from 5 6ss embryos|strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | scRNA seq FoxD3 Citrine 78 | ChIP seq Biotin ChIP seq and ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using a enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a Genome build: danRer10 | Citrine reporter expressing cells from 5 6ss embryos | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | GSM2845271 | GSM2845271: scRNA seq FoxD3 Citrine 78; Danio rerio; RNA Seq | GSM2845271 | 1 | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | GEO Accession:GSM2845271 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP124607 | WTCHG_181146_710508_1.fastq.gz | fastq | 88464039.0 | 1734589.0 | GSM2845271 r1 | 0:51 | A:25246058;C:19455878;G:19527692;T:24229580;N:4831 | 51 | 25246058 | 19455878 | 19527692 | 24229580 | 4831 | SRX3374285 | SRS2671513 | SRA629218 | GEO | Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine | 1 | 0.90997 | 0.09874 | 0.91104 | 0.53966 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United Kingdom | 2017-11-08 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 44549 | 44549 | SRR6268116 | SRX3374284 | SRS2671514 | SRP124607 | PRJNA417594 | From pioneer to repressor: Bimodal foxd3 activity dynamically remodels neural crest regulatory landscape in vivo | GSE106676 | Other | The neural crest NC is a transient embryonic stem cell population characterised by its multipotency and broad developmental potential. Here we perform NC specific transcriptional and epigenomic profiling of foxd3 mutant versus wild type cells in vivo to define the gene regulatory circuits controlling NC specification. Together with global binding analysis obtained by foxd3 biotin ChIP and single cell profiles of foxd3 expressing premigratory NC our analysis shows that during early steps of NC formation foxd3 acts globally as a pioneer factor to prime the onset of genes regulating NC specification and migration by re arranging the chromatin landscape opening cis regulatory elements and reshuffling nucleosomes. Strikingly foxd3 then gradually switches from an activator to its previously well described role as a transcriptional repressor. Taken together these results demonstrate that foxd3 acts bimodally in the neural crest as a switch from 'permissive' to 'repressive' nucleosome/chromatin organisation to maintain multipotency and define cell fates. Overall design: Examination of RNA seq ATAC seq histone ChIP seq Biotin ChIP seq in wild type and foxd3 mutant context at epib stages and in neural crest cells; single cell RNA seq | pubmed:30513303;pubmed:33111104 | scRNA seq FoxD3 Citrine 77 | GSM2845270 | source name:Citrine reporter expressing cells from 5 6ss embryos|strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | scRNA seq FoxD3 Citrine 77 | ChIP seq Biotin ChIP seq and ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using a enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a Genome build: danRer10 | Citrine reporter expressing cells from 5 6ss embryos | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | GSM2845270 | GSM2845270: scRNA seq FoxD3 Citrine 77; Danio rerio; RNA Seq | GSM2845270 | 1 | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | GEO Accession:GSM2845270 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP124607 | WTCHG_181146_710507_1.fastq.gz | fastq | 249948450.0 | 4900950.0 | GSM2845270 r1 | 0:51 | A:68796982;C:56175193;G:56407660;T:68549667;N:18948 | 51 | 68796982 | 56175193 | 56407660 | 68549667 | 18948 | SRX3374284 | SRS2671514 | SRA629218 | GEO | Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine | 1 | 0.91194 | 0.0982 | 0.90457 | 0.55055 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United Kingdom | 2017-11-08 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 44550 | 44550 | SRR6268115 | SRX3374283 | SRS2671508 | SRP124607 | PRJNA417594 | From pioneer to repressor: Bimodal foxd3 activity dynamically remodels neural crest regulatory landscape in vivo | GSE106676 | Other | The neural crest NC is a transient embryonic stem cell population characterised by its multipotency and broad developmental potential. Here we perform NC specific transcriptional and epigenomic profiling of foxd3 mutant versus wild type cells in vivo to define the gene regulatory circuits controlling NC specification. Together with global binding analysis obtained by foxd3 biotin ChIP and single cell profiles of foxd3 expressing premigratory NC our analysis shows that during early steps of NC formation foxd3 acts globally as a pioneer factor to prime the onset of genes regulating NC specification and migration by re arranging the chromatin landscape opening cis regulatory elements and reshuffling nucleosomes. Strikingly foxd3 then gradually switches from an activator to its previously well described role as a transcriptional repressor. Taken together these results demonstrate that foxd3 acts bimodally in the neural crest as a switch from 'permissive' to 'repressive' nucleosome/chromatin organisation to maintain multipotency and define cell fates. Overall design: Examination of RNA seq ATAC seq histone ChIP seq Biotin ChIP seq in wild type and foxd3 mutant context at epib stages and in neural crest cells; single cell RNA seq | pubmed:30513303;pubmed:33111104 | scRNA seq FoxD3 Citrine 76 | GSM2845269 | source name:Citrine reporter expressing cells from 5 6ss embryos|strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | scRNA seq FoxD3 Citrine 76 | ChIP seq Biotin ChIP seq and ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using a enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a Genome build: danRer10 | Citrine reporter expressing cells from 5 6ss embryos | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | GSM2845269 | GSM2845269: scRNA seq FoxD3 Citrine 76; Danio rerio; RNA Seq | GSM2845269 | 1 | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | GEO Accession:GSM2845269 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP124607 | WTCHG_181146_710506_1.fastq.gz | fastq | 286498620.0 | 5617620.0 | GSM2845269 r1 | 0:51 | A:78660657;C:64542467;G:64890981;T:78382670;N:21845 | 51 | 78660657 | 64542467 | 64890981 | 78382670 | 21845 | SRX3374283 | SRS2671508 | SRA629218 | GEO | Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine | 1 | 0.91215 | 0.10143 | 0.91114 | 0.53101 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United Kingdom | 2017-11-08 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 44551 | 44551 | SRR6268114 | SRX3374282 | SRS2671507 | SRP124607 | PRJNA417594 | From pioneer to repressor: Bimodal foxd3 activity dynamically remodels neural crest regulatory landscape in vivo | GSE106676 | Other | The neural crest NC is a transient embryonic stem cell population characterised by its multipotency and broad developmental potential. Here we perform NC specific transcriptional and epigenomic profiling of foxd3 mutant versus wild type cells in vivo to define the gene regulatory circuits controlling NC specification. Together with global binding analysis obtained by foxd3 biotin ChIP and single cell profiles of foxd3 expressing premigratory NC our analysis shows that during early steps of NC formation foxd3 acts globally as a pioneer factor to prime the onset of genes regulating NC specification and migration by re arranging the chromatin landscape opening cis regulatory elements and reshuffling nucleosomes. Strikingly foxd3 then gradually switches from an activator to its previously well described role as a transcriptional repressor. Taken together these results demonstrate that foxd3 acts bimodally in the neural crest as a switch from 'permissive' to 'repressive' nucleosome/chromatin organisation to maintain multipotency and define cell fates. Overall design: Examination of RNA seq ATAC seq histone ChIP seq Biotin ChIP seq in wild type and foxd3 mutant context at epib stages and in neural crest cells; single cell RNA seq | pubmed:30513303;pubmed:33111104 | scRNA seq FoxD3 Citrine 75 | GSM2845268 | source name:Citrine reporter expressing cells from 5 6ss embryos|strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | scRNA seq FoxD3 Citrine 75 | ChIP seq Biotin ChIP seq and ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using a enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a Genome build: danRer10 | Citrine reporter expressing cells from 5 6ss embryos | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | GSM2845268 | GSM2845268: scRNA seq FoxD3 Citrine 75; Danio rerio; RNA Seq | GSM2845268 | 1 | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | GEO Accession:GSM2845268 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP124607 | WTCHG_181146_710505_1.fastq.gz | fastq | 220107891.0 | 4315841.0 | GSM2845268 r1 | 0:51 | A:60813293;C:49223907;G:49470991;T:60582696;N:17004 | 51 | 60813293 | 49223907 | 49470991 | 60582696 | 17004 | SRX3374282 | SRS2671507 | SRA629218 | GEO | Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine | 1 | 0.90881 | 0.10119 | 0.86454 | 0.5453 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United Kingdom | 2017-11-08 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 44552 | 44552 | SRR6268113 | SRX3374281 | SRS2671512 | SRP124607 | PRJNA417594 | From pioneer to repressor: Bimodal foxd3 activity dynamically remodels neural crest regulatory landscape in vivo | GSE106676 | Other | The neural crest NC is a transient embryonic stem cell population characterised by its multipotency and broad developmental potential. Here we perform NC specific transcriptional and epigenomic profiling of foxd3 mutant versus wild type cells in vivo to define the gene regulatory circuits controlling NC specification. Together with global binding analysis obtained by foxd3 biotin ChIP and single cell profiles of foxd3 expressing premigratory NC our analysis shows that during early steps of NC formation foxd3 acts globally as a pioneer factor to prime the onset of genes regulating NC specification and migration by re arranging the chromatin landscape opening cis regulatory elements and reshuffling nucleosomes. Strikingly foxd3 then gradually switches from an activator to its previously well described role as a transcriptional repressor. Taken together these results demonstrate that foxd3 acts bimodally in the neural crest as a switch from 'permissive' to 'repressive' nucleosome/chromatin organisation to maintain multipotency and define cell fates. Overall design: Examination of RNA seq ATAC seq histone ChIP seq Biotin ChIP seq in wild type and foxd3 mutant context at epib stages and in neural crest cells; single cell RNA seq | pubmed:30513303;pubmed:33111104 | scRNA seq FoxD3 Citrine 74 | GSM2845267 | source name:Citrine reporter expressing cells from 5 6ss embryos|strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | scRNA seq FoxD3 Citrine 74 | ChIP seq Biotin ChIP seq and ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using a enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a Genome build: danRer10 | Citrine reporter expressing cells from 5 6ss embryos | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | GSM2845267 | GSM2845267: scRNA seq FoxD3 Citrine 74; Danio rerio; RNA Seq | GSM2845267 | 1 | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | GEO Accession:GSM2845267 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP124607 | WTCHG_181146_710504_1.fastq.gz | fastq | 410318001.0 | 8045451.0 | GSM2845267 r1 | 0:51 | A:113266313;C:91458650;G:92326377;T:113234835;N:31826 | 51 | 113266313 | 91458650 | 92326377 | 113234835 | 31826 | SRX3374281 | SRS2671512 | SRA629218 | GEO | Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine | 1 | 0.9076 | 0.106 | 0.91812 | 0.55673 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United Kingdom | 2017-11-08 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 44553 | 44553 | SRR6268112 | SRX3374280 | SRS2671510 | SRP124607 | PRJNA417594 | From pioneer to repressor: Bimodal foxd3 activity dynamically remodels neural crest regulatory landscape in vivo | GSE106676 | Other | The neural crest NC is a transient embryonic stem cell population characterised by its multipotency and broad developmental potential. Here we perform NC specific transcriptional and epigenomic profiling of foxd3 mutant versus wild type cells in vivo to define the gene regulatory circuits controlling NC specification. Together with global binding analysis obtained by foxd3 biotin ChIP and single cell profiles of foxd3 expressing premigratory NC our analysis shows that during early steps of NC formation foxd3 acts globally as a pioneer factor to prime the onset of genes regulating NC specification and migration by re arranging the chromatin landscape opening cis regulatory elements and reshuffling nucleosomes. Strikingly foxd3 then gradually switches from an activator to its previously well described role as a transcriptional repressor. Taken together these results demonstrate that foxd3 acts bimodally in the neural crest as a switch from 'permissive' to 'repressive' nucleosome/chromatin organisation to maintain multipotency and define cell fates. Overall design: Examination of RNA seq ATAC seq histone ChIP seq Biotin ChIP seq in wild type and foxd3 mutant context at epib stages and in neural crest cells; single cell RNA seq | pubmed:30513303;pubmed:33111104 | scRNA seq FoxD3 Citrine 73 | GSM2845266 | source name:Citrine reporter expressing cells from 5 6ss embryos|strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | scRNA seq FoxD3 Citrine 73 | ChIP seq Biotin ChIP seq and ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using a enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a Genome build: danRer10 | Citrine reporter expressing cells from 5 6ss embryos | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | GSM2845266 | GSM2845266: scRNA seq FoxD3 Citrine 73; Danio rerio; RNA Seq | GSM2845266 | 1 | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | GEO Accession:GSM2845266 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP124607 | WTCHG_181146_710503_1.fastq.gz | fastq | 239791086.0 | 4701786.0 | GSM2845266 r1 | 0:51 | A:65972651;C:54248777;G:54595964;T:64957388;N:16306 | 51 | 65972651 | 54248777 | 54595964 | 64957388 | 16306 | SRX3374280 | SRS2671510 | SRA629218 | GEO | Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine | 1 | 0.91439 | 0.10233 | 0.91196 | 0.52865 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United Kingdom | 2017-11-08 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 44554 | 44554 | SRR6268111 | SRX3374279 | SRS2671504 | SRP124607 | PRJNA417594 | From pioneer to repressor: Bimodal foxd3 activity dynamically remodels neural crest regulatory landscape in vivo | GSE106676 | Other | The neural crest NC is a transient embryonic stem cell population characterised by its multipotency and broad developmental potential. Here we perform NC specific transcriptional and epigenomic profiling of foxd3 mutant versus wild type cells in vivo to define the gene regulatory circuits controlling NC specification. Together with global binding analysis obtained by foxd3 biotin ChIP and single cell profiles of foxd3 expressing premigratory NC our analysis shows that during early steps of NC formation foxd3 acts globally as a pioneer factor to prime the onset of genes regulating NC specification and migration by re arranging the chromatin landscape opening cis regulatory elements and reshuffling nucleosomes. Strikingly foxd3 then gradually switches from an activator to its previously well described role as a transcriptional repressor. Taken together these results demonstrate that foxd3 acts bimodally in the neural crest as a switch from 'permissive' to 'repressive' nucleosome/chromatin organisation to maintain multipotency and define cell fates. Overall design: Examination of RNA seq ATAC seq histone ChIP seq Biotin ChIP seq in wild type and foxd3 mutant context at epib stages and in neural crest cells; single cell RNA seq | pubmed:30513303;pubmed:33111104 | scRNA seq FoxD3 Citrine 72 | GSM2845265 | source name:Citrine reporter expressing cells from 5 6ss embryos|strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | scRNA seq FoxD3 Citrine 72 | ChIP seq Biotin ChIP seq and ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using a enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a Genome build: danRer10 | Citrine reporter expressing cells from 5 6ss embryos | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | GSM2845265 | GSM2845265: scRNA seq FoxD3 Citrine 72; Danio rerio; RNA Seq | GSM2845265 | 1 | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | GEO Accession:GSM2845265 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP124607 | WTCHG_181146_710502_1.fastq.gz | fastq | 98577951.0 | 1932901.0 | GSM2845265 r1 | 0:51 | A:27897528;C:22079855;G:22119530;T:26475809;N:5229 | 51 | 27897528 | 22079855 | 22119530 | 26475809 | 5229 | SRX3374279 | SRS2671504 | SRA629218 | GEO | Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine | 1 | 0.91666 | 0.09141 | 0.87744 | 0.526 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United Kingdom | 2017-11-08 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 44555 | 44555 | SRR6268110 | SRX3374278 | SRS2671511 | SRP124607 | PRJNA417594 | From pioneer to repressor: Bimodal foxd3 activity dynamically remodels neural crest regulatory landscape in vivo | GSE106676 | Other | The neural crest NC is a transient embryonic stem cell population characterised by its multipotency and broad developmental potential. Here we perform NC specific transcriptional and epigenomic profiling of foxd3 mutant versus wild type cells in vivo to define the gene regulatory circuits controlling NC specification. Together with global binding analysis obtained by foxd3 biotin ChIP and single cell profiles of foxd3 expressing premigratory NC our analysis shows that during early steps of NC formation foxd3 acts globally as a pioneer factor to prime the onset of genes regulating NC specification and migration by re arranging the chromatin landscape opening cis regulatory elements and reshuffling nucleosomes. Strikingly foxd3 then gradually switches from an activator to its previously well described role as a transcriptional repressor. Taken together these results demonstrate that foxd3 acts bimodally in the neural crest as a switch from 'permissive' to 'repressive' nucleosome/chromatin organisation to maintain multipotency and define cell fates. Overall design: Examination of RNA seq ATAC seq histone ChIP seq Biotin ChIP seq in wild type and foxd3 mutant context at epib stages and in neural crest cells; single cell RNA seq | pubmed:30513303;pubmed:33111104 | scRNA seq FoxD3 Citrine 71 | GSM2845264 | source name:Citrine reporter expressing cells from 5 6ss embryos|strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | scRNA seq FoxD3 Citrine 71 | ChIP seq Biotin ChIP seq and ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using a enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a Genome build: danRer10 | Citrine reporter expressing cells from 5 6ss embryos | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | GSM2845264 | GSM2845264: scRNA seq FoxD3 Citrine 71; Danio rerio; RNA Seq | GSM2845264 | 1 | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | GEO Accession:GSM2845264 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP124607 | WTCHG_181146_710501_1.fastq.gz | fastq | 104116092.0 | 2041492.0 | GSM2845264 r1 | 0:51 | A:29273164;C:23449432;G:23432296;T:27955577;N:5623 | 51 | 29273164 | 23449432 | 23432296 | 27955577 | 5623 | SRX3374278 | SRS2671511 | SRA629218 | GEO | Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine | 1 | 0.91791 | 0.08055 | 0.90049 | 0.52781 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United Kingdom | 2017-11-08 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 44556 | 44556 | SRR6268109 | SRX3374277 | SRS2671506 | SRP124607 | PRJNA417594 | From pioneer to repressor: Bimodal foxd3 activity dynamically remodels neural crest regulatory landscape in vivo | GSE106676 | Other | The neural crest NC is a transient embryonic stem cell population characterised by its multipotency and broad developmental potential. Here we perform NC specific transcriptional and epigenomic profiling of foxd3 mutant versus wild type cells in vivo to define the gene regulatory circuits controlling NC specification. Together with global binding analysis obtained by foxd3 biotin ChIP and single cell profiles of foxd3 expressing premigratory NC our analysis shows that during early steps of NC formation foxd3 acts globally as a pioneer factor to prime the onset of genes regulating NC specification and migration by re arranging the chromatin landscape opening cis regulatory elements and reshuffling nucleosomes. Strikingly foxd3 then gradually switches from an activator to its previously well described role as a transcriptional repressor. Taken together these results demonstrate that foxd3 acts bimodally in the neural crest as a switch from 'permissive' to 'repressive' nucleosome/chromatin organisation to maintain multipotency and define cell fates. Overall design: Examination of RNA seq ATAC seq histone ChIP seq Biotin ChIP seq in wild type and foxd3 mutant context at epib stages and in neural crest cells; single cell RNA seq | pubmed:30513303;pubmed:33111104 | scRNA seq FoxD3 Citrine 70 | GSM2845263 | source name:Citrine reporter expressing cells from 5 6ss embryos|strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | scRNA seq FoxD3 Citrine 70 | ChIP seq Biotin ChIP seq and ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using a enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a Genome build: danRer10 | Citrine reporter expressing cells from 5 6ss embryos | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | GSM2845263 | GSM2845263: scRNA seq FoxD3 Citrine 70; Danio rerio; RNA Seq | GSM2845263 | 1 | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | GEO Accession:GSM2845263 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP124607 | WTCHG_181146_709508_1.fastq.gz | fastq | 361019667.0 | 7078817.0 | GSM2845263 r1 | 0:51 | A:98313793;C:82125745;G:82186304;T:98365964;N:27861 | 51 | 98313793 | 82125745 | 82186304 | 98365964 | 27861 | SRX3374277 | SRS2671506 | SRA629218 | GEO | Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine | 1 | 0.90777 | 0.0911 | 0.92007 | 0.51572 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United Kingdom | 2017-11-08 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 44557 | 44557 | SRR6268108 | SRX3374276 | SRS2671502 | SRP124607 | PRJNA417594 | From pioneer to repressor: Bimodal foxd3 activity dynamically remodels neural crest regulatory landscape in vivo | GSE106676 | Other | The neural crest NC is a transient embryonic stem cell population characterised by its multipotency and broad developmental potential. Here we perform NC specific transcriptional and epigenomic profiling of foxd3 mutant versus wild type cells in vivo to define the gene regulatory circuits controlling NC specification. Together with global binding analysis obtained by foxd3 biotin ChIP and single cell profiles of foxd3 expressing premigratory NC our analysis shows that during early steps of NC formation foxd3 acts globally as a pioneer factor to prime the onset of genes regulating NC specification and migration by re arranging the chromatin landscape opening cis regulatory elements and reshuffling nucleosomes. Strikingly foxd3 then gradually switches from an activator to its previously well described role as a transcriptional repressor. Taken together these results demonstrate that foxd3 acts bimodally in the neural crest as a switch from 'permissive' to 'repressive' nucleosome/chromatin organisation to maintain multipotency and define cell fates. Overall design: Examination of RNA seq ATAC seq histone ChIP seq Biotin ChIP seq in wild type and foxd3 mutant context at epib stages and in neural crest cells; single cell RNA seq | pubmed:30513303;pubmed:33111104 | scRNA seq FoxD3 Citrine 69 | GSM2845262 | source name:Citrine reporter expressing cells from 5 6ss embryos|strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | scRNA seq FoxD3 Citrine 69 | ChIP seq Biotin ChIP seq and ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using a enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a Genome build: danRer10 | Citrine reporter expressing cells from 5 6ss embryos | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | GSM2845262 | GSM2845262: scRNA seq FoxD3 Citrine 69; Danio rerio; RNA Seq | GSM2845262 | 1 | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | GEO Accession:GSM2845262 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP124607 | WTCHG_181146_709507_1.fastq.gz | fastq | 359840394.0 | 7055694.0 | GSM2845262 r1 | 0:51 | A:98199050;C:81680050;G:81754203;T:98179117;N:27974 | 51 | 98199050 | 81680050 | 81754203 | 98179117 | 27974 | SRX3374276 | SRS2671502 | SRA629218 | GEO | Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine | 1 | 0.9096 | 0.09246 | 0.90883 | 0.53308 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United Kingdom | 2017-11-08 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 44558 | 44558 | SRR6268107 | SRX3374275 | SRS2671503 | SRP124607 | PRJNA417594 | From pioneer to repressor: Bimodal foxd3 activity dynamically remodels neural crest regulatory landscape in vivo | GSE106676 | Other | The neural crest NC is a transient embryonic stem cell population characterised by its multipotency and broad developmental potential. Here we perform NC specific transcriptional and epigenomic profiling of foxd3 mutant versus wild type cells in vivo to define the gene regulatory circuits controlling NC specification. Together with global binding analysis obtained by foxd3 biotin ChIP and single cell profiles of foxd3 expressing premigratory NC our analysis shows that during early steps of NC formation foxd3 acts globally as a pioneer factor to prime the onset of genes regulating NC specification and migration by re arranging the chromatin landscape opening cis regulatory elements and reshuffling nucleosomes. Strikingly foxd3 then gradually switches from an activator to its previously well described role as a transcriptional repressor. Taken together these results demonstrate that foxd3 acts bimodally in the neural crest as a switch from 'permissive' to 'repressive' nucleosome/chromatin organisation to maintain multipotency and define cell fates. Overall design: Examination of RNA seq ATAC seq histone ChIP seq Biotin ChIP seq in wild type and foxd3 mutant context at epib stages and in neural crest cells; single cell RNA seq | pubmed:30513303;pubmed:33111104 | scRNA seq FoxD3 Citrine 68 | GSM2845261 | source name:Citrine reporter expressing cells from 5 6ss embryos|strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | scRNA seq FoxD3 Citrine 68 | ChIP seq Biotin ChIP seq and ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using a enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a Genome build: danRer10 | Citrine reporter expressing cells from 5 6ss embryos | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | GSM2845261 | GSM2845261: scRNA seq FoxD3 Citrine 68; Danio rerio; RNA Seq | GSM2845261 | 1 | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | GEO Accession:GSM2845261 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP124607 | WTCHG_181146_709506_1.fastq.gz | fastq | 392925216.0 | 7704416.0 | GSM2845261 r1 | 0:51 | A:107316599;C:89108321;G:89155093;T:107314510;N:30693 | 51 | 107316599 | 89108321 | 89155093 | 107314510 | 30693 | SRX3374275 | SRS2671503 | SRA629218 | GEO | Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine | 1 | 0.90666 | 0.0822 | 0.90293 | 0.53946 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United Kingdom | 2017-11-08 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 44559 | 44559 | SRR6268106 | SRX3374274 | SRS2671505 | SRP124607 | PRJNA417594 | From pioneer to repressor: Bimodal foxd3 activity dynamically remodels neural crest regulatory landscape in vivo | GSE106676 | Other | The neural crest NC is a transient embryonic stem cell population characterised by its multipotency and broad developmental potential. Here we perform NC specific transcriptional and epigenomic profiling of foxd3 mutant versus wild type cells in vivo to define the gene regulatory circuits controlling NC specification. Together with global binding analysis obtained by foxd3 biotin ChIP and single cell profiles of foxd3 expressing premigratory NC our analysis shows that during early steps of NC formation foxd3 acts globally as a pioneer factor to prime the onset of genes regulating NC specification and migration by re arranging the chromatin landscape opening cis regulatory elements and reshuffling nucleosomes. Strikingly foxd3 then gradually switches from an activator to its previously well described role as a transcriptional repressor. Taken together these results demonstrate that foxd3 acts bimodally in the neural crest as a switch from 'permissive' to 'repressive' nucleosome/chromatin organisation to maintain multipotency and define cell fates. Overall design: Examination of RNA seq ATAC seq histone ChIP seq Biotin ChIP seq in wild type and foxd3 mutant context at epib stages and in neural crest cells; single cell RNA seq | pubmed:30513303;pubmed:33111104 | scRNA seq FoxD3 Citrine 67 | GSM2845260 | source name:Citrine reporter expressing cells from 5 6ss embryos|strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | scRNA seq FoxD3 Citrine 67 | ChIP seq Biotin ChIP seq and ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using a enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a Genome build: danRer10 | Citrine reporter expressing cells from 5 6ss embryos | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | GSM2845260 | GSM2845260: scRNA seq FoxD3 Citrine 67; Danio rerio; RNA Seq | GSM2845260 | 1 | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | GEO Accession:GSM2845260 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP124607 | WTCHG_181146_709505_1.fastq.gz | fastq | 296749977.0 | 5818627.0 | GSM2845260 r1 | 0:51 | A:81063560;C:67242975;G:67362189;T:81058379;N:22874 | 51 | 81063560 | 67242975 | 67362189 | 81058379 | 22874 | SRX3374274 | SRS2671505 | SRA629218 | GEO | Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine | 1 | 0.90237 | 0.09283 | 0.89958 | 0.53314 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United Kingdom | 2017-11-08 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 44560 | 44560 | SRR6268105 | SRX3374273 | SRS2671516 | SRP124607 | PRJNA417594 | From pioneer to repressor: Bimodal foxd3 activity dynamically remodels neural crest regulatory landscape in vivo | GSE106676 | Other | The neural crest NC is a transient embryonic stem cell population characterised by its multipotency and broad developmental potential. Here we perform NC specific transcriptional and epigenomic profiling of foxd3 mutant versus wild type cells in vivo to define the gene regulatory circuits controlling NC specification. Together with global binding analysis obtained by foxd3 biotin ChIP and single cell profiles of foxd3 expressing premigratory NC our analysis shows that during early steps of NC formation foxd3 acts globally as a pioneer factor to prime the onset of genes regulating NC specification and migration by re arranging the chromatin landscape opening cis regulatory elements and reshuffling nucleosomes. Strikingly foxd3 then gradually switches from an activator to its previously well described role as a transcriptional repressor. Taken together these results demonstrate that foxd3 acts bimodally in the neural crest as a switch from 'permissive' to 'repressive' nucleosome/chromatin organisation to maintain multipotency and define cell fates. Overall design: Examination of RNA seq ATAC seq histone ChIP seq Biotin ChIP seq in wild type and foxd3 mutant context at epib stages and in neural crest cells; single cell RNA seq | pubmed:30513303;pubmed:33111104 | scRNA seq FoxD3 Citrine 66 | GSM2845259 | source name:Citrine reporter expressing cells from 5 6ss embryos|strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | scRNA seq FoxD3 Citrine 66 | ChIP seq Biotin ChIP seq and ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using a enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a Genome build: danRer10 | Citrine reporter expressing cells from 5 6ss embryos | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | GSM2845259 | GSM2845259: scRNA seq FoxD3 Citrine 66; Danio rerio; RNA Seq | GSM2845259 | 1 | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | GEO Accession:GSM2845259 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP124607 | WTCHG_181146_709504_1.fastq.gz | fastq | 229983531.0 | 4509481.0 | GSM2845259 r1 | 0:51 | A:63488353;C:51465192;G:51652705;T:63359489;N:17792 | 51 | 63488353 | 51465192 | 51652705 | 63359489 | 17792 | SRX3374273 | SRS2671516 | SRA629218 | GEO | Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine | 1 | 0.9059 | 0.10725 | 0.91273 | 0.54521 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United Kingdom | 2017-11-08 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 44561 | 44561 | SRR6268104 | SRX3374272 | SRS2671501 | SRP124607 | PRJNA417594 | From pioneer to repressor: Bimodal foxd3 activity dynamically remodels neural crest regulatory landscape in vivo | GSE106676 | Other | The neural crest NC is a transient embryonic stem cell population characterised by its multipotency and broad developmental potential. Here we perform NC specific transcriptional and epigenomic profiling of foxd3 mutant versus wild type cells in vivo to define the gene regulatory circuits controlling NC specification. Together with global binding analysis obtained by foxd3 biotin ChIP and single cell profiles of foxd3 expressing premigratory NC our analysis shows that during early steps of NC formation foxd3 acts globally as a pioneer factor to prime the onset of genes regulating NC specification and migration by re arranging the chromatin landscape opening cis regulatory elements and reshuffling nucleosomes. Strikingly foxd3 then gradually switches from an activator to its previously well described role as a transcriptional repressor. Taken together these results demonstrate that foxd3 acts bimodally in the neural crest as a switch from 'permissive' to 'repressive' nucleosome/chromatin organisation to maintain multipotency and define cell fates. Overall design: Examination of RNA seq ATAC seq histone ChIP seq Biotin ChIP seq in wild type and foxd3 mutant context at epib stages and in neural crest cells; single cell RNA seq | pubmed:30513303;pubmed:33111104 | scRNA seq FoxD3 Citrine 65 | GSM2845258 | source name:Citrine reporter expressing cells from 5 6ss embryos|strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | scRNA seq FoxD3 Citrine 65 | ChIP seq Biotin ChIP seq and ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using a enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a Genome build: danRer10 | Citrine reporter expressing cells from 5 6ss embryos | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | GSM2845258 | GSM2845258: scRNA seq FoxD3 Citrine 65; Danio rerio; RNA Seq | GSM2845258 | 1 | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | GEO Accession:GSM2845258 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP124607 | WTCHG_181146_709503_1.fastq.gz | fastq | 222491937.0 | 4362587.0 | GSM2845258 r1 | 0:51 | A:60183015;C:51135894;G:51289518;T:59866428;N:17082 | 51 | 60183015 | 51135894 | 51289518 | 59866428 | 17082 | SRX3374272 | SRS2671501 | SRA629218 | GEO | Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine | 1 | 0.91963 | 0.06987 | 0.8938 | 0.5225 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United Kingdom | 2017-11-08 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 44562 | 44562 | SRR6268103 | SRX3374271 | SRS2671500 | SRP124607 | PRJNA417594 | From pioneer to repressor: Bimodal foxd3 activity dynamically remodels neural crest regulatory landscape in vivo | GSE106676 | Other | The neural crest NC is a transient embryonic stem cell population characterised by its multipotency and broad developmental potential. Here we perform NC specific transcriptional and epigenomic profiling of foxd3 mutant versus wild type cells in vivo to define the gene regulatory circuits controlling NC specification. Together with global binding analysis obtained by foxd3 biotin ChIP and single cell profiles of foxd3 expressing premigratory NC our analysis shows that during early steps of NC formation foxd3 acts globally as a pioneer factor to prime the onset of genes regulating NC specification and migration by re arranging the chromatin landscape opening cis regulatory elements and reshuffling nucleosomes. Strikingly foxd3 then gradually switches from an activator to its previously well described role as a transcriptional repressor. Taken together these results demonstrate that foxd3 acts bimodally in the neural crest as a switch from 'permissive' to 'repressive' nucleosome/chromatin organisation to maintain multipotency and define cell fates. Overall design: Examination of RNA seq ATAC seq histone ChIP seq Biotin ChIP seq in wild type and foxd3 mutant context at epib stages and in neural crest cells; single cell RNA seq | pubmed:30513303;pubmed:33111104 | scRNA seq FoxD3 Citrine 64 | GSM2845257 | source name:Citrine reporter expressing cells from 5 6ss embryos|strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | scRNA seq FoxD3 Citrine 64 | ChIP seq Biotin ChIP seq and ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using a enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a Genome build: danRer10 | Citrine reporter expressing cells from 5 6ss embryos | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | GSM2845257 | GSM2845257: scRNA seq FoxD3 Citrine 64; Danio rerio; RNA Seq | GSM2845257 | 1 | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | GEO Accession:GSM2845257 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP124607 | WTCHG_181146_709502_1.fastq.gz | fastq | 355096068.0 | 6962668.0 | GSM2845257 r1 | 0:51 | A:95947455;C:81571146;G:81475773;T:96074585;N:27109 | 51 | 95947455 | 81571146 | 81475773 | 96074585 | 27109 | SRX3374271 | SRS2671500 | SRA629218 | GEO | Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine | 1 | 0.90419 | 0.09025 | 0.91555 | 0.52772 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United Kingdom | 2017-11-08 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 44563 | 44563 | SRR6268102 | SRX3374270 | SRS2671499 | SRP124607 | PRJNA417594 | From pioneer to repressor: Bimodal foxd3 activity dynamically remodels neural crest regulatory landscape in vivo | GSE106676 | Other | The neural crest NC is a transient embryonic stem cell population characterised by its multipotency and broad developmental potential. Here we perform NC specific transcriptional and epigenomic profiling of foxd3 mutant versus wild type cells in vivo to define the gene regulatory circuits controlling NC specification. Together with global binding analysis obtained by foxd3 biotin ChIP and single cell profiles of foxd3 expressing premigratory NC our analysis shows that during early steps of NC formation foxd3 acts globally as a pioneer factor to prime the onset of genes regulating NC specification and migration by re arranging the chromatin landscape opening cis regulatory elements and reshuffling nucleosomes. Strikingly foxd3 then gradually switches from an activator to its previously well described role as a transcriptional repressor. Taken together these results demonstrate that foxd3 acts bimodally in the neural crest as a switch from 'permissive' to 'repressive' nucleosome/chromatin organisation to maintain multipotency and define cell fates. Overall design: Examination of RNA seq ATAC seq histone ChIP seq Biotin ChIP seq in wild type and foxd3 mutant context at epib stages and in neural crest cells; single cell RNA seq | pubmed:30513303;pubmed:33111104 | scRNA seq FoxD3 Citrine 63 | GSM2845256 | source name:Citrine reporter expressing cells from 5 6ss embryos|strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | scRNA seq FoxD3 Citrine 63 | ChIP seq Biotin ChIP seq and ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using a enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a Genome build: danRer10 | Citrine reporter expressing cells from 5 6ss embryos | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | GSM2845256 | GSM2845256: scRNA seq FoxD3 Citrine 63; Danio rerio; RNA Seq | GSM2845256 | 1 | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | GEO Accession:GSM2845256 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP124607 | WTCHG_181146_709501_1.fastq.gz | fastq | 155899095.0 | 3056845.0 | GSM2845256 r1 | 0:51 | A:42105072;C:35894129;G:35908191;T:41979652;N:12051 | 51 | 42105072 | 35894129 | 35908191 | 41979652 | 12051 | SRX3374270 | SRS2671499 | SRA629218 | GEO | Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine | 1 | 0.91619 | 0.0758 | 0.89589 | 0.52242 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United Kingdom | 2017-11-08 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 44564 | 44564 | SRR6268101 | SRX3374269 | SRS2671497 | SRP124607 | PRJNA417594 | From pioneer to repressor: Bimodal foxd3 activity dynamically remodels neural crest regulatory landscape in vivo | GSE106676 | Other | The neural crest NC is a transient embryonic stem cell population characterised by its multipotency and broad developmental potential. Here we perform NC specific transcriptional and epigenomic profiling of foxd3 mutant versus wild type cells in vivo to define the gene regulatory circuits controlling NC specification. Together with global binding analysis obtained by foxd3 biotin ChIP and single cell profiles of foxd3 expressing premigratory NC our analysis shows that during early steps of NC formation foxd3 acts globally as a pioneer factor to prime the onset of genes regulating NC specification and migration by re arranging the chromatin landscape opening cis regulatory elements and reshuffling nucleosomes. Strikingly foxd3 then gradually switches from an activator to its previously well described role as a transcriptional repressor. Taken together these results demonstrate that foxd3 acts bimodally in the neural crest as a switch from 'permissive' to 'repressive' nucleosome/chromatin organisation to maintain multipotency and define cell fates. Overall design: Examination of RNA seq ATAC seq histone ChIP seq Biotin ChIP seq in wild type and foxd3 mutant context at epib stages and in neural crest cells; single cell RNA seq | pubmed:30513303;pubmed:33111104 | scRNA seq FoxD3 Citrine 62 | GSM2845255 | source name:Citrine reporter expressing cells from 5 6ss embryos|strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | scRNA seq FoxD3 Citrine 62 | ChIP seq Biotin ChIP seq and ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using a enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a Genome build: danRer10 | Citrine reporter expressing cells from 5 6ss embryos | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | GSM2845255 | GSM2845255: scRNA seq FoxD3 Citrine 62; Danio rerio; RNA Seq | GSM2845255 | 1 | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | GEO Accession:GSM2845255 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP124607 | WTCHG_181145_708508_1.fastq.gz | fastq | 261758979.0 | 5132529.0 | GSM2845255 r1 | 0:51 | A:72590201;C:58444107;G:58580810;T:72125133;N:18728 | 51 | 72590201 | 58444107 | 58580810 | 72125133 | 18728 | SRX3374269 | SRS2671497 | SRA629218 | GEO | Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine | 1 | 0.90438 | 0.1052 | 0.91244 | 0.55615 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United Kingdom | 2017-11-08 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 44565 | 44565 | SRR6268100 | SRX3374268 | SRS2671492 | SRP124607 | PRJNA417594 | From pioneer to repressor: Bimodal foxd3 activity dynamically remodels neural crest regulatory landscape in vivo | GSE106676 | Other | The neural crest NC is a transient embryonic stem cell population characterised by its multipotency and broad developmental potential. Here we perform NC specific transcriptional and epigenomic profiling of foxd3 mutant versus wild type cells in vivo to define the gene regulatory circuits controlling NC specification. Together with global binding analysis obtained by foxd3 biotin ChIP and single cell profiles of foxd3 expressing premigratory NC our analysis shows that during early steps of NC formation foxd3 acts globally as a pioneer factor to prime the onset of genes regulating NC specification and migration by re arranging the chromatin landscape opening cis regulatory elements and reshuffling nucleosomes. Strikingly foxd3 then gradually switches from an activator to its previously well described role as a transcriptional repressor. Taken together these results demonstrate that foxd3 acts bimodally in the neural crest as a switch from 'permissive' to 'repressive' nucleosome/chromatin organisation to maintain multipotency and define cell fates. Overall design: Examination of RNA seq ATAC seq histone ChIP seq Biotin ChIP seq in wild type and foxd3 mutant context at epib stages and in neural crest cells; single cell RNA seq | pubmed:30513303;pubmed:33111104 | scRNA seq FoxD3 Citrine 61 | GSM2845254 | source name:Citrine reporter expressing cells from 5 6ss embryos|strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | scRNA seq FoxD3 Citrine 61 | ChIP seq Biotin ChIP seq and ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using a enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a Genome build: danRer10 | Citrine reporter expressing cells from 5 6ss embryos | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | GSM2845254 | GSM2845254: scRNA seq FoxD3 Citrine 61; Danio rerio; RNA Seq | GSM2845254 | 1 | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | GEO Accession:GSM2845254 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP124607 | WTCHG_181145_708507_1.fastq.gz | fastq | 300874602.0 | 5899502.0 | GSM2845254 r1 | 0:51 | A:82885872;C:67531603;G:67697234;T:82736603;N:23290 | 51 | 82885872 | 67531603 | 67697234 | 82736603 | 23290 | SRX3374268 | SRS2671492 | SRA629218 | GEO | Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine | 1 | 0.9023 | 0.10048 | 0.9013 | 0.55671 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United Kingdom | 2017-11-08 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 44566 | 44566 | SRR6268099 | SRX3374267 | SRS2671493 | SRP124607 | PRJNA417594 | From pioneer to repressor: Bimodal foxd3 activity dynamically remodels neural crest regulatory landscape in vivo | GSE106676 | Other | The neural crest NC is a transient embryonic stem cell population characterised by its multipotency and broad developmental potential. Here we perform NC specific transcriptional and epigenomic profiling of foxd3 mutant versus wild type cells in vivo to define the gene regulatory circuits controlling NC specification. Together with global binding analysis obtained by foxd3 biotin ChIP and single cell profiles of foxd3 expressing premigratory NC our analysis shows that during early steps of NC formation foxd3 acts globally as a pioneer factor to prime the onset of genes regulating NC specification and migration by re arranging the chromatin landscape opening cis regulatory elements and reshuffling nucleosomes. Strikingly foxd3 then gradually switches from an activator to its previously well described role as a transcriptional repressor. Taken together these results demonstrate that foxd3 acts bimodally in the neural crest as a switch from 'permissive' to 'repressive' nucleosome/chromatin organisation to maintain multipotency and define cell fates. Overall design: Examination of RNA seq ATAC seq histone ChIP seq Biotin ChIP seq in wild type and foxd3 mutant context at epib stages and in neural crest cells; single cell RNA seq | pubmed:30513303;pubmed:33111104 | scRNA seq FoxD3 Citrine 60 | GSM2845253 | source name:Citrine reporter expressing cells from 5 6ss embryos|strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | scRNA seq FoxD3 Citrine 60 | ChIP seq Biotin ChIP seq and ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using a enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a Genome build: danRer10 | Citrine reporter expressing cells from 5 6ss embryos | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | GSM2845253 | GSM2845253: scRNA seq FoxD3 Citrine 60; Danio rerio; RNA Seq | GSM2845253 | 1 | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | GEO Accession:GSM2845253 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP124607 | WTCHG_181145_708506_1.fastq.gz | fastq | 221176137.0 | 4336787.0 | GSM2845253 r1 | 0:51 | A:60998674;C:49514363;G:49566398;T:61079758;N:16944 | 51 | 60998674 | 49514363 | 49566398 | 61079758 | 16944 | SRX3374267 | SRS2671493 | SRA629218 | GEO | Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine | 1 | 0.89459 | 0.09386 | 0.88136 | 0.53748 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United Kingdom | 2017-11-08 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 44567 | 44567 | SRR6268098 | SRX3374266 | SRS2671491 | SRP124607 | PRJNA417594 | From pioneer to repressor: Bimodal foxd3 activity dynamically remodels neural crest regulatory landscape in vivo | GSE106676 | Other | The neural crest NC is a transient embryonic stem cell population characterised by its multipotency and broad developmental potential. Here we perform NC specific transcriptional and epigenomic profiling of foxd3 mutant versus wild type cells in vivo to define the gene regulatory circuits controlling NC specification. Together with global binding analysis obtained by foxd3 biotin ChIP and single cell profiles of foxd3 expressing premigratory NC our analysis shows that during early steps of NC formation foxd3 acts globally as a pioneer factor to prime the onset of genes regulating NC specification and migration by re arranging the chromatin landscape opening cis regulatory elements and reshuffling nucleosomes. Strikingly foxd3 then gradually switches from an activator to its previously well described role as a transcriptional repressor. Taken together these results demonstrate that foxd3 acts bimodally in the neural crest as a switch from 'permissive' to 'repressive' nucleosome/chromatin organisation to maintain multipotency and define cell fates. Overall design: Examination of RNA seq ATAC seq histone ChIP seq Biotin ChIP seq in wild type and foxd3 mutant context at epib stages and in neural crest cells; single cell RNA seq | pubmed:30513303;pubmed:33111104 | scRNA seq FoxD3 Citrine 59 | GSM2845252 | source name:Citrine reporter expressing cells from 5 6ss embryos|strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | scRNA seq FoxD3 Citrine 59 | ChIP seq Biotin ChIP seq and ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using a enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a Genome build: danRer10 | Citrine reporter expressing cells from 5 6ss embryos | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | GSM2845252 | GSM2845252: scRNA seq FoxD3 Citrine 59; Danio rerio; RNA Seq | GSM2845252 | 1 | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | GEO Accession:GSM2845252 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP124607 | WTCHG_181145_708505_1.fastq.gz | fastq | 389440233.0 | 7636083.0 | GSM2845252 r1 | 0:51 | A:107830456;C:86730145;G:86839984;T:108009929;N:29719 | 51 | 107830456 | 86730145 | 86839984 | 108009929 | 29719 | SRX3374266 | SRS2671491 | SRA629218 | GEO | Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine | 1 | 0.89099 | 0.10729 | 0.9035 | 0.5527 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United Kingdom | 2017-11-08 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 44568 | 44568 | SRR6268097 | SRX3374265 | SRS2671498 | SRP124607 | PRJNA417594 | From pioneer to repressor: Bimodal foxd3 activity dynamically remodels neural crest regulatory landscape in vivo | GSE106676 | Other | The neural crest NC is a transient embryonic stem cell population characterised by its multipotency and broad developmental potential. Here we perform NC specific transcriptional and epigenomic profiling of foxd3 mutant versus wild type cells in vivo to define the gene regulatory circuits controlling NC specification. Together with global binding analysis obtained by foxd3 biotin ChIP and single cell profiles of foxd3 expressing premigratory NC our analysis shows that during early steps of NC formation foxd3 acts globally as a pioneer factor to prime the onset of genes regulating NC specification and migration by re arranging the chromatin landscape opening cis regulatory elements and reshuffling nucleosomes. Strikingly foxd3 then gradually switches from an activator to its previously well described role as a transcriptional repressor. Taken together these results demonstrate that foxd3 acts bimodally in the neural crest as a switch from 'permissive' to 'repressive' nucleosome/chromatin organisation to maintain multipotency and define cell fates. Overall design: Examination of RNA seq ATAC seq histone ChIP seq Biotin ChIP seq in wild type and foxd3 mutant context at epib stages and in neural crest cells; single cell RNA seq | pubmed:30513303;pubmed:33111104 | scRNA seq FoxD3 Citrine 58 | GSM2845251 | source name:Citrine reporter expressing cells from 5 6ss embryos|strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | scRNA seq FoxD3 Citrine 58 | ChIP seq Biotin ChIP seq and ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using a enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a Genome build: danRer10 | Citrine reporter expressing cells from 5 6ss embryos | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | GSM2845251 | GSM2845251: scRNA seq FoxD3 Citrine 58; Danio rerio; RNA Seq | GSM2845251 | 1 | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | GEO Accession:GSM2845251 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP124607 | WTCHG_181145_708504_1.fastq.gz | fastq | 239052759.0 | 4687309.0 | GSM2845251 r1 | 0:51 | A:66150304;C:53233244;G:53605022;T:66045905;N:18284 | 51 | 66150304 | 53233244 | 53605022 | 66045905 | 18284 | SRX3374265 | SRS2671498 | SRA629218 | GEO | Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine | 1 | 0.89817 | 0.11479 | 0.88974 | 0.55506 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United Kingdom | 2017-11-08 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 44569 | 44569 | SRR6268096 | SRX3374264 | SRS2671494 | SRP124607 | PRJNA417594 | From pioneer to repressor: Bimodal foxd3 activity dynamically remodels neural crest regulatory landscape in vivo | GSE106676 | Other | The neural crest NC is a transient embryonic stem cell population characterised by its multipotency and broad developmental potential. Here we perform NC specific transcriptional and epigenomic profiling of foxd3 mutant versus wild type cells in vivo to define the gene regulatory circuits controlling NC specification. Together with global binding analysis obtained by foxd3 biotin ChIP and single cell profiles of foxd3 expressing premigratory NC our analysis shows that during early steps of NC formation foxd3 acts globally as a pioneer factor to prime the onset of genes regulating NC specification and migration by re arranging the chromatin landscape opening cis regulatory elements and reshuffling nucleosomes. Strikingly foxd3 then gradually switches from an activator to its previously well described role as a transcriptional repressor. Taken together these results demonstrate that foxd3 acts bimodally in the neural crest as a switch from 'permissive' to 'repressive' nucleosome/chromatin organisation to maintain multipotency and define cell fates. Overall design: Examination of RNA seq ATAC seq histone ChIP seq Biotin ChIP seq in wild type and foxd3 mutant context at epib stages and in neural crest cells; single cell RNA seq | pubmed:30513303;pubmed:33111104 | scRNA seq FoxD3 Citrine 57 | GSM2845250 | source name:Citrine reporter expressing cells from 5 6ss embryos|strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | scRNA seq FoxD3 Citrine 57 | ChIP seq Biotin ChIP seq and ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using a enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a Genome build: danRer10 | Citrine reporter expressing cells from 5 6ss embryos | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | GSM2845250 | GSM2845250: scRNA seq FoxD3 Citrine 57; Danio rerio; RNA Seq | GSM2845250 | 1 | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | GEO Accession:GSM2845250 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP124607 | WTCHG_181145_708503_1.fastq.gz | fastq | 404213046.0 | 7925746.0 | GSM2845250 r1 | 0:51 | A:111229780;C:90790119;G:90937403;T:111224584;N:31160 | 51 | 111229780 | 90790119 | 90937403 | 111224584 | 31160 | SRX3374264 | SRS2671494 | SRA629218 | GEO | Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine | 1 | 0.89482 | 0.10619 | 0.88962 | 0.54888 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United Kingdom | 2017-11-08 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 44570 | 44570 | SRR6268095 | SRX3374263 | SRS2671495 | SRP124607 | PRJNA417594 | From pioneer to repressor: Bimodal foxd3 activity dynamically remodels neural crest regulatory landscape in vivo | GSE106676 | Other | The neural crest NC is a transient embryonic stem cell population characterised by its multipotency and broad developmental potential. Here we perform NC specific transcriptional and epigenomic profiling of foxd3 mutant versus wild type cells in vivo to define the gene regulatory circuits controlling NC specification. Together with global binding analysis obtained by foxd3 biotin ChIP and single cell profiles of foxd3 expressing premigratory NC our analysis shows that during early steps of NC formation foxd3 acts globally as a pioneer factor to prime the onset of genes regulating NC specification and migration by re arranging the chromatin landscape opening cis regulatory elements and reshuffling nucleosomes. Strikingly foxd3 then gradually switches from an activator to its previously well described role as a transcriptional repressor. Taken together these results demonstrate that foxd3 acts bimodally in the neural crest as a switch from 'permissive' to 'repressive' nucleosome/chromatin organisation to maintain multipotency and define cell fates. Overall design: Examination of RNA seq ATAC seq histone ChIP seq Biotin ChIP seq in wild type and foxd3 mutant context at epib stages and in neural crest cells; single cell RNA seq | pubmed:30513303;pubmed:33111104 | scRNA seq FoxD3 Citrine 56 | GSM2845249 | source name:Citrine reporter expressing cells from 5 6ss embryos|strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | scRNA seq FoxD3 Citrine 56 | ChIP seq Biotin ChIP seq and ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using a enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a Genome build: danRer10 | Citrine reporter expressing cells from 5 6ss embryos | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | GSM2845249 | GSM2845249: scRNA seq FoxD3 Citrine 56; Danio rerio; RNA Seq | GSM2845249 | 1 | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | GEO Accession:GSM2845249 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP124607 | WTCHG_181145_708502_1.fastq.gz | fastq | 129016230.0 | 2529730.0 | GSM2845249 r1 | 0:51 | A:36295719;C:28707933;G:28814532;T:35190894;N:7152 | 51 | 36295719 | 28707933 | 28814532 | 35190894 | 7152 | SRX3374263 | SRS2671495 | SRA629218 | GEO | Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine | 1 | 0.89251 | 0.09543 | 0.88562 | 0.54133 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United Kingdom | 2017-11-08 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 44571 | 44571 | SRR6268094 | SRX3374262 | SRS2671496 | SRP124607 | PRJNA417594 | From pioneer to repressor: Bimodal foxd3 activity dynamically remodels neural crest regulatory landscape in vivo | GSE106676 | Other | The neural crest NC is a transient embryonic stem cell population characterised by its multipotency and broad developmental potential. Here we perform NC specific transcriptional and epigenomic profiling of foxd3 mutant versus wild type cells in vivo to define the gene regulatory circuits controlling NC specification. Together with global binding analysis obtained by foxd3 biotin ChIP and single cell profiles of foxd3 expressing premigratory NC our analysis shows that during early steps of NC formation foxd3 acts globally as a pioneer factor to prime the onset of genes regulating NC specification and migration by re arranging the chromatin landscape opening cis regulatory elements and reshuffling nucleosomes. Strikingly foxd3 then gradually switches from an activator to its previously well described role as a transcriptional repressor. Taken together these results demonstrate that foxd3 acts bimodally in the neural crest as a switch from 'permissive' to 'repressive' nucleosome/chromatin organisation to maintain multipotency and define cell fates. Overall design: Examination of RNA seq ATAC seq histone ChIP seq Biotin ChIP seq in wild type and foxd3 mutant context at epib stages and in neural crest cells; single cell RNA seq | pubmed:30513303;pubmed:33111104 | scRNA seq FoxD3 Citrine 55 | GSM2845248 | source name:Citrine reporter expressing cells from 5 6ss embryos|strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | scRNA seq FoxD3 Citrine 55 | ChIP seq Biotin ChIP seq and ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using a enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a Genome build: danRer10 | Citrine reporter expressing cells from 5 6ss embryos | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | GSM2845248 | GSM2845248: scRNA seq FoxD3 Citrine 55; Danio rerio; RNA Seq | GSM2845248 | 1 | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | GEO Accession:GSM2845248 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP124607 | WTCHG_181145_708501_1.fastq.gz | fastq | 148180551.0 | 2905501.0 | GSM2845248 r1 | 0:51 | A:41253081;C:33050850;G:33109865;T:40756870;N:9885 | 51 | 41253081 | 33050850 | 33109865 | 40756870 | 9885 | SRX3374262 | SRS2671496 | SRA629218 | GEO | Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine | 1 | 0.89333 | 0.11522 | 0.89637 | 0.57172 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United Kingdom | 2017-11-08 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 44572 | 44572 | SRR6268093 | SRX3374261 | SRS2671489 | SRP124607 | PRJNA417594 | From pioneer to repressor: Bimodal foxd3 activity dynamically remodels neural crest regulatory landscape in vivo | GSE106676 | Other | The neural crest NC is a transient embryonic stem cell population characterised by its multipotency and broad developmental potential. Here we perform NC specific transcriptional and epigenomic profiling of foxd3 mutant versus wild type cells in vivo to define the gene regulatory circuits controlling NC specification. Together with global binding analysis obtained by foxd3 biotin ChIP and single cell profiles of foxd3 expressing premigratory NC our analysis shows that during early steps of NC formation foxd3 acts globally as a pioneer factor to prime the onset of genes regulating NC specification and migration by re arranging the chromatin landscape opening cis regulatory elements and reshuffling nucleosomes. Strikingly foxd3 then gradually switches from an activator to its previously well described role as a transcriptional repressor. Taken together these results demonstrate that foxd3 acts bimodally in the neural crest as a switch from 'permissive' to 'repressive' nucleosome/chromatin organisation to maintain multipotency and define cell fates. Overall design: Examination of RNA seq ATAC seq histone ChIP seq Biotin ChIP seq in wild type and foxd3 mutant context at epib stages and in neural crest cells; single cell RNA seq | pubmed:30513303;pubmed:33111104 | scRNA seq FoxD3 Citrine 54 | GSM2845247 | source name:Citrine reporter expressing cells from 5 6ss embryos|strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | scRNA seq FoxD3 Citrine 54 | ChIP seq Biotin ChIP seq and ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using a enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a Genome build: danRer10 | Citrine reporter expressing cells from 5 6ss embryos | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | GSM2845247 | GSM2845247: scRNA seq FoxD3 Citrine 54; Danio rerio; RNA Seq | GSM2845247 | 1 | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | GEO Accession:GSM2845247 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP124607 | WTCHG_181145_707508_1.fastq.gz | fastq | 378936885.0 | 7430135.0 | GSM2845247 r1 | 0:51 | A:106757804;C:82806597;G:82590022;T:106755609;N:26853 | 51 | 106757804 | 82806597 | 82590022 | 106755609 | 26853 | SRX3374261 | SRS2671489 | SRA629218 | GEO | Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine | 1 | 0.88115 | 0.1084 | 0.90926 | 0.55695 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United Kingdom | 2017-11-08 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 44573 | 44573 | SRR6268092 | SRX3374260 | SRS2671490 | SRP124607 | PRJNA417594 | From pioneer to repressor: Bimodal foxd3 activity dynamically remodels neural crest regulatory landscape in vivo | GSE106676 | Other | The neural crest NC is a transient embryonic stem cell population characterised by its multipotency and broad developmental potential. Here we perform NC specific transcriptional and epigenomic profiling of foxd3 mutant versus wild type cells in vivo to define the gene regulatory circuits controlling NC specification. Together with global binding analysis obtained by foxd3 biotin ChIP and single cell profiles of foxd3 expressing premigratory NC our analysis shows that during early steps of NC formation foxd3 acts globally as a pioneer factor to prime the onset of genes regulating NC specification and migration by re arranging the chromatin landscape opening cis regulatory elements and reshuffling nucleosomes. Strikingly foxd3 then gradually switches from an activator to its previously well described role as a transcriptional repressor. Taken together these results demonstrate that foxd3 acts bimodally in the neural crest as a switch from 'permissive' to 'repressive' nucleosome/chromatin organisation to maintain multipotency and define cell fates. Overall design: Examination of RNA seq ATAC seq histone ChIP seq Biotin ChIP seq in wild type and foxd3 mutant context at epib stages and in neural crest cells; single cell RNA seq | pubmed:30513303;pubmed:33111104 | scRNA seq FoxD3 Citrine 53 | GSM2845246 | source name:Citrine reporter expressing cells from 5 6ss embryos|strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | scRNA seq FoxD3 Citrine 53 | ChIP seq Biotin ChIP seq and ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using a enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a Genome build: danRer10 | Citrine reporter expressing cells from 5 6ss embryos | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | GSM2845246 | GSM2845246: scRNA seq FoxD3 Citrine 53; Danio rerio; RNA Seq | GSM2845246 | 1 | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | GEO Accession:GSM2845246 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP124607 | WTCHG_181145_707507_1.fastq.gz | fastq | 501859839.0 | 9840389.0 | GSM2845246 r1 | 0:51 | A:143629358;C:108043628;G:108768199;T:141382225;N:36429 | 51 | 143629358 | 108043628 | 108768199 | 141382225 | 36429 | SRX3374260 | SRS2671490 | SRA629218 | GEO | Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine | 1 | 0.8917 | 0.1705 | 0.93253 | 0.74874 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United Kingdom | 2017-11-08 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 44574 | 44574 | SRR6268091 | SRX3374259 | SRS2671488 | SRP124607 | PRJNA417594 | From pioneer to repressor: Bimodal foxd3 activity dynamically remodels neural crest regulatory landscape in vivo | GSE106676 | Other | The neural crest NC is a transient embryonic stem cell population characterised by its multipotency and broad developmental potential. Here we perform NC specific transcriptional and epigenomic profiling of foxd3 mutant versus wild type cells in vivo to define the gene regulatory circuits controlling NC specification. Together with global binding analysis obtained by foxd3 biotin ChIP and single cell profiles of foxd3 expressing premigratory NC our analysis shows that during early steps of NC formation foxd3 acts globally as a pioneer factor to prime the onset of genes regulating NC specification and migration by re arranging the chromatin landscape opening cis regulatory elements and reshuffling nucleosomes. Strikingly foxd3 then gradually switches from an activator to its previously well described role as a transcriptional repressor. Taken together these results demonstrate that foxd3 acts bimodally in the neural crest as a switch from 'permissive' to 'repressive' nucleosome/chromatin organisation to maintain multipotency and define cell fates. Overall design: Examination of RNA seq ATAC seq histone ChIP seq Biotin ChIP seq in wild type and foxd3 mutant context at epib stages and in neural crest cells; single cell RNA seq | pubmed:30513303;pubmed:33111104 | scRNA seq FoxD3 Citrine 52 | GSM2845245 | source name:Citrine reporter expressing cells from 5 6ss embryos|strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | scRNA seq FoxD3 Citrine 52 | ChIP seq Biotin ChIP seq and ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using a enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a Genome build: danRer10 | Citrine reporter expressing cells from 5 6ss embryos | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | GSM2845245 | GSM2845245: scRNA seq FoxD3 Citrine 52; Danio rerio; RNA Seq | GSM2845245 | 1 | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | GEO Accession:GSM2845245 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP124607 | WTCHG_181145_707506_1.fastq.gz | fastq | 434411115.0 | 8517865.0 | GSM2845245 r1 | 0:51 | A:120755506;C:96742484;G:96808944;T:120070375;N:33806 | 51 | 120755506 | 96742484 | 96808944 | 120070375 | 33806 | SRX3374259 | SRS2671488 | SRA629218 | GEO | Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine | 1 | 0.91009 | 0.09418 | 0.90037 | 0.56998 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United Kingdom | 2017-11-08 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 44575 | 44575 | SRR6268090 | SRX3374258 | SRS2671484 | SRP124607 | PRJNA417594 | From pioneer to repressor: Bimodal foxd3 activity dynamically remodels neural crest regulatory landscape in vivo | GSE106676 | Other | The neural crest NC is a transient embryonic stem cell population characterised by its multipotency and broad developmental potential. Here we perform NC specific transcriptional and epigenomic profiling of foxd3 mutant versus wild type cells in vivo to define the gene regulatory circuits controlling NC specification. Together with global binding analysis obtained by foxd3 biotin ChIP and single cell profiles of foxd3 expressing premigratory NC our analysis shows that during early steps of NC formation foxd3 acts globally as a pioneer factor to prime the onset of genes regulating NC specification and migration by re arranging the chromatin landscape opening cis regulatory elements and reshuffling nucleosomes. Strikingly foxd3 then gradually switches from an activator to its previously well described role as a transcriptional repressor. Taken together these results demonstrate that foxd3 acts bimodally in the neural crest as a switch from 'permissive' to 'repressive' nucleosome/chromatin organisation to maintain multipotency and define cell fates. Overall design: Examination of RNA seq ATAC seq histone ChIP seq Biotin ChIP seq in wild type and foxd3 mutant context at epib stages and in neural crest cells; single cell RNA seq | pubmed:30513303;pubmed:33111104 | scRNA seq FoxD3 Citrine 51 | GSM2845244 | source name:Citrine reporter expressing cells from 5 6ss embryos|strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | scRNA seq FoxD3 Citrine 51 | ChIP seq Biotin ChIP seq and ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using a enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a Genome build: danRer10 | Citrine reporter expressing cells from 5 6ss embryos | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | GSM2845244 | GSM2845244: scRNA seq FoxD3 Citrine 51; Danio rerio; RNA Seq | GSM2845244 | 1 | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | GEO Accession:GSM2845244 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP124607 | WTCHG_181145_707505_1.fastq.gz | fastq | 435054429.0 | 8530479.0 | GSM2845244 r1 | 0:51 | A:121030192;C:96642734;G:96458249;T:120889704;N:33550 | 51 | 121030192 | 96642734 | 96458249 | 120889704 | 33550 | SRX3374258 | SRS2671484 | SRA629218 | GEO | Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine | 1 | 0.89808 | 0.11737 | 0.91228 | 0.56249 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United Kingdom | 2017-11-08 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 44576 | 44576 | SRR6268089 | SRX3374257 | SRS2671485 | SRP124607 | PRJNA417594 | From pioneer to repressor: Bimodal foxd3 activity dynamically remodels neural crest regulatory landscape in vivo | GSE106676 | Other | The neural crest NC is a transient embryonic stem cell population characterised by its multipotency and broad developmental potential. Here we perform NC specific transcriptional and epigenomic profiling of foxd3 mutant versus wild type cells in vivo to define the gene regulatory circuits controlling NC specification. Together with global binding analysis obtained by foxd3 biotin ChIP and single cell profiles of foxd3 expressing premigratory NC our analysis shows that during early steps of NC formation foxd3 acts globally as a pioneer factor to prime the onset of genes regulating NC specification and migration by re arranging the chromatin landscape opening cis regulatory elements and reshuffling nucleosomes. Strikingly foxd3 then gradually switches from an activator to its previously well described role as a transcriptional repressor. Taken together these results demonstrate that foxd3 acts bimodally in the neural crest as a switch from 'permissive' to 'repressive' nucleosome/chromatin organisation to maintain multipotency and define cell fates. Overall design: Examination of RNA seq ATAC seq histone ChIP seq Biotin ChIP seq in wild type and foxd3 mutant context at epib stages and in neural crest cells; single cell RNA seq | pubmed:30513303;pubmed:33111104 | scRNA seq FoxD3 Citrine 50 | GSM2845243 | source name:Citrine reporter expressing cells from 5 6ss embryos|strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | scRNA seq FoxD3 Citrine 50 | ChIP seq Biotin ChIP seq and ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using a enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a Genome build: danRer10 | Citrine reporter expressing cells from 5 6ss embryos | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | GSM2845243 | GSM2845243: scRNA seq FoxD3 Citrine 50; Danio rerio; RNA Seq | GSM2845243 | 1 | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | GEO Accession:GSM2845243 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP124607 | WTCHG_181145_707504_1.fastq.gz | fastq | 424242888.0 | 8318488.0 | GSM2845243 r1 | 0:51 | A:117651965;C:94271086;G:94592668;T:117694333;N:32836 | 51 | 117651965 | 94271086 | 94592668 | 117694333 | 32836 | SRX3374257 | SRS2671485 | SRA629218 | GEO | Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine | 1 | 0.89739 | 0.10573 | 0.90538 | 0.55397 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United Kingdom | 2017-11-08 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 44577 | 44577 | SRR6268088 | SRX3374256 | SRS2671486 | SRP124607 | PRJNA417594 | From pioneer to repressor: Bimodal foxd3 activity dynamically remodels neural crest regulatory landscape in vivo | GSE106676 | Other | The neural crest NC is a transient embryonic stem cell population characterised by its multipotency and broad developmental potential. Here we perform NC specific transcriptional and epigenomic profiling of foxd3 mutant versus wild type cells in vivo to define the gene regulatory circuits controlling NC specification. Together with global binding analysis obtained by foxd3 biotin ChIP and single cell profiles of foxd3 expressing premigratory NC our analysis shows that during early steps of NC formation foxd3 acts globally as a pioneer factor to prime the onset of genes regulating NC specification and migration by re arranging the chromatin landscape opening cis regulatory elements and reshuffling nucleosomes. Strikingly foxd3 then gradually switches from an activator to its previously well described role as a transcriptional repressor. Taken together these results demonstrate that foxd3 acts bimodally in the neural crest as a switch from 'permissive' to 'repressive' nucleosome/chromatin organisation to maintain multipotency and define cell fates. Overall design: Examination of RNA seq ATAC seq histone ChIP seq Biotin ChIP seq in wild type and foxd3 mutant context at epib stages and in neural crest cells; single cell RNA seq | pubmed:30513303;pubmed:33111104 | scRNA seq FoxD3 Citrine 49 | GSM2845242 | source name:Citrine reporter expressing cells from 5 6ss embryos|strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | scRNA seq FoxD3 Citrine 49 | ChIP seq Biotin ChIP seq and ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using a enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a Genome build: danRer10 | Citrine reporter expressing cells from 5 6ss embryos | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | GSM2845242 | GSM2845242: scRNA seq FoxD3 Citrine 49; Danio rerio; RNA Seq | GSM2845242 | 1 | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | GEO Accession:GSM2845242 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP124607 | WTCHG_181145_707503_1.fastq.gz | fastq | 413410488.0 | 8106088.0 | GSM2845242 r1 | 0:51 | A:113679181;C:93122974;G:93003285;T:113573567;N:31481 | 51 | 113679181 | 93122974 | 93003285 | 113573567 | 31481 | SRX3374256 | SRS2671486 | SRA629218 | GEO | Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine | 1 | 0.89629 | 0.08193 | 0.88266 | 0.54582 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United Kingdom | 2017-11-08 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 44578 | 44578 | SRR6268087 | SRX3374255 | SRS2671483 | SRP124607 | PRJNA417594 | From pioneer to repressor: Bimodal foxd3 activity dynamically remodels neural crest regulatory landscape in vivo | GSE106676 | Other | The neural crest NC is a transient embryonic stem cell population characterised by its multipotency and broad developmental potential. Here we perform NC specific transcriptional and epigenomic profiling of foxd3 mutant versus wild type cells in vivo to define the gene regulatory circuits controlling NC specification. Together with global binding analysis obtained by foxd3 biotin ChIP and single cell profiles of foxd3 expressing premigratory NC our analysis shows that during early steps of NC formation foxd3 acts globally as a pioneer factor to prime the onset of genes regulating NC specification and migration by re arranging the chromatin landscape opening cis regulatory elements and reshuffling nucleosomes. Strikingly foxd3 then gradually switches from an activator to its previously well described role as a transcriptional repressor. Taken together these results demonstrate that foxd3 acts bimodally in the neural crest as a switch from 'permissive' to 'repressive' nucleosome/chromatin organisation to maintain multipotency and define cell fates. Overall design: Examination of RNA seq ATAC seq histone ChIP seq Biotin ChIP seq in wild type and foxd3 mutant context at epib stages and in neural crest cells; single cell RNA seq | pubmed:30513303;pubmed:33111104 | scRNA seq FoxD3 Citrine 48 | GSM2845241 | source name:Citrine reporter expressing cells from 5 6ss embryos|strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | scRNA seq FoxD3 Citrine 48 | ChIP seq Biotin ChIP seq and ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using a enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a Genome build: danRer10 | Citrine reporter expressing cells from 5 6ss embryos | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | GSM2845241 | GSM2845241: scRNA seq FoxD3 Citrine 48; Danio rerio; RNA Seq | GSM2845241 | 1 | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | GEO Accession:GSM2845241 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP124607 | WTCHG_181145_707502_1.fastq.gz | fastq | 482393598.0 | 9458698.0 | GSM2845241 r1 | 0:51 | A:132082561;C:109342303;G:109033120;T:131898291;N:37323 | 51 | 132082561 | 109342303 | 109033120 | 131898291 | 37323 | SRX3374255 | SRS2671483 | SRA629218 | GEO | Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine | 1 | 0.90241 | 0.08657 | 0.89877 | 0.52918 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United Kingdom | 2017-11-08 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 44579 | 44579 | SRR6268086 | SRX3374254 | SRS2671487 | SRP124607 | PRJNA417594 | From pioneer to repressor: Bimodal foxd3 activity dynamically remodels neural crest regulatory landscape in vivo | GSE106676 | Other | The neural crest NC is a transient embryonic stem cell population characterised by its multipotency and broad developmental potential. Here we perform NC specific transcriptional and epigenomic profiling of foxd3 mutant versus wild type cells in vivo to define the gene regulatory circuits controlling NC specification. Together with global binding analysis obtained by foxd3 biotin ChIP and single cell profiles of foxd3 expressing premigratory NC our analysis shows that during early steps of NC formation foxd3 acts globally as a pioneer factor to prime the onset of genes regulating NC specification and migration by re arranging the chromatin landscape opening cis regulatory elements and reshuffling nucleosomes. Strikingly foxd3 then gradually switches from an activator to its previously well described role as a transcriptional repressor. Taken together these results demonstrate that foxd3 acts bimodally in the neural crest as a switch from 'permissive' to 'repressive' nucleosome/chromatin organisation to maintain multipotency and define cell fates. Overall design: Examination of RNA seq ATAC seq histone ChIP seq Biotin ChIP seq in wild type and foxd3 mutant context at epib stages and in neural crest cells; single cell RNA seq | pubmed:30513303;pubmed:33111104 | scRNA seq FoxD3 Citrine 47 | GSM2845240 | source name:Citrine reporter expressing cells from 5 6ss embryos|strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | scRNA seq FoxD3 Citrine 47 | ChIP seq Biotin ChIP seq and ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using a enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a Genome build: danRer10 | Citrine reporter expressing cells from 5 6ss embryos | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | GSM2845240 | GSM2845240: scRNA seq FoxD3 Citrine 47; Danio rerio; RNA Seq | GSM2845240 | 1 | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | GEO Accession:GSM2845240 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP124607 | WTCHG_181145_707501_1.fastq.gz | fastq | 80404611.0 | 1576561.0 | GSM2845240 r1 | 0:51 | A:23379756;C:17408432;G:17854834;T:21757597;N:3992 | 51 | 23379756 | 17408432 | 17854834 | 21757597 | 3992 | SRX3374254 | SRS2671487 | SRA629218 | GEO | Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine | 1 | 0.89713 | 0.11268 | 0.90335 | 0.56473 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United Kingdom | 2017-11-08 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 44580 | 44580 | SRR6268085 | SRX3374253 | SRS2671481 | SRP124607 | PRJNA417594 | From pioneer to repressor: Bimodal foxd3 activity dynamically remodels neural crest regulatory landscape in vivo | GSE106676 | Other | The neural crest NC is a transient embryonic stem cell population characterised by its multipotency and broad developmental potential. Here we perform NC specific transcriptional and epigenomic profiling of foxd3 mutant versus wild type cells in vivo to define the gene regulatory circuits controlling NC specification. Together with global binding analysis obtained by foxd3 biotin ChIP and single cell profiles of foxd3 expressing premigratory NC our analysis shows that during early steps of NC formation foxd3 acts globally as a pioneer factor to prime the onset of genes regulating NC specification and migration by re arranging the chromatin landscape opening cis regulatory elements and reshuffling nucleosomes. Strikingly foxd3 then gradually switches from an activator to its previously well described role as a transcriptional repressor. Taken together these results demonstrate that foxd3 acts bimodally in the neural crest as a switch from 'permissive' to 'repressive' nucleosome/chromatin organisation to maintain multipotency and define cell fates. Overall design: Examination of RNA seq ATAC seq histone ChIP seq Biotin ChIP seq in wild type and foxd3 mutant context at epib stages and in neural crest cells; single cell RNA seq | pubmed:30513303;pubmed:33111104 | scRNA seq FoxD3 Citrine 46 | GSM2845239 | source name:Citrine reporter expressing cells from 5 6ss embryos|strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | scRNA seq FoxD3 Citrine 46 | ChIP seq Biotin ChIP seq and ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using a enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a Genome build: danRer10 | Citrine reporter expressing cells from 5 6ss embryos | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | GSM2845239 | GSM2845239: scRNA seq FoxD3 Citrine 46; Danio rerio; RNA Seq | GSM2845239 | 1 | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | GEO Accession:GSM2845239 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP124607 | WTCHG_181145_706508_1.fastq.gz | fastq | 33326256.0 | 653456.0 | GSM2845239 r1 | 0:51 | A:9687297;C:7157128;G:7722297;T:8757938;N:1596 | 51 | 9687297 | 7157128 | 7722297 | 8757938 | 1596 | SRX3374253 | SRS2671481 | SRA629218 | GEO | Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine | 1 | 0.9143 | 0.10413 | 0.90421 | 0.50319 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United Kingdom | 2017-11-08 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 44581 | 44581 | SRR6268084 | SRX3374252 | SRS2671482 | SRP124607 | PRJNA417594 | From pioneer to repressor: Bimodal foxd3 activity dynamically remodels neural crest regulatory landscape in vivo | GSE106676 | Other | The neural crest NC is a transient embryonic stem cell population characterised by its multipotency and broad developmental potential. Here we perform NC specific transcriptional and epigenomic profiling of foxd3 mutant versus wild type cells in vivo to define the gene regulatory circuits controlling NC specification. Together with global binding analysis obtained by foxd3 biotin ChIP and single cell profiles of foxd3 expressing premigratory NC our analysis shows that during early steps of NC formation foxd3 acts globally as a pioneer factor to prime the onset of genes regulating NC specification and migration by re arranging the chromatin landscape opening cis regulatory elements and reshuffling nucleosomes. Strikingly foxd3 then gradually switches from an activator to its previously well described role as a transcriptional repressor. Taken together these results demonstrate that foxd3 acts bimodally in the neural crest as a switch from 'permissive' to 'repressive' nucleosome/chromatin organisation to maintain multipotency and define cell fates. Overall design: Examination of RNA seq ATAC seq histone ChIP seq Biotin ChIP seq in wild type and foxd3 mutant context at epib stages and in neural crest cells; single cell RNA seq | pubmed:30513303;pubmed:33111104 | scRNA seq FoxD3 Citrine 45 | GSM2845238 | source name:Citrine reporter expressing cells from 5 6ss embryos|strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | scRNA seq FoxD3 Citrine 45 | ChIP seq Biotin ChIP seq and ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using a enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a Genome build: danRer10 | Citrine reporter expressing cells from 5 6ss embryos | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | GSM2845238 | GSM2845238: scRNA seq FoxD3 Citrine 45; Danio rerio; RNA Seq | GSM2845238 | 1 | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | GEO Accession:GSM2845238 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP124607 | WTCHG_181145_706507_1.fastq.gz | fastq | 218638530.0 | 4287030.0 | GSM2845238 r1 | 0:51 | A:61155203;C:48461536;G:48678162;T:60327739;N:15890 | 51 | 61155203 | 48461536 | 48678162 | 60327739 | 15890 | SRX3374252 | SRS2671482 | SRA629218 | GEO | Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine | 1 | 0.90745 | 0.10341 | 0.90325 | 0.54791 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United Kingdom | 2017-11-08 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 44582 | 44582 | SRR6268083 | SRX3374251 | SRS2671480 | SRP124607 | PRJNA417594 | From pioneer to repressor: Bimodal foxd3 activity dynamically remodels neural crest regulatory landscape in vivo | GSE106676 | Other | The neural crest NC is a transient embryonic stem cell population characterised by its multipotency and broad developmental potential. Here we perform NC specific transcriptional and epigenomic profiling of foxd3 mutant versus wild type cells in vivo to define the gene regulatory circuits controlling NC specification. Together with global binding analysis obtained by foxd3 biotin ChIP and single cell profiles of foxd3 expressing premigratory NC our analysis shows that during early steps of NC formation foxd3 acts globally as a pioneer factor to prime the onset of genes regulating NC specification and migration by re arranging the chromatin landscape opening cis regulatory elements and reshuffling nucleosomes. Strikingly foxd3 then gradually switches from an activator to its previously well described role as a transcriptional repressor. Taken together these results demonstrate that foxd3 acts bimodally in the neural crest as a switch from 'permissive' to 'repressive' nucleosome/chromatin organisation to maintain multipotency and define cell fates. Overall design: Examination of RNA seq ATAC seq histone ChIP seq Biotin ChIP seq in wild type and foxd3 mutant context at epib stages and in neural crest cells; single cell RNA seq | pubmed:30513303;pubmed:33111104 | scRNA seq FoxD3 Citrine 44 | GSM2845237 | source name:Citrine reporter expressing cells from 5 6ss embryos|strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | scRNA seq FoxD3 Citrine 44 | ChIP seq Biotin ChIP seq and ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using a enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a Genome build: danRer10 | Citrine reporter expressing cells from 5 6ss embryos | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | GSM2845237 | GSM2845237: scRNA seq FoxD3 Citrine 44; Danio rerio; RNA Seq | GSM2845237 | 1 | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | GEO Accession:GSM2845237 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP124607 | WTCHG_181145_706506_1.fastq.gz | fastq | 93948120.0 | 1842120.0 | GSM2845237 r1 | 0:51 | A:25903446;C:21122913;G:21191952;T:25722737;N:7072 | 51 | 25903446 | 21122913 | 21191952 | 25722737 | 7072 | SRX3374251 | SRS2671480 | SRA629218 | GEO | Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine | 1 | 0.91309 | 0.09015 | 0.8952 | 0.52221 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United Kingdom | 2017-11-08 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 44583 | 44583 | SRR6268082 | SRX3374250 | SRS2671479 | SRP124607 | PRJNA417594 | From pioneer to repressor: Bimodal foxd3 activity dynamically remodels neural crest regulatory landscape in vivo | GSE106676 | Other | The neural crest NC is a transient embryonic stem cell population characterised by its multipotency and broad developmental potential. Here we perform NC specific transcriptional and epigenomic profiling of foxd3 mutant versus wild type cells in vivo to define the gene regulatory circuits controlling NC specification. Together with global binding analysis obtained by foxd3 biotin ChIP and single cell profiles of foxd3 expressing premigratory NC our analysis shows that during early steps of NC formation foxd3 acts globally as a pioneer factor to prime the onset of genes regulating NC specification and migration by re arranging the chromatin landscape opening cis regulatory elements and reshuffling nucleosomes. Strikingly foxd3 then gradually switches from an activator to its previously well described role as a transcriptional repressor. Taken together these results demonstrate that foxd3 acts bimodally in the neural crest as a switch from 'permissive' to 'repressive' nucleosome/chromatin organisation to maintain multipotency and define cell fates. Overall design: Examination of RNA seq ATAC seq histone ChIP seq Biotin ChIP seq in wild type and foxd3 mutant context at epib stages and in neural crest cells; single cell RNA seq | pubmed:30513303;pubmed:33111104 | scRNA seq FoxD3 Citrine 43 | GSM2845236 | source name:Citrine reporter expressing cells from 5 6ss embryos|strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | scRNA seq FoxD3 Citrine 43 | ChIP seq Biotin ChIP seq and ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using a enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a Genome build: danRer10 | Citrine reporter expressing cells from 5 6ss embryos | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | strain:Gtfoxd3 citrinect110|tissue:Citrine reporter expressing cells from 5 6ss embryos|developmental stage:5 6ss|assay:scRNA seq|isolation method:FACS | GSM2845236 | GSM2845236: scRNA seq FoxD3 Citrine 43; Danio rerio; RNA Seq | GSM2845236 | 1 | FACS sorted cells were washed with PBS and stored at 80C in lysis buffer. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit AM1931 checked on Bioanalyser samples with RIN >7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit 634889. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit FC 131 1024. For scRNA.seq individual cells were collected by FACS cDNA was obtained and sequencing libraries as previously described Picelli et al. 2014. Libraries were sequenced using 50 bp single end reads for 96 cells. 4x10E7 dilution of ERCC spike in control was used. | GEO Accession:GSM2845236 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP124607 | WTCHG_181145_706505_1.fastq.gz | fastq | 1027038.0 | 20138.0 | GSM2845236 r1 | 0:51 | A:278183;C:237276;G:226704;T:284818;N:57 | 51 | 278183 | 237276 | 226704 | 284818 | 57 | SRX3374250 | SRS2671479 | SRA629218 | GEO | Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine | 1 | 0.89912 | 0.08815 | 0.92646 | 0.5335 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nextera | sc | single_cell_plate | smartseq | United Kingdom | 2017-11-08 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures |
Advanced export
JSON shape: default, array, newline-delimited
CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;