run_metadata
6,717 rows where experiment.library_layout = "SINGLE" and technology = "smartseq"
This data as json, CSV (advanced)
| Link | rowid ▼ | run.accession | experiment.accession | sample.accession | study.accession | bioproject | study.title | study.alias | study.type | study.abstract | study.attributes | study.PMIDs | sample.description | sample.title | sample.alias | sample.centername | sample.attributes | GEOsample.title | GEOsample.dataprocessing | GEOsample.source | GEOsample.treatmentprotocol | GEOsample.extractprotocol | GEOsample.growthprotocol | GEOsample.characteristics | GEOsample.accession | experiment.title | experiment.alias | experiment.library_name | experiment.design_description | experiment.library_construction_protocol | experiment.attributes | experiment.library_strategy | experiment.library_source | experiment.library_selection | experiment.library_layout | experiment.platform | experiment.instrument_model | experiment.spot_descriptor | experiment.study_ref | run.title | run.attributes | run.filename | run.semantic_name | run.total_bases | run.total_spots | run.alias | run.read_lengths | run.base_counts | run.r1_length | run.r2_length | run.r3_length | run.r4_length | run.Acount | run.Ccount | run.Gcount | run.Tcount | run.Ncount | run.experiment | run.pool_member | submission.accession | submission.srasource | submission.bioprojectsource | seqdetective.n_mates | seqdetective.mapping_rate.mate1 | seqdetective.mapping_rate.mate2 | seqdetective.nofeature_rate.mate1 | seqdetective.nofeature_rate.mate2 | seqdetective.sparsity.mate1 | seqdetective.sparsity.mate2 | seqdetective.pos_strand_rate.mate1 | seqdetective.pos_strand_rate.mate2 | seqdetective.readlen.mate1 | seqdetective.readlen.mate2 | seqdetective.judgement.mate1 | seqdetective.judgement.mate2 | seqdetective.judgement.reason | platform_family | instrument_generation | read_bias | selection_class | prep_kit | sc_or_bulk | tech_class | technology | tech_variant | submission.bioprojectsource.country | earliest_date | devstage_curation | devstage_curation_coarse | tissue_curation | tissue_curation_coarse |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 9651 | 9651 | ERR3266392 | ERX3293003 | ERS3358386 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp positive rep2 | SAMEA5556346 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp positive rep2 s | sponge tdr gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_9pos_S2_L001_R1_001.fastq.gz | fastq | 603238067.0 | 8014716.0 | E MTAB 7846:sponge tdr gfp positive rep2 lane1 | 0:75.27 1:0 | A:164797697;C:136552121;G:141138007;T:160737152;N:13090 | 75 | 0 | 164797697 | 136552121 | 141138007 | 160737152 | 13090 | ERX3293003 | ERS3358386 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95083 | 0.06432 | 0.71532 | 0.50098 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9652 | 9652 | ERR3266393 | ERX3293003 | ERS3358386 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp positive rep2 | SAMEA5556346 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp positive rep2 s | sponge tdr gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_9pos_S2_L002_R1_001.fastq.gz | fastq | 603749720.0 | 8021069.0 | E MTAB 7846:sponge tdr gfp positive rep2 lane2 | 0:75.27 1:0 | A:164972969;C:136661417;G:141205792;T:160896264;N:13278 | 75 | 0 | 164972969 | 136661417 | 141205792 | 160896264 | 13278 | ERX3293003 | ERS3358386 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.951 | 0.06542 | 0.71768 | 0.50051 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9653 | 9653 | ERR3266394 | ERX3293003 | ERS3358386 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp positive rep2 | SAMEA5556346 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp positive rep2 s | sponge tdr gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_9pos_S2_L003_R1_001.fastq.gz | fastq | 608154053.0 | 8079704.0 | E MTAB 7846:sponge tdr gfp positive rep2 lane3 | 0:75.27 1:0 | A:166117918;C:137731172;G:142320339;T:161970092;N:14532 | 75 | 0 | 166117918 | 137731172 | 142320339 | 161970092 | 14532 | ERX3293003 | ERS3358386 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95155 | 0.0657 | 0.71634 | 0.49493 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9654 | 9654 | ERR3266395 | ERX3293003 | ERS3358386 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp positive rep2 | SAMEA5556346 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp positive rep2 s | sponge tdr gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_9pos_S2_L004_R1_001.fastq.gz | fastq | 599143392.0 | 7959897.0 | E MTAB 7846:sponge tdr gfp positive rep2 lane4 | 0:75.27 1:0 | A:163706904;C:135622453;G:140192351;T:159605249;N:16435 | 75 | 0 | 163706904 | 135622453 | 140192351 | 159605249 | 16435 | ERX3293003 | ERS3358386 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95061 | 0.06431 | 0.71764 | 0.50166 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9655 | 9655 | ERR3266388 | ERX3293002 | ERS3358385 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp positive rep1 | SAMEA5556345 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp positive rep1 s | sponge tdr gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_6pos_S4_L001_R1_001.fastq.gz | fastq | 616761505.0 | 8202480.0 | E MTAB 7846:sponge tdr gfp positive rep1 lane1 | 0:75.19 1:0 | A:168679238;C:139548565;G:143969797;T:164545362;N:18543 | 75 | 0 | 168679238 | 139548565 | 143969797 | 164545362 | 18543 | ERX3293002 | ERS3358385 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95019 | 0.06806 | 0.7097 | 0.50337 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9656 | 9656 | ERR3266389 | ERX3293002 | ERS3358385 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp positive rep1 | SAMEA5556345 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp positive rep1 s | sponge tdr gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_6pos_S4_L002_R1_001.fastq.gz | fastq | 617529482.0 | 8212485.0 | E MTAB 7846:sponge tdr gfp positive rep1 lane2 | 0:75.19 1:0 | A:168925757;C:139655387;G:144096837;T:164831236;N:20265 | 75 | 0 | 168925757 | 139655387 | 144096837 | 164831236 | 20265 | ERX3293002 | ERS3358385 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.9492 | 0.06753 | 0.712 | 0.49881 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9657 | 9657 | ERR3266390 | ERX3293002 | ERS3358385 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp positive rep1 | SAMEA5556345 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp positive rep1 s | sponge tdr gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_6pos_S4_L003_R1_001.fastq.gz | fastq | 624156883.0 | 8300861.0 | E MTAB 7846:sponge tdr gfp positive rep1 lane3 | 0:75.19 1:0 | A:170696950;C:141302376;G:145759286;T:166377781;N:20490 | 75 | 0 | 170696950 | 141302376 | 145759286 | 166377781 | 20490 | ERX3293002 | ERS3358385 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94917 | 0.06724 | 0.71291 | 0.50783 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9658 | 9658 | ERR3266391 | ERX3293002 | ERS3358385 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp positive rep1 | SAMEA5556345 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp positive rep1 s | sponge tdr gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_6pos_S4_L004_R1_001.fastq.gz | fastq | 615013615.0 | 8179180.0 | E MTAB 7846:sponge tdr gfp positive rep1 lane4 | 0:75.19 1:0 | A:168237742;C:139106952;G:143535658;T:164110735;N:22528 | 75 | 0 | 168237742 | 139106952 | 143535658 | 164110735 | 22528 | ERX3293002 | ERS3358385 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94892 | 0.06723 | 0.71206 | 0.50775 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9659 | 9659 | ERR3266384 | ERX3293001 | ERS3358384 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp negative rep2 | SAMEA5556344 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556344|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp negative rep2 s | sponge tdr gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_9neg_S1_L001_R1_001.fastq.gz | fastq | 659562366.0 | 8762947.0 | E MTAB 7846:sponge tdr gfp negative rep2 lane1 | 0:75.27 1:0 | A:178744772;C:150091912;G:155092318;T:175619332;N:14032 | 75 | 0 | 178744772 | 150091912 | 155092318 | 175619332 | 14032 | ERX3293001 | ERS3358384 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.9517 | 0.06908 | 0.70822 | 0.48025 | 73 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9660 | 9660 | ERR3266385 | ERX3293001 | ERS3358384 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp negative rep2 | SAMEA5556344 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556344|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp negative rep2 s | sponge tdr gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_9neg_S1_L002_R1_001.fastq.gz | fastq | 658688825.0 | 8751176.0 | E MTAB 7846:sponge tdr gfp negative rep2 lane2 | 0:75.27 1:0 | A:178540155;C:149844100;G:154850294;T:175438757;N:15519 | 75 | 0 | 178540155 | 149844100 | 154850294 | 175438757 | 15519 | ERX3293001 | ERS3358384 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95059 | 0.06748 | 0.70806 | 0.48177 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9661 | 9661 | ERR3266386 | ERX3293001 | ERS3358384 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp negative rep2 | SAMEA5556344 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556344|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp negative rep2 s | sponge tdr gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_9neg_S1_L003_R1_001.fastq.gz | fastq | 665901310.0 | 8846927.0 | E MTAB 7846:sponge tdr gfp negative rep2 lane3 | 0:75.27 1:0 | A:180412445;C:151589489;G:156677030;T:177206192;N:16154 | 75 | 0 | 180412445 | 151589489 | 156677030 | 177206192 | 16154 | ERX3293001 | ERS3358384 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95095 | 0.06855 | 0.7082 | 0.4787 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9662 | 9662 | ERR3266387 | ERX3293001 | ERS3358384 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp negative rep2 | SAMEA5556344 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556344|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp negative rep2 s | sponge tdr gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_9neg_S1_L004_R1_001.fastq.gz | fastq | 655674573.0 | 8711278.0 | E MTAB 7846:sponge tdr gfp negative rep2 lane4 | 0:75.27 1:0 | A:177658097;C:149188009;G:154201531;T:174609176;N:17760 | 75 | 0 | 177658097 | 149188009 | 154201531 | 174609176 | 17760 | ERX3293001 | ERS3358384 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.9503 | 0.06838 | 0.70926 | 0.47475 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9663 | 9663 | ERR3266380 | ERX3293000 | ERS3358383 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp negative rep1 | SAMEA5556343 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556343|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp negative rep1 s | sponge tdr gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_6neg_S3_L001_R1_001.fastq.gz | fastq | 634491637.0 | 8440052.0 | E MTAB 7846:sponge tdr gfp negative rep1 lane1 | 0:75.18 1:0 | A:170881257;C:145535643;G:150561786;T:167495156;N:17795 | 75 | 0 | 170881257 | 145535643 | 150561786 | 167495156 | 17795 | ERX3293000 | ERS3358383 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94996 | 0.05672 | 0.70571 | 0.48691 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9664 | 9664 | ERR3266381 | ERX3293000 | ERS3358383 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp negative rep1 | SAMEA5556343 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556343|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp negative rep1 s | sponge tdr gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_6neg_S3_L002_R1_001.fastq.gz | fastq | 632900752.0 | 8418846.0 | E MTAB 7846:sponge tdr gfp negative rep1 lane2 | 0:75.18 1:0 | A:170454908;C:145141392;G:150172752;T:167112562;N:19138 | 75 | 0 | 170454908 | 145141392 | 150172752 | 167112562 | 19138 | ERX3293000 | ERS3358383 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94905 | 0.05627 | 0.70457 | 0.4865 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9665 | 9665 | ERR3266382 | ERX3293000 | ERS3358383 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp negative rep1 | SAMEA5556343 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556343|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp negative rep1 s | sponge tdr gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_6neg_S3_L003_R1_001.fastq.gz | fastq | 638530115.0 | 8494045.0 | E MTAB 7846:sponge tdr gfp negative rep1 lane3 | 0:75.17 1:0 | A:171907482;C:146526309;G:151612209;T:168464163;N:19952 | 75 | 0 | 171907482 | 146526309 | 151612209 | 168464163 | 19952 | ERX3293000 | ERS3358383 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94919 | 0.05578 | 0.70849 | 0.48073 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9666 | 9666 | ERR3266383 | ERX3293000 | ERS3358383 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge tdr gfp negative rep1 | SAMEA5556343 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556343|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge tdr gfp negative rep1 s | sponge tdr gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E9_6neg_S3_L004_R1_001.fastq.gz | fastq | 627433322.0 | 8346505.0 | E MTAB 7846:sponge tdr gfp negative rep1 lane4 | 0:75.17 1:0 | A:169016383;C:143886824;G:148914725;T:165593528;N:21862 | 75 | 0 | 169016383 | 143886824 | 148914725 | 165593528 | 21862 | ERX3293000 | ERS3358383 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94993 | 0.05721 | 0.7052 | 0.48878 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9667 | 9667 | ERR3266376 | ERX3292999 | ERS3358382 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp positive rep2 | SAMEA5556342 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556342|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp positive rep2 s | sponge isl gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_7pos_S10_L001_R1_001.fastq.gz | fastq | 618672195.0 | 8218047.0 | E MTAB 7846:sponge isl gfp positive rep2 lane1 | 0:75.28 1:0 | A:166422886;C:142212204;G:146857539;T:163167819;N:11747 | 75 | 0 | 166422886 | 142212204 | 146857539 | 163167819 | 11747 | ERX3292999 | ERS3358382 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94979 | 0.08351 | 0.70863 | 0.47581 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9668 | 9668 | ERR3266377 | ERX3292999 | ERS3358382 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp positive rep2 | SAMEA5556342 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556342|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp positive rep2 s | sponge isl gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_7pos_S10_L002_R1_001.fastq.gz | fastq | 618709102.0 | 8218295.0 | E MTAB 7846:sponge isl gfp positive rep2 lane2 | 0:75.28 1:0 | A:166470432;C:142189977;G:146819280;T:163216323;N:13090 | 75 | 0 | 166470432 | 142189977 | 146819280 | 163216323 | 13090 | ERX3292999 | ERS3358382 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94977 | 0.08255 | 0.70644 | 0.47228 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9669 | 9669 | ERR3266378 | ERX3292999 | ERS3358382 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp positive rep2 | SAMEA5556342 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556342|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp positive rep2 s | sponge isl gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_7pos_S10_L003_R1_001.fastq.gz | fastq | 625353059.0 | 8306375.0 | E MTAB 7846:sponge isl gfp positive rep2 lane3 | 0:75.29 1:0 | A:168233274;C:143793178;G:148510556;T:164802476;N:13575 | 75 | 0 | 168233274 | 143793178 | 148510556 | 164802476 | 13575 | ERX3292999 | ERS3358382 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95014 | 0.08368 | 0.70743 | 0.47846 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9670 | 9670 | ERR3266379 | ERX3292999 | ERS3358382 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp positive rep2 | SAMEA5556342 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556342|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp positive rep2 s | sponge isl gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_7pos_S10_L004_R1_001.fastq.gz | fastq | 615204990.0 | 8171748.0 | E MTAB 7846:sponge isl gfp positive rep2 lane4 | 0:75.28 1:0 | A:165565861;C:141380152;G:146028839;T:162214263;N:15875 | 75 | 0 | 165565861 | 141380152 | 146028839 | 162214263 | 15875 | ERX3292999 | ERS3358382 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94954 | 0.08233 | 0.70834 | 0.48166 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9671 | 9671 | ERR3266372 | ERX3292998 | ERS3358381 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp positive rep1 | SAMEA5556341 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556341|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp positive rep1 s | sponge isl gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_6pos_S12_L001_R1_001.fastq.gz | fastq | 626474467.0 | 8318996.0 | E MTAB 7846:sponge isl gfp positive rep1 lane1 | 0:75.31 1:0 | A:170186220;C:142441110;G:147048643;T:166786401;N:12093 | 75 | 0 | 170186220 | 142441110 | 147048643 | 166786401 | 12093 | ERX3292998 | ERS3358381 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94907 | 0.08132 | 0.69684 | 0.4736 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9672 | 9672 | ERR3266373 | ERX3292998 | ERS3358381 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp positive rep1 | SAMEA5556341 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556341|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp positive rep1 s | sponge isl gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_6pos_S12_L002_R1_001.fastq.gz | fastq | 626477579.0 | 8318750.0 | E MTAB 7846:sponge isl gfp positive rep1 lane2 | 0:75.31 1:0 | A:170185337;C:142396801;G:147032265;T:166850532;N:12644 | 75 | 0 | 170185337 | 142396801 | 147032265 | 166850532 | 12644 | ERX3292998 | ERS3358381 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94941 | 0.08253 | 0.6957 | 0.47554 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9673 | 9673 | ERR3266374 | ERX3292998 | ERS3358381 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp positive rep1 | SAMEA5556341 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556341|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp positive rep1 s | sponge isl gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_6pos_S12_L003_R1_001.fastq.gz | fastq | 632098509.0 | 8393388.0 | E MTAB 7846:sponge isl gfp positive rep1 lane3 | 0:75.31 1:0 | A:171699353;C:143766296;G:148442110;T:168177264;N:13486 | 75 | 0 | 171699353 | 143766296 | 148442110 | 168177264 | 13486 | ERX3292998 | ERS3358381 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94866 | 0.08247 | 0.69601 | 0.48009 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9674 | 9674 | ERR3266375 | ERX3292998 | ERS3358381 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp positive rep1 | SAMEA5556341 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556341|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp positive rep1 s | sponge isl gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_6pos_S12_L004_R1_001.fastq.gz | fastq | 622997479.0 | 8272752.0 | E MTAB 7846:sponge isl gfp positive rep1 lane4 | 0:75.31 1:0 | A:169306677;C:141586415;G:146241288;T:165847752;N:15347 | 75 | 0 | 169306677 | 141586415 | 146241288 | 165847752 | 15347 | ERX3292998 | ERS3358381 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.9483 | 0.08034 | 0.69662 | 0.47868 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9675 | 9675 | ERR3266368 | ERX3292997 | ERS3358380 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp negative rep2 | SAMEA5556340 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556340|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp negative rep2 s | sponge isl gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_7neg_S9_L001_R1_001.fastq.gz | fastq | 707454819.0 | 9395082.0 | E MTAB 7846:sponge isl gfp negative rep2 lane1 | 0:75.30 1:0 | A:194991862;C:157927850;G:163280639;T:191241488;N:12980 | 75 | 0 | 194991862 | 157927850 | 163280639 | 191241488 | 12980 | ERX3292997 | ERS3358380 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.93871 | 0.08926 | 0.70806 | 0.46501 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9676 | 9676 | ERR3266369 | ERX3292997 | ERS3358380 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp negative rep2 | SAMEA5556340 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556340|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp negative rep2 s | sponge isl gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_7neg_S9_L002_R1_001.fastq.gz | fastq | 704791838.0 | 9359668.0 | E MTAB 7846:sponge isl gfp negative rep2 lane2 | 0:75.30 1:0 | A:194317422;C:157276895;G:162624670;T:190558322;N:14529 | 75 | 0 | 194317422 | 157276895 | 162624670 | 190558322 | 14529 | ERX3292997 | ERS3358380 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.93816 | 0.08859 | 0.70999 | 0.4661 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9677 | 9677 | ERR3266370 | ERX3292997 | ERS3358380 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp negative rep2 | SAMEA5556340 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556340|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp negative rep2 s | sponge isl gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_7neg_S9_L003_R1_001.fastq.gz | fastq | 715991833.0 | 9508323.0 | E MTAB 7846:sponge isl gfp negative rep2 lane3 | 0:75.30 1:0 | A:197297222;C:159913026;G:165363927;T:193402765;N:14893 | 75 | 0 | 197297222 | 159913026 | 165363927 | 193402765 | 14893 | ERX3292997 | ERS3358380 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.93844 | 0.08854 | 0.70828 | 0.46042 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9678 | 9678 | ERR3266371 | ERX3292997 | ERS3358380 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp negative rep2 | SAMEA5556340 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556340|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp negative rep2 s | sponge isl gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_7neg_S9_L004_R1_001.fastq.gz | fastq | 703723869.0 | 9345669.0 | E MTAB 7846:sponge isl gfp negative rep2 lane4 | 0:75.30 1:0 | A:194029886;C:157050176;G:162432310;T:190193608;N:17889 | 75 | 0 | 194029886 | 157050176 | 162432310 | 190193608 | 17889 | ERX3292997 | ERS3358380 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.93897 | 0.08993 | 0.70863 | 0.45707 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9679 | 9679 | ERR3266364 | ERX3292996 | ERS3358379 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp negative rep1 | SAMEA5556339 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556339|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp negative rep1 s | sponge isl gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_6neg_S11_L001_R1_001.fastq.gz | fastq | 676581458.0 | 8983758.0 | E MTAB 7846:sponge isl gfp negative rep1 lane1 | 0:75.31 1:0 | A:184297337;C:153352193;G:158268476;T:180651038;N:12414 | 75 | 0 | 184297337 | 153352193 | 158268476 | 180651038 | 12414 | ERX3292996 | ERS3358379 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94981 | 0.07715 | 0.69138 | 0.47243 | 74 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9680 | 9680 | ERR3266365 | ERX3292996 | ERS3358379 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp negative rep1 | SAMEA5556339 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556339|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp negative rep1 s | sponge isl gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_6neg_S11_L002_R1_001.fastq.gz | fastq | 676876555.0 | 8987445.0 | E MTAB 7846:sponge isl gfp negative rep1 lane2 | 0:75.31 1:0 | A:184435129;C:153332402;G:158323789;T:180770978;N:14257 | 75 | 0 | 184435129 | 153332402 | 158323789 | 180770978 | 14257 | ERX3292996 | ERS3358379 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94901 | 0.07805 | 0.69179 | 0.47182 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9681 | 9681 | ERR3266366 | ERX3292996 | ERS3358379 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp negative rep1 | SAMEA5556339 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556339|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp negative rep1 s | sponge isl gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_6neg_S11_L003_R1_001.fastq.gz | fastq | 681771213.0 | 9052615.0 | E MTAB 7846:sponge isl gfp negative rep1 lane3 | 0:75.31 1:0 | A:185717696;C:154552039;G:159567102;T:181919781;N:14595 | 75 | 0 | 185717696 | 154552039 | 159567102 | 181919781 | 14595 | ERX3292996 | ERS3358379 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94923 | 0.07768 | 0.69167 | 0.47219 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9682 | 9682 | ERR3266367 | ERX3292996 | ERS3358379 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp negative rep1 | SAMEA5556339 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556339|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp negative rep1 s | sponge isl gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_6neg_S11_L004_R1_001.fastq.gz | fastq | 671169917.0 | 8911624.0 | E MTAB 7846:sponge isl gfp negative rep1 lane4 | 0:75.31 1:0 | A:182910490;C:152045814;G:157010053;T:179186548;N:17012 | 75 | 0 | 182910490 | 152045814 | 157010053 | 179186548 | 17012 | ERX3292996 | ERS3358379 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94941 | 0.07612 | 0.69106 | 0.47736 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9683 | 9683 | ERR3266360 | ERX3292995 | ERS3358378 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp positive rep2 | SAMEA5556338 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556338|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp positive rep2 s | sponge ccn gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_8pos_S6_L001_R1_001.fastq.gz | fastq | 745666738.0 | 9917771.0 | E MTAB 7846:sponge ccn gfp positive rep2 lane1 | 0:75.18 1:0 | A:207714377;C:163732420;G:169037726;T:205161925;N:20290 | 75 | 0 | 207714377 | 163732420 | 169037726 | 205161925 | 20290 | ERX3292995 | ERS3358378 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94006 | 0.17809 | 0.68166 | 0.48912 | 74 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9684 | 9684 | ERR3266361 | ERX3292995 | ERS3358378 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp positive rep2 | SAMEA5556338 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556338|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp positive rep2 s | sponge ccn gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_8pos_S6_L002_R1_001.fastq.gz | fastq | 747693645.0 | 9944395.0 | E MTAB 7846:sponge ccn gfp positive rep2 lane2 | 0:75.19 1:0 | A:208257288;C:164106384;G:169478025;T:205830399;N:21549 | 75 | 0 | 208257288 | 164106384 | 169478025 | 205830399 | 21549 | ERX3292995 | ERS3358378 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.93873 | 0.17738 | 0.68296 | 0.49656 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9685 | 9685 | ERR3266362 | ERX3292995 | ERS3358378 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp positive rep2 | SAMEA5556338 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556338|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp positive rep2 s | sponge ccn gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_8pos_S6_L003_R1_001.fastq.gz | fastq | 756134124.0 | 10056818.0 | E MTAB 7846:sponge ccn gfp positive rep2 lane3 | 0:75.19 1:0 | A:210573012;C:166089133;G:171475300;T:207973232;N:23447 | 75 | 0 | 210573012 | 166089133 | 171475300 | 207973232 | 23447 | ERX3292995 | ERS3358378 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94077 | 0.18001 | 0.68004 | 0.49812 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9686 | 9686 | ERR3266363 | ERX3292995 | ERS3358378 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp positive rep2 | SAMEA5556338 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556338|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp positive rep2 s | sponge ccn gfp positive rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_8pos_S6_L004_R1_001.fastq.gz | fastq | 747687619.0 | 9944417.0 | E MTAB 7846:sponge ccn gfp positive rep2 lane4 | 0:75.19 1:0 | A:208315943;C:164104155;G:169484250;T:205757712;N:25559 | 75 | 0 | 208315943 | 164104155 | 169484250 | 205757712 | 25559 | ERX3292995 | ERS3358378 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.94025 | 0.17965 | 0.68124 | 0.49249 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9687 | 9687 | ERR3266356 | ERX3292994 | ERS3358377 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp positive rep1 | SAMEA5556337 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556337|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp positive rep1 s | sponge ccn gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_7pos_S8_L001_R1_001.fastq.gz | fastq | 600153564.0 | 7972767.0 | E MTAB 7846:sponge ccn gfp positive rep1 lane1 | 0:75.28 1:0 | A:165075878;C:133961511;G:138306424;T:162797903;N:11848 | 75 | 0 | 165075878 | 133961511 | 138306424 | 162797903 | 11848 | ERX3292994 | ERS3358377 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95367 | 0.14146 | 0.69154 | 0.46621 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9688 | 9688 | ERR3266357 | ERX3292994 | ERS3358377 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp positive rep1 | SAMEA5556337 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556337|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp positive rep1 s | sponge ccn gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_7pos_S8_L002_R1_001.fastq.gz | fastq | 600790169.0 | 7981038.0 | E MTAB 7846:sponge ccn gfp positive rep1 lane2 | 0:75.28 1:0 | A:165262968;C:133988329;G:138458635;T:163066854;N:13383 | 75 | 0 | 165262968 | 133988329 | 138458635 | 163066854 | 13383 | ERX3292994 | ERS3358377 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95365 | 0.14116 | 0.69301 | 0.46836 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9689 | 9689 | ERR3266358 | ERX3292994 | ERS3358377 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp positive rep1 | SAMEA5556337 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556337|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp positive rep1 s | sponge ccn gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_7pos_S8_L003_R1_001.fastq.gz | fastq | 608611085.0 | 8084904.0 | E MTAB 7846:sponge ccn gfp positive rep1 lane3 | 0:75.28 1:0 | A:167402055;C:135871708;G:140314669;T:165009252;N:13401 | 75 | 0 | 167402055 | 135871708 | 140314669 | 165009252 | 13401 | ERX3292994 | ERS3358377 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95403 | 0.14167 | 0.69311 | 0.4702 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9690 | 9690 | ERR3266359 | ERX3292994 | ERS3358377 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp positive rep1 | SAMEA5556337 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556337|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp positive rep1 s | sponge ccn gfp positive rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_7pos_S8_L004_R1_001.fastq.gz | fastq | 599558663.0 | 7964718.0 | E MTAB 7846:sponge ccn gfp positive rep1 lane4 | 0:75.28 1:0 | A:164965131;C:133749666;G:138194884;T:162633558;N:15424 | 75 | 0 | 164965131 | 133749666 | 138194884 | 162633558 | 15424 | ERX3292994 | ERS3358377 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95285 | 0.14085 | 0.69037 | 0.47345 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9691 | 9691 | ERR3266352 | ERX3292993 | ERS3358376 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp negative rep2 | SAMEA5556336 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556336|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp negative rep2 s | sponge ccn gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_8neg_S5_L001_R1_001.fastq.gz | fastq | 599599608.0 | 7970460.0 | E MTAB 7846:sponge ccn gfp negative rep2 lane1 | 0:75.23 1:0 | A:162236409;C:136907675;G:141538730;T:158902520;N:14274 | 75 | 0 | 162236409 | 136907675 | 141538730 | 158902520 | 14274 | ERX3292993 | ERS3358376 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95404 | 0.05923 | 0.69737 | 0.48627 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9692 | 9692 | ERR3266353 | ERX3292993 | ERS3358376 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp negative rep2 | SAMEA5556336 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556336|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp negative rep2 s | sponge ccn gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_8neg_S5_L002_R1_001.fastq.gz | fastq | 600057776.0 | 7976438.0 | E MTAB 7846:sponge ccn gfp negative rep2 lane2 | 0:75.23 1:0 | A:162367410;C:136994919;G:141577782;T:159102194;N:15471 | 75 | 0 | 162367410 | 136994919 | 141577782 | 159102194 | 15471 | ERX3292993 | ERS3358376 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.953 | 0.06085 | 0.6952 | 0.48868 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9693 | 9693 | ERR3266354 | ERX3292993 | ERS3358376 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp negative rep2 | SAMEA5556336 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556336|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp negative rep2 s | sponge ccn gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_8neg_S5_L003_R1_001.fastq.gz | fastq | 607089697.0 | 8069901.0 | E MTAB 7846:sponge ccn gfp negative rep2 lane3 | 0:75.23 1:0 | A:164235344;C:138684000;G:143335680;T:160819270;N:15403 | 75 | 0 | 164235344 | 138684000 | 143335680 | 160819270 | 15403 | ERX3292993 | ERS3358376 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95245 | 0.06055 | 0.69589 | 0.48813 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9694 | 9694 | ERR3266355 | ERX3292993 | ERS3358376 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp negative rep2 | SAMEA5556336 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556336|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp negative rep2 s | sponge ccn gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_8neg_S5_L004_R1_001.fastq.gz | fastq | 598098243.0 | 7950223.0 | E MTAB 7846:sponge ccn gfp negative rep2 lane4 | 0:75.23 1:0 | A:161836808;C:136564804;G:141157424;T:158521860;N:17347 | 75 | 0 | 161836808 | 136564804 | 141157424 | 158521860 | 17347 | ERX3292993 | ERS3358376 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95299 | 0.06032 | 0.69501 | 0.48928 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9695 | 9695 | ERR3266348 | ERX3292992 | ERS3358375 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp negative rep1 | SAMEA5556335 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556335|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp negative rep1 s | sponge ccn gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_7neg_S7_L001_R1_001.fastq.gz | fastq | 668175990.0 | 8872549.0 | E MTAB 7846:sponge ccn gfp negative rep1 lane1 | 0:75.31 1:0 | A:179859350;C:153483169;G:158360605;T:176462088;N:10778 | 75 | 0 | 179859350 | 153483169 | 158360605 | 176462088 | 10778 | ERX3292992 | ERS3358375 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.95955 | 0.07154 | 0.69696 | 0.46425 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9696 | 9696 | ERR3266349 | ERX3292992 | ERS3358375 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp negative rep1 | SAMEA5556335 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556335|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp negative rep1 s | sponge ccn gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_7neg_S7_L002_R1_001.fastq.gz | fastq | 668154755.0 | 8872093.0 | E MTAB 7846:sponge ccn gfp negative rep1 lane2 | 0:75.31 1:0 | A:179811687;C:153454931;G:158314391;T:176560936;N:12810 | 75 | 0 | 179811687 | 153454931 | 158314391 | 176560936 | 12810 | ERX3292992 | ERS3358375 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.96029 | 0.06969 | 0.69684 | 0.46725 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9697 | 9697 | ERR3266350 | ERX3292992 | ERS3358375 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp negative rep1 | SAMEA5556335 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556335|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp negative rep1 s | sponge ccn gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_7neg_S7_L003_R1_001.fastq.gz | fastq | 676984426.0 | 8989004.0 | E MTAB 7846:sponge ccn gfp negative rep1 lane3 | 0:75.31 1:0 | A:182159685;C:155578195;G:160511499;T:178722363;N:12684 | 75 | 0 | 182159685 | 155578195 | 160511499 | 178722363 | 12684 | ERX3292992 | ERS3358375 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.96012 | 0.07159 | 0.69554 | 0.46811 | 75 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 9698 | 9698 | ERR3266351 | ERX3292992 | ERS3358375 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge ccn gfp negative rep1 | SAMEA5556335 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556335|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge ccn gfp negative rep1 s | sponge ccn gfp negative rep1 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E6_7neg_S7_L004_R1_001.fastq.gz | fastq | 666031892.0 | 8843695.0 | E MTAB 7846:sponge ccn gfp negative rep1 lane4 | 0:75.31 1:0 | A:179243298;C:152946459;G:157873912;T:175953752;N:14471 | 75 | 0 | 179243298 | 152946459 | 157873912 | 175953752 | 14471 | ERX3292992 | ERS3358375 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.96014 | 0.07169 | 0.69493 | 0.47058 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 10237 | 10237 | ERR7131169 | ERX6698608 | ERS8070397 | ERP132560 | PRJEB48218 | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E-MTAB-11083 | Transcriptome Analysis | To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb. | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | F8 Nega | SAMEA10418613 | Friedrich Miescher Institute for Biomedical Research | ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418613|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F8 Nega|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry /GFP |genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]|individual:pool 8|organism part:olfactory bulb|sample name:E MTAB 11083:F8 Nega|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E MTAB 11083:F8 Nega s | F8 Nega s | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | Experimental Factor: fraction:mCherry /GFP | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP132560 | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | 2874F22-1_210715_D00404_0538_BCD91CANXX_TCGACGTC-CTAAGCCT_L006_R1_001.fastq.gz | fastq | 658093749.0 | 12903799.0 | E MTAB 11083:2874F22 1 210715 D00404 0538 BCD91CANXX TCGACGTC CTAAGCCT L006 | 0:51 1:0 | A:173355262;C:152464129;G:147489024;T:184739885;N:45449 | 51 | 0 | 173355262 | 152464129 | 147489024 | 184739885 | 45449 | ERX6698608 | ERS8070397 | ERA6757553 | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | 1 | 0.78328 | 0.15147 | 0.71289 | 0.53671 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Switzerland | 2021-12-01 | Adult | Adult | Brain | Nervous System | |||||||||||||||||||
| 10238 | 10238 | ERR7131170 | ERX6698608 | ERS8070397 | ERP132560 | PRJEB48218 | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E-MTAB-11083 | Transcriptome Analysis | To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb. | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | F8 Nega | SAMEA10418613 | Friedrich Miescher Institute for Biomedical Research | ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418613|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F8 Nega|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry /GFP |genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]|individual:pool 8|organism part:olfactory bulb|sample name:E MTAB 11083:F8 Nega|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E MTAB 11083:F8 Nega s | F8 Nega s | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | Experimental Factor: fraction:mCherry /GFP | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP132560 | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | 2874F22-2_210715_D00404_0538_BCD91CANXX_TCGACGTC-CTAAGCCT_L007_R1_001.fastq.gz | fastq | 661103769.0 | 12962819.0 | E MTAB 11083:2874F22 2 210715 D00404 0538 BCD91CANXX TCGACGTC CTAAGCCT L007 | 0:51 1:0 | A:174223249;C:153223284;G:148276805;T:185335092;N:45339 | 51 | 0 | 174223249 | 153223284 | 148276805 | 185335092 | 45339 | ERX6698608 | ERS8070397 | ERA6757553 | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | 1 | 0.78539 | 0.15054 | 0.70897 | 0.5322 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Switzerland | 2021-12-01 | Adult | Adult | Brain | Nervous System | |||||||||||||||||||
| 10239 | 10239 | ERR7131167 | ERX6698607 | ERS8070396 | ERP132560 | PRJEB48218 | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E-MTAB-11083 | Transcriptome Analysis | To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb. | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | F8 mCherry GFP | SAMEA10418612 | Friedrich Miescher Institute for Biomedical Research | ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418612|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F8 mCherry GFP|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP+|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]|individual:pool 8|organism part:olfactory bulb|sample name:E MTAB 11083:F8 mCherry GFP|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E MTAB 11083:F8 mCherry GFP s | F8 mCherry GFP s | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | Experimental Factor: fraction:mCherry+/GFP+ | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP132560 | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | 2874F24-1_210715_D00404_0538_BCD91CANXX_TCGACGTC-TCTCTCCG_L006_R1_001.fastq.gz | fastq | 693183636.0 | 13591836.0 | E MTAB 11083:2874F24 1 210715 D00404 0538 BCD91CANXX TCGACGTC TCTCTCCG L006 | 0:51 1:0 | A:183977687;C:159275153;G:153149826;T:196732022;N:48948 | 51 | 0 | 183977687 | 159275153 | 153149826 | 196732022 | 48948 | ERX6698607 | ERS8070396 | ERA6757553 | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | 1 | 0.68942 | 0.15593 | 0.75828 | 0.51858 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Switzerland | 2021-12-01 | Adult | Adult | Brain | Nervous System | |||||||||||||||||||
| 10240 | 10240 | ERR7131168 | ERX6698607 | ERS8070396 | ERP132560 | PRJEB48218 | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E-MTAB-11083 | Transcriptome Analysis | To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb. | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | F8 mCherry GFP | SAMEA10418612 | Friedrich Miescher Institute for Biomedical Research | ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418612|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F8 mCherry GFP|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP+|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]|individual:pool 8|organism part:olfactory bulb|sample name:E MTAB 11083:F8 mCherry GFP|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E MTAB 11083:F8 mCherry GFP s | F8 mCherry GFP s | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | Experimental Factor: fraction:mCherry+/GFP+ | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP132560 | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | 2874F24-2_210715_D00404_0538_BCD91CANXX_TCGACGTC-TCTCTCCG_L007_R1_001.fastq.gz | fastq | 696648678.0 | 13659778.0 | E MTAB 11083:2874F24 2 210715 D00404 0538 BCD91CANXX TCGACGTC TCTCTCCG L007 | 0:51 1:0 | A:184971832;C:160126524;G:154012023;T:197490098;N:48201 | 51 | 0 | 184971832 | 160126524 | 154012023 | 197490098 | 48201 | ERX6698607 | ERS8070396 | ERA6757553 | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | 1 | 0.6906 | 0.15634 | 0.75909 | 0.51346 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Switzerland | 2021-12-01 | Adult | Adult | Brain | Nervous System | |||||||||||||||||||
| 10241 | 10241 | ERR7131165 | ERX6698606 | ERS8070395 | ERP132560 | PRJEB48218 | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E-MTAB-11083 | Transcriptome Analysis | To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb. | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | F8 mCherry | SAMEA10418611 | Friedrich Miescher Institute for Biomedical Research | ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418611|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F8 mCherry|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP |genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]|individual:pool 8|organism part:olfactory bulb|sample name:E MTAB 11083:F8 mCherry|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E MTAB 11083:F8 mCherry s | F8 mCherry s | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | Experimental Factor: fraction:mCherry+/GFP | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP132560 | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | 2874F23-1_210715_D00404_0538_BCD91CANXX_TCGACGTC-CGTCTAAT_L006_R1_001.fastq.gz | fastq | 667760646.0 | 13093346.0 | E MTAB 11083:2874F23 1 210715 D00404 0538 BCD91CANXX TCGACGTC CGTCTAAT L006 | 0:51 1:0 | A:179948739;C:150541918;G:145038845;T:192184092;N:47052 | 51 | 0 | 179948739 | 150541918 | 145038845 | 192184092 | 47052 | ERX6698606 | ERS8070395 | ERA6757553 | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | 1 | 0.71661 | 0.19774 | 0.74576 | 0.52117 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Switzerland | 2021-12-01 | Adult | Adult | Brain | Nervous System | |||||||||||||||||||
| 10242 | 10242 | ERR7131166 | ERX6698606 | ERS8070395 | ERP132560 | PRJEB48218 | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E-MTAB-11083 | Transcriptome Analysis | To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb. | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | F8 mCherry | SAMEA10418611 | Friedrich Miescher Institute for Biomedical Research | ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418611|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F8 mCherry|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP |genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]|individual:pool 8|organism part:olfactory bulb|sample name:E MTAB 11083:F8 mCherry|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E MTAB 11083:F8 mCherry s | F8 mCherry s | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | Experimental Factor: fraction:mCherry+/GFP | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP132560 | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | 2874F23-2_210715_D00404_0538_BCD91CANXX_TCGACGTC-CGTCTAAT_L007_R1_001.fastq.gz | fastq | 670970484.0 | 13156284.0 | E MTAB 11083:2874F23 2 210715 D00404 0538 BCD91CANXX TCGACGTC CGTCTAAT L007 | 0:51 1:0 | A:180906557;C:151329492;G:145816347;T:192872804;N:45284 | 51 | 0 | 180906557 | 151329492 | 145816347 | 192872804 | 45284 | ERX6698606 | ERS8070395 | ERA6757553 | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | 1 | 0.71682 | 0.19902 | 0.74517 | 0.52618 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Switzerland | 2021-12-01 | Adult | Adult | Brain | Nervous System | |||||||||||||||||||
| 10243 | 10243 | ERR7131163 | ERX6698605 | ERS8070394 | ERP132560 | PRJEB48218 | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E-MTAB-11083 | Transcriptome Analysis | To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb. | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | F7 Nega | SAMEA10418610 | Friedrich Miescher Institute for Biomedical Research | ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418610|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F7 Nega|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry /GFP |genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]|individual:pool 7|organism part:olfactory bulb|sample name:E MTAB 11083:F7 Nega|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E MTAB 11083:F7 Nega s | F7 Nega s | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | Experimental Factor: fraction:mCherry /GFP | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP132560 | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | 2874F19-1_210715_D00404_0538_BCD91CANXX_TCGACGTC-GTAAGGAG_L006_R1_001.fastq.gz | fastq | 652205238.0 | 12788338.0 | E MTAB 11083:2874F19 1 210715 D00404 0538 BCD91CANXX TCGACGTC GTAAGGAG L006 | 0:51 1:0 | A:173730405;C:149044598;G:145436777;T:183946928;N:46530 | 51 | 0 | 173730405 | 149044598 | 145436777 | 183946928 | 46530 | ERX6698605 | ERS8070394 | ERA6757553 | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | 1 | 0.80595 | 0.17309 | 0.71003 | 0.53696 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Switzerland | 2021-12-01 | Adult | Adult | Brain | Nervous System | |||||||||||||||||||
| 10244 | 10244 | ERR7131164 | ERX6698605 | ERS8070394 | ERP132560 | PRJEB48218 | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E-MTAB-11083 | Transcriptome Analysis | To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb. | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | F7 Nega | SAMEA10418610 | Friedrich Miescher Institute for Biomedical Research | ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418610|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F7 Nega|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry /GFP |genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]|individual:pool 7|organism part:olfactory bulb|sample name:E MTAB 11083:F7 Nega|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E MTAB 11083:F7 Nega s | F7 Nega s | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | Experimental Factor: fraction:mCherry /GFP | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP132560 | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | 2874F19-2_210715_D00404_0538_BCD91CANXX_TCGACGTC-GTAAGGAG_L007_R1_001.fastq.gz | fastq | 655593423.0 | 12854773.0 | E MTAB 11083:2874F19 2 210715 D00404 0538 BCD91CANXX TCGACGTC GTAAGGAG L007 | 0:51 1:0 | A:174715119;C:149844974;G:146250446;T:184737535;N:45349 | 51 | 0 | 174715119 | 149844974 | 146250446 | 184737535 | 45349 | ERX6698605 | ERS8070394 | ERA6757553 | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | 1 | 0.80585 | 0.17497 | 0.71078 | 0.53767 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Switzerland | 2021-12-01 | Adult | Adult | Brain | Nervous System | |||||||||||||||||||
| 10245 | 10245 | ERR7131161 | ERX6698604 | ERS8070393 | ERP132560 | PRJEB48218 | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E-MTAB-11083 | Transcriptome Analysis | To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb. | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | F7 mCherry GFP | SAMEA10418609 | Friedrich Miescher Institute for Biomedical Research | ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418609|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F7 mCherry GFP|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP+|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]|individual:pool 7|organism part:olfactory bulb|sample name:E MTAB 11083:F7 mCherry GFP|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E MTAB 11083:F7 mCherry GFP s | F7 mCherry GFP s | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | Experimental Factor: fraction:mCherry+/GFP+ | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP132560 | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | 2874F21-1_210715_D00404_0538_BCD91CANXX_TCGACGTC-AAGGAGTA_L006_R1_001.fastq.gz | fastq | 661067151.0 | 12962101.0 | E MTAB 11083:2874F21 1 210715 D00404 0538 BCD91CANXX TCGACGTC AAGGAGTA L006 | 0:51 1:0 | A:168281419;C:157701209;G:153487197;T:181550252;N:47074 | 51 | 0 | 168281419 | 157701209 | 153487197 | 181550252 | 47074 | ERX6698604 | ERS8070393 | ERA6757553 | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | 1 | 0.39074 | 0.11592 | 0.82615 | 0.5252 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Switzerland | 2021-12-01 | Adult | Adult | Brain | Nervous System | |||||||||||||||||||
| 10246 | 10246 | ERR7131162 | ERX6698604 | ERS8070393 | ERP132560 | PRJEB48218 | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E-MTAB-11083 | Transcriptome Analysis | To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb. | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | F7 mCherry GFP | SAMEA10418609 | Friedrich Miescher Institute for Biomedical Research | ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418609|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F7 mCherry GFP|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP+|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]|individual:pool 7|organism part:olfactory bulb|sample name:E MTAB 11083:F7 mCherry GFP|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E MTAB 11083:F7 mCherry GFP s | F7 mCherry GFP s | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | Experimental Factor: fraction:mCherry+/GFP+ | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP132560 | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | 2874F21-2_210715_D00404_0538_BCD91CANXX_TCGACGTC-AAGGAGTA_L007_R1_001.fastq.gz | fastq | 665709018.0 | 13053118.0 | E MTAB 11083:2874F21 2 210715 D00404 0538 BCD91CANXX TCGACGTC AAGGAGTA L007 | 0:51 1:0 | A:169539998;C:158884603;G:154624803;T:182614264;N:45350 | 51 | 0 | 169539998 | 158884603 | 154624803 | 182614264 | 45350 | ERX6698604 | ERS8070393 | ERA6757553 | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | 1 | 0.38966 | 0.1152 | 0.8258 | 0.53305 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Switzerland | 2021-12-01 | Adult | Adult | Brain | Nervous System | |||||||||||||||||||
| 10247 | 10247 | ERR7131159 | ERX6698603 | ERS8070392 | ERP132560 | PRJEB48218 | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E-MTAB-11083 | Transcriptome Analysis | To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb. | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | F7 mCherry | SAMEA10418608 | Friedrich Miescher Institute for Biomedical Research | ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418608|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F7 mCherry|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP |genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]|individual:pool 7|organism part:olfactory bulb|sample name:E MTAB 11083:F7 mCherry|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E MTAB 11083:F7 mCherry s | F7 mCherry s | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | Experimental Factor: fraction:mCherry+/GFP | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP132560 | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | 2874F20-1_210715_D00404_0538_BCD91CANXX_TCGACGTC-ACTGCATA_L006_R1_001.fastq.gz | fastq | 657813402.0 | 12898302.0 | E MTAB 11083:2874F20 1 210715 D00404 0538 BCD91CANXX TCGACGTC ACTGCATA L006 | 0:51 1:0 | A:175873489;C:149476129;G:143987770;T:188429588;N:46426 | 51 | 0 | 175873489 | 149476129 | 143987770 | 188429588 | 46426 | ERX6698603 | ERS8070392 | ERA6757553 | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | 1 | 0.70507 | 0.2048 | 0.75923 | 0.52828 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Switzerland | 2021-12-01 | Adult | Adult | Brain | Nervous System | |||||||||||||||||||
| 10248 | 10248 | ERR7131160 | ERX6698603 | ERS8070392 | ERP132560 | PRJEB48218 | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E-MTAB-11083 | Transcriptome Analysis | To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb. | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | F7 mCherry | SAMEA10418608 | Friedrich Miescher Institute for Biomedical Research | ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418608|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F7 mCherry|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP |genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]|individual:pool 7|organism part:olfactory bulb|sample name:E MTAB 11083:F7 mCherry|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E MTAB 11083:F7 mCherry s | F7 mCherry s | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | Experimental Factor: fraction:mCherry+/GFP | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP132560 | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | 2874F20-2_210715_D00404_0538_BCD91CANXX_TCGACGTC-ACTGCATA_L007_R1_001.fastq.gz | fastq | 660303426.0 | 12947126.0 | E MTAB 11083:2874F20 2 210715 D00404 0538 BCD91CANXX TCGACGTC ACTGCATA L007 | 0:51 1:0 | A:176607119;C:150065781;G:144613110;T:188972809;N:44607 | 51 | 0 | 176607119 | 150065781 | 144613110 | 188972809 | 44607 | ERX6698603 | ERS8070392 | ERA6757553 | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | 1 | 0.70705 | 0.20314 | 0.75852 | 0.52949 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Switzerland | 2021-12-01 | Adult | Adult | Brain | Nervous System | |||||||||||||||||||
| 10249 | 10249 | ERR7131157 | ERX6698602 | ERS8070391 | ERP132560 | PRJEB48218 | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E-MTAB-11083 | Transcriptome Analysis | To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb. | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | F6 Nega | SAMEA10418607 | Friedrich Miescher Institute for Biomedical Research | ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418607|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F6 Nega|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry /GFP |genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]|individual:pool 6|organism part:olfactory bulb|sample name:E MTAB 11083:F6 Nega|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E MTAB 11083:F6 Nega s | F6 Nega s | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | Experimental Factor: fraction:mCherry /GFP | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP132560 | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | 2874F16-1_210715_D00404_0538_BCD91CANXX_TGCAGCTA-TCTCTCCG_L006_R1_001.fastq.gz | fastq | 669627450.0 | 13129950.0 | E MTAB 11083:2874F16 1 210715 D00404 0538 BCD91CANXX TGCAGCTA TCTCTCCG L006 | 0:51 1:0 | A:177483937;C:154097051;G:148063012;T:189935690;N:47760 | 51 | 0 | 177483937 | 154097051 | 148063012 | 189935690 | 47760 | ERX6698602 | ERS8070391 | ERA6757553 | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | 1 | 0.77183 | 0.16001 | 0.71467 | 0.53352 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Switzerland | 2021-12-01 | Adult | Adult | Brain | Nervous System | |||||||||||||||||||
| 10250 | 10250 | ERR7131158 | ERX6698602 | ERS8070391 | ERP132560 | PRJEB48218 | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E-MTAB-11083 | Transcriptome Analysis | To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb. | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | F6 Nega | SAMEA10418607 | Friedrich Miescher Institute for Biomedical Research | ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418607|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F6 Nega|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry /GFP |genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]|individual:pool 6|organism part:olfactory bulb|sample name:E MTAB 11083:F6 Nega|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E MTAB 11083:F6 Nega s | F6 Nega s | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | Experimental Factor: fraction:mCherry /GFP | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP132560 | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | 2874F16-2_210715_D00404_0538_BCD91CANXX_TGCAGCTA-TCTCTCCG_L007_R1_001.fastq.gz | fastq | 671615073.0 | 13168923.0 | E MTAB 11083:2874F16 2 210715 D00404 0538 BCD91CANXX TGCAGCTA TCTCTCCG L007 | 0:51 1:0 | A:178109157;C:154619024;G:148595207;T:190246469;N:45216 | 51 | 0 | 178109157 | 154619024 | 148595207 | 190246469 | 45216 | ERX6698602 | ERS8070391 | ERA6757553 | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | 1 | 0.77284 | 0.15963 | 0.71569 | 0.53038 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Switzerland | 2021-12-01 | Adult | Adult | Brain | Nervous System | |||||||||||||||||||
| 10251 | 10251 | ERR7131155 | ERX6698601 | ERS8070390 | ERP132560 | PRJEB48218 | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E-MTAB-11083 | Transcriptome Analysis | To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb. | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | F6 mCherry GFP | SAMEA10418606 | Friedrich Miescher Institute for Biomedical Research | ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418606|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F6 mCherry GFP|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP+|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]|individual:pool 6|organism part:olfactory bulb|sample name:E MTAB 11083:F6 mCherry GFP|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E MTAB 11083:F6 mCherry GFP s | F6 mCherry GFP s | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | Experimental Factor: fraction:mCherry+/GFP+ | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP132560 | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | 2874F18-1_210715_D00404_0538_BCD91CANXX_TCGACGTC-TATCCTCT_L006_R1_001.fastq.gz | fastq | 667663542.0 | 13091442.0 | E MTAB 11083:2874F18 1 210715 D00404 0538 BCD91CANXX TCGACGTC TATCCTCT L006 | 0:51 1:0 | A:177646483;C:152747528;G:146388226;T:190833951;N:47354 | 51 | 0 | 177646483 | 152747528 | 146388226 | 190833951 | 47354 | ERX6698601 | ERS8070390 | ERA6757553 | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | 1 | 0.67964 | 0.18123 | 0.77193 | 0.53313 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Switzerland | 2021-12-01 | Adult | Adult | Brain | Nervous System | |||||||||||||||||||
| 10252 | 10252 | ERR7131156 | ERX6698601 | ERS8070390 | ERP132560 | PRJEB48218 | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E-MTAB-11083 | Transcriptome Analysis | To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb. | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | F6 mCherry GFP | SAMEA10418606 | Friedrich Miescher Institute for Biomedical Research | ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418606|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F6 mCherry GFP|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP+|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]|individual:pool 6|organism part:olfactory bulb|sample name:E MTAB 11083:F6 mCherry GFP|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E MTAB 11083:F6 mCherry GFP s | F6 mCherry GFP s | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | Experimental Factor: fraction:mCherry+/GFP+ | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP132560 | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | 2874F18-2_210715_D00404_0538_BCD91CANXX_TCGACGTC-TATCCTCT_L007_R1_001.fastq.gz | fastq | 670170141.0 | 13140591.0 | E MTAB 11083:2874F18 2 210715 D00404 0538 BCD91CANXX TCGACGTC TATCCTCT L007 | 0:51 1:0 | A:178425395;C:153363855;G:147033779;T:191300976;N:46136 | 51 | 0 | 178425395 | 153363855 | 147033779 | 191300976 | 46136 | ERX6698601 | ERS8070390 | ERA6757553 | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | 1 | 0.67922 | 0.18101 | 0.77141 | 0.53601 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Switzerland | 2021-12-01 | Adult | Adult | Brain | Nervous System | |||||||||||||||||||
| 10253 | 10253 | ERR7131153 | ERX6698600 | ERS8070389 | ERP132560 | PRJEB48218 | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E-MTAB-11083 | Transcriptome Analysis | To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb. | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | F6 mCherry | SAMEA10418605 | Friedrich Miescher Institute for Biomedical Research | ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418605|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F6 mCherry|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP |genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]|individual:pool 6|organism part:olfactory bulb|sample name:E MTAB 11083:F6 mCherry|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E MTAB 11083:F6 mCherry s | F6 mCherry s | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | Experimental Factor: fraction:mCherry+/GFP | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP132560 | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | 2874F17-1_210715_D00404_0538_BCD91CANXX_TCGACGTC-CTCTCTAT_L006_R1_001.fastq.gz | fastq | 677617008.0 | 13286608.0 | E MTAB 11083:2874F17 1 210715 D00404 0538 BCD91CANXX TCGACGTC CTCTCTAT L006 | 0:51 1:0 | A:181785899;C:152797687;G:147070676;T:195914808;N:47938 | 51 | 0 | 181785899 | 152797687 | 147070676 | 195914808 | 47938 | ERX6698600 | ERS8070389 | ERA6757553 | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | 1 | 0.68298 | 0.1953 | 0.76292 | 0.5395 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Switzerland | 2021-12-01 | Adult | Adult | Brain | Nervous System | |||||||||||||||||||
| 10254 | 10254 | ERR7131154 | ERX6698600 | ERS8070389 | ERP132560 | PRJEB48218 | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E-MTAB-11083 | Transcriptome Analysis | To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb. | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | F6 mCherry | SAMEA10418605 | Friedrich Miescher Institute for Biomedical Research | ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418605|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F6 mCherry|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP |genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]|individual:pool 6|organism part:olfactory bulb|sample name:E MTAB 11083:F6 mCherry|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E MTAB 11083:F6 mCherry s | F6 mCherry s | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | Experimental Factor: fraction:mCherry+/GFP | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP132560 | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | 2874F17-2_210715_D00404_0538_BCD91CANXX_TCGACGTC-CTCTCTAT_L007_R1_001.fastq.gz | fastq | 679922973.0 | 13331823.0 | E MTAB 11083:2874F17 2 210715 D00404 0538 BCD91CANXX TCGACGTC CTCTCTAT L007 | 0:51 1:0 | A:182567819;C:153380607;G:147589890;T:196337722;N:46935 | 51 | 0 | 182567819 | 153380607 | 147589890 | 196337722 | 46935 | ERX6698600 | ERS8070389 | ERA6757553 | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | 1 | 0.68391 | 0.19726 | 0.76299 | 0.54099 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Switzerland | 2021-12-01 | Adult | Adult | Brain | Nervous System | |||||||||||||||||||
| 10255 | 10255 | ERR7131151 | ERX6698599 | ERS8070388 | ERP132560 | PRJEB48218 | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E-MTAB-11083 | Transcriptome Analysis | To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb. | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | F5 Nega | SAMEA10418604 | Friedrich Miescher Institute for Biomedical Research | ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418604|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F5 Nega|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry /GFP |genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]|individual:pool 5|organism part:olfactory bulb|sample name:E MTAB 11083:F5 Nega|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E MTAB 11083:F5 Nega s | F5 Nega s | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | Experimental Factor: fraction:mCherry /GFP | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP132560 | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | 2874F13-1_210715_D00404_0538_BCD91CANXX_TGCAGCTA-AAGGAGTA_L006_R1_001.fastq.gz | fastq | 620316315.0 | 12163065.0 | E MTAB 11083:2874F13 1 210715 D00404 0538 BCD91CANXX TGCAGCTA AAGGAGTA L006 | 0:51 1:0 | A:165967355;C:141072216;G:136931219;T:176301963;N:43562 | 51 | 0 | 165967355 | 141072216 | 136931219 | 176301963 | 43562 | ERX6698599 | ERS8070388 | ERA6757553 | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | 1 | 0.78924 | 0.17457 | 0.71934 | 0.53563 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Switzerland | 2021-12-01 | Adult | Adult | Brain | Nervous System | |||||||||||||||||||
| 10256 | 10256 | ERR7131152 | ERX6698599 | ERS8070388 | ERP132560 | PRJEB48218 | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E-MTAB-11083 | Transcriptome Analysis | To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb. | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | F5 Nega | SAMEA10418604 | Friedrich Miescher Institute for Biomedical Research | ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418604|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F5 Nega|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry /GFP |genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]|individual:pool 5|organism part:olfactory bulb|sample name:E MTAB 11083:F5 Nega|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E MTAB 11083:F5 Nega s | F5 Nega s | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | Experimental Factor: fraction:mCherry /GFP | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP132560 | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | 2874F13-2_210715_D00404_0538_BCD91CANXX_TGCAGCTA-AAGGAGTA_L007_R1_001.fastq.gz | fastq | 623905338.0 | 12233438.0 | E MTAB 11083:2874F13 2 210715 D00404 0538 BCD91CANXX TGCAGCTA AAGGAGTA L007 | 0:51 1:0 | A:166996253;C:141937637;G:137825206;T:177103504;N:42738 | 51 | 0 | 166996253 | 141937637 | 137825206 | 177103504 | 42738 | ERX6698599 | ERS8070388 | ERA6757553 | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | 1 | 0.78975 | 0.17387 | 0.72153 | 0.54149 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Switzerland | 2021-12-01 | Adult | Adult | Brain | Nervous System | |||||||||||||||||||
| 10257 | 10257 | ERR7131149 | ERX6698598 | ERS8070387 | ERP132560 | PRJEB48218 | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E-MTAB-11083 | Transcriptome Analysis | To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb. | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | F5 mCherry GFP | SAMEA10418603 | Friedrich Miescher Institute for Biomedical Research | ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418603|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F5 mCherry GFP|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP+|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]|individual:pool 5|organism part:olfactory bulb|sample name:E MTAB 11083:F5 mCherry GFP|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E MTAB 11083:F5 mCherry GFP s | F5 mCherry GFP s | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | Experimental Factor: fraction:mCherry+/GFP+ | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP132560 | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | 2874F15-1_210715_D00404_0538_BCD91CANXX_TGCAGCTA-CGTCTAAT_L006_R1_001.fastq.gz | fastq | 670154841.0 | 13140291.0 | E MTAB 11083:2874F15 1 210715 D00404 0538 BCD91CANXX TGCAGCTA CGTCTAAT L006 | 0:51 1:0 | A:182457480;C:149175456;G:144548173;T:193927470;N:46262 | 51 | 0 | 182457480 | 149175456 | 144548173 | 193927470 | 46262 | ERX6698598 | ERS8070387 | ERA6757553 | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | 1 | 0.71875 | 0.18671 | 0.76047 | 0.52398 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Switzerland | 2021-12-01 | Adult | Adult | Brain | Nervous System | |||||||||||||||||||
| 10258 | 10258 | ERR7131150 | ERX6698598 | ERS8070387 | ERP132560 | PRJEB48218 | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E-MTAB-11083 | Transcriptome Analysis | To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb. | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | F5 mCherry GFP | SAMEA10418603 | Friedrich Miescher Institute for Biomedical Research | ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418603|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F5 mCherry GFP|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP+|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]|individual:pool 5|organism part:olfactory bulb|sample name:E MTAB 11083:F5 mCherry GFP|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E MTAB 11083:F5 mCherry GFP s | F5 mCherry GFP s | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | Experimental Factor: fraction:mCherry+/GFP+ | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP132560 | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | 2874F15-2_210715_D00404_0538_BCD91CANXX_TGCAGCTA-CGTCTAAT_L007_R1_001.fastq.gz | fastq | 674202048.0 | 13219648.0 | E MTAB 11083:2874F15 2 210715 D00404 0538 BCD91CANXX TGCAGCTA CGTCTAAT L007 | 0:51 1:0 | A:183639511;C:150168226;G:145502071;T:194847755;N:44485 | 51 | 0 | 183639511 | 150168226 | 145502071 | 194847755 | 44485 | ERX6698598 | ERS8070387 | ERA6757553 | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | 1 | 0.72111 | 0.18813 | 0.76378 | 0.5258 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Switzerland | 2021-12-01 | Adult | Adult | Brain | Nervous System | |||||||||||||||||||
| 10259 | 10259 | ERR7131147 | ERX6698597 | ERS8070386 | ERP132560 | PRJEB48218 | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E-MTAB-11083 | Transcriptome Analysis | To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb. | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | F5 mCherry | SAMEA10418602 | Friedrich Miescher Institute for Biomedical Research | ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418602|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F5 mCherry|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP |genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]|individual:pool 5|organism part:olfactory bulb|sample name:E MTAB 11083:F5 mCherry|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E MTAB 11083:F5 mCherry s | F5 mCherry s | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | Experimental Factor: fraction:mCherry+/GFP | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP132560 | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | 2874F14-1_210715_D00404_0538_BCD91CANXX_TGCAGCTA-CTAAGCCT_L006_R1_001.fastq.gz | fastq | 615458259.0 | 12067809.0 | E MTAB 11083:2874F14 1 210715 D00404 0538 BCD91CANXX TGCAGCTA CTAAGCCT L006 | 0:51 1:0 | A:165108582;C:139178883;G:134070672;T:177059757;N:40365 | 51 | 0 | 165108582 | 139178883 | 134070672 | 177059757 | 40365 | ERX6698597 | ERS8070386 | ERA6757553 | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | 1 | 0.69017 | 0.1977 | 0.77193 | 0.53352 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Switzerland | 2021-12-01 | Adult | Adult | Brain | Nervous System | |||||||||||||||||||
| 10260 | 10260 | ERR7131148 | ERX6698597 | ERS8070386 | ERP132560 | PRJEB48218 | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E-MTAB-11083 | Transcriptome Analysis | To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb. | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | F5 mCherry | SAMEA10418602 | Friedrich Miescher Institute for Biomedical Research | ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418602|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F5 mCherry|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP |genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]|individual:pool 5|organism part:olfactory bulb|sample name:E MTAB 11083:F5 mCherry|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E MTAB 11083:F5 mCherry s | F5 mCherry s | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | Experimental Factor: fraction:mCherry+/GFP | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP132560 | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | 2874F14-2_210715_D00404_0538_BCD91CANXX_TGCAGCTA-CTAAGCCT_L007_R1_001.fastq.gz | fastq | 619061613.0 | 12138463.0 | E MTAB 11083:2874F14 2 210715 D00404 0538 BCD91CANXX TGCAGCTA CTAAGCCT L007 | 0:51 1:0 | A:166167516;C:140058774;G:134972850;T:177822733;N:39740 | 51 | 0 | 166167516 | 140058774 | 134972850 | 177822733 | 39740 | ERX6698597 | ERS8070386 | ERA6757553 | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | 1 | 0.69118 | 0.20019 | 0.7707 | 0.52174 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Switzerland | 2021-12-01 | Adult | Adult | Brain | Nervous System | |||||||||||||||||||
| 10261 | 10261 | ERR7131145 | ERX6698596 | ERS8070385 | ERP132560 | PRJEB48218 | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E-MTAB-11083 | Transcriptome Analysis | To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb. | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | F4 Nega | SAMEA10418601 | Friedrich Miescher Institute for Biomedical Research | ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418601|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F4 Nega|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry /GFP |genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]|individual:pool 4|organism part:olfactory bulb|sample name:E MTAB 11083:F4 Nega|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E MTAB 11083:F4 Nega s | F4 Nega s | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | Experimental Factor: fraction:mCherry /GFP | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP132560 | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | 2874F10-1_210715_D00404_0538_BCD91CANXX_TGCAGCTA-TATCCTCT_L006_R1_001.fastq.gz | fastq | 652536687.0 | 12794837.0 | E MTAB 11083:2874F10 1 210715 D00404 0538 BCD91CANXX TGCAGCTA TATCCTCT L006 | 0:51 1:0 | A:178033231;C:144661707;G:139876661;T:189921085;N:44003 | 51 | 0 | 178033231 | 144661707 | 139876661 | 189921085 | 44003 | ERX6698596 | ERS8070385 | ERA6757553 | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | 1 | 0.76201 | 0.2508 | 0.71299 | 0.53379 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Switzerland | 2021-12-01 | Adult | Adult | Brain | Nervous System | |||||||||||||||||||
| 10262 | 10262 | ERR7131146 | ERX6698596 | ERS8070385 | ERP132560 | PRJEB48218 | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E-MTAB-11083 | Transcriptome Analysis | To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb. | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | F4 Nega | SAMEA10418601 | Friedrich Miescher Institute for Biomedical Research | ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418601|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F4 Nega|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry /GFP |genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]|individual:pool 4|organism part:olfactory bulb|sample name:E MTAB 11083:F4 Nega|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E MTAB 11083:F4 Nega s | F4 Nega s | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | Experimental Factor: fraction:mCherry /GFP | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP132560 | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | 2874F10-2_210715_D00404_0538_BCD91CANXX_TGCAGCTA-TATCCTCT_L007_R1_001.fastq.gz | fastq | 655278957.0 | 12848607.0 | E MTAB 11083:2874F10 2 210715 D00404 0538 BCD91CANXX TGCAGCTA TATCCTCT L007 | 0:51 1:0 | A:178938002;C:145332613;G:140527756;T:190437189;N:43397 | 51 | 0 | 178938002 | 145332613 | 140527756 | 190437189 | 43397 | ERX6698596 | ERS8070385 | ERA6757553 | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | 1 | 0.76188 | 0.25356 | 0.71344 | 0.53081 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Switzerland | 2021-12-01 | Adult | Adult | Brain | Nervous System | |||||||||||||||||||
| 10263 | 10263 | ERR7131143 | ERX6698595 | ERS8070384 | ERP132560 | PRJEB48218 | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E-MTAB-11083 | Transcriptome Analysis | To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb. | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | F4 mCherry GFP | SAMEA10418600 | Friedrich Miescher Institute for Biomedical Research | ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418600|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F4 mCherry GFP|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP+|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]|individual:pool 4|organism part:olfactory bulb|sample name:E MTAB 11083:F4 mCherry GFP|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E MTAB 11083:F4 mCherry GFP s | F4 mCherry GFP s | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | Experimental Factor: fraction:mCherry+/GFP+ | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP132560 | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | 2874F12-1_210715_D00404_0538_BCD91CANXX_TGCAGCTA-ACTGCATA_L006_R1_001.fastq.gz | fastq | 297921855.0 | 5841605.0 | E MTAB 11083:2874F12 1 210715 D00404 0538 BCD91CANXX TGCAGCTA ACTGCATA L006 | 0:51 1:0 | A:82400724;C:65517496;G:64603058;T:85384480;N:16097 | 51 | 0 | 82400724 | 65517496 | 64603058 | 85384480 | 16097 | ERX6698595 | ERS8070384 | ERA6757553 | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | 1 | 0.72496 | 0.20794 | 0.81223 | 0.52529 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Switzerland | 2021-12-01 | Adult | Adult | Brain | Nervous System | |||||||||||||||||||
| 10264 | 10264 | ERR7131144 | ERX6698595 | ERS8070384 | ERP132560 | PRJEB48218 | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E-MTAB-11083 | Transcriptome Analysis | To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb. | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | F4 mCherry GFP | SAMEA10418600 | Friedrich Miescher Institute for Biomedical Research | ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418600|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F4 mCherry GFP|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP+|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]|individual:pool 4|organism part:olfactory bulb|sample name:E MTAB 11083:F4 mCherry GFP|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E MTAB 11083:F4 mCherry GFP s | F4 mCherry GFP s | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | Experimental Factor: fraction:mCherry+/GFP+ | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP132560 | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | 2874F12-2_210715_D00404_0538_BCD91CANXX_TGCAGCTA-ACTGCATA_L007_R1_001.fastq.gz | fastq | 309412971.0 | 6066921.0 | E MTAB 11083:2874F12 2 210715 D00404 0538 BCD91CANXX TGCAGCTA ACTGCATA L007 | 0:51 1:0 | A:85531271;C:68164437;G:67129209;T:88573210;N:14844 | 51 | 0 | 85531271 | 68164437 | 67129209 | 88573210 | 14844 | ERX6698595 | ERS8070384 | ERA6757553 | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | 1 | 0.7245 | 0.20724 | 0.80468 | 0.52791 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Switzerland | 2021-12-01 | Adult | Adult | Brain | Nervous System | |||||||||||||||||||
| 10265 | 10265 | ERR7131141 | ERX6698594 | ERS8070383 | ERP132560 | PRJEB48218 | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E-MTAB-11083 | Transcriptome Analysis | To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb. | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | F4 mCherry | SAMEA10418599 | Friedrich Miescher Institute for Biomedical Research | ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418599|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F4 mCherry|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP |genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]|individual:pool 4|organism part:olfactory bulb|sample name:E MTAB 11083:F4 mCherry|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E MTAB 11083:F4 mCherry s | F4 mCherry s | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | Experimental Factor: fraction:mCherry+/GFP | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP132560 | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | 2874F11-1_210715_D00404_0538_BCD91CANXX_TGCAGCTA-GTAAGGAG_L006_R1_001.fastq.gz | fastq | 672319791.0 | 13182741.0 | E MTAB 11083:2874F11 1 210715 D00404 0538 BCD91CANXX TGCAGCTA GTAAGGAG L006 | 0:51 1:0 | A:181508034;C:150928549;G:146124085;T:193711358;N:47765 | 51 | 0 | 181508034 | 150928549 | 146124085 | 193711358 | 47765 | ERX6698594 | ERS8070383 | ERA6757553 | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | 1 | 0.71726 | 0.19842 | 0.74986 | 0.53363 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Switzerland | 2021-12-01 | Adult | Adult | Brain | Nervous System | |||||||||||||||||||
| 10266 | 10266 | ERR7131142 | ERX6698594 | ERS8070383 | ERP132560 | PRJEB48218 | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E-MTAB-11083 | Transcriptome Analysis | To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb. | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | F4 mCherry | SAMEA10418599 | Friedrich Miescher Institute for Biomedical Research | ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418599|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F4 mCherry|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP |genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]|individual:pool 4|organism part:olfactory bulb|sample name:E MTAB 11083:F4 mCherry|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E MTAB 11083:F4 mCherry s | F4 mCherry s | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | Experimental Factor: fraction:mCherry+/GFP | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP132560 | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | 2874F11-2_210715_D00404_0538_BCD91CANXX_TGCAGCTA-GTAAGGAG_L007_R1_001.fastq.gz | fastq | 675486075.0 | 13244825.0 | E MTAB 11083:2874F11 2 210715 D00404 0538 BCD91CANXX TGCAGCTA GTAAGGAG L007 | 0:51 1:0 | A:182462261;C:151688554;G:146902713;T:194385945;N:46602 | 51 | 0 | 182462261 | 151688554 | 146902713 | 194385945 | 46602 | ERX6698594 | ERS8070383 | ERA6757553 | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | 1 | 0.71745 | 0.19727 | 0.74805 | 0.53092 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Switzerland | 2021-12-01 | Adult | Adult | Brain | Nervous System | |||||||||||||||||||
| 10267 | 10267 | ERR7131139 | ERX6698593 | ERS8070382 | ERP132560 | PRJEB48218 | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E-MTAB-11083 | Transcriptome Analysis | To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb. | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | F3 Nega | SAMEA10418598 | Friedrich Miescher Institute for Biomedical Research | ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418598|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F3 Nega|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry /GFP |genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]|individual:pool 3|organism part:olfactory bulb|sample name:E MTAB 11083:F3 Nega|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E MTAB 11083:F3 Nega s | F3 Nega s | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | Experimental Factor: fraction:mCherry /GFP | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP132560 | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | 2874F7-1_210715_D00404_0538_BCD91CANXX_CGATCAGT-CGTCTAAT_L006_R1_001.fastq.gz | fastq | 630093627.0 | 12354777.0 | E MTAB 11083:2874F7 1 210715 D00404 0538 BCD91CANXX CGATCAGT CGTCTAAT L006 | 0:51 1:0 | A:165132739;C:146179836;G:142796880;T:175940613;N:43559 | 51 | 0 | 165132739 | 146179836 | 142796880 | 175940613 | 43559 | ERX6698593 | ERS8070382 | ERA6757553 | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | 1 | 0.81672 | 0.15219 | 0.71277 | 0.52461 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Switzerland | 2021-12-01 | Adult | Adult | Brain | Nervous System | |||||||||||||||||||
| 10268 | 10268 | ERR7131140 | ERX6698593 | ERS8070382 | ERP132560 | PRJEB48218 | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E-MTAB-11083 | Transcriptome Analysis | To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb. | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | F3 Nega | SAMEA10418598 | Friedrich Miescher Institute for Biomedical Research | ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418598|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F3 Nega|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry /GFP |genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]|individual:pool 3|organism part:olfactory bulb|sample name:E MTAB 11083:F3 Nega|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E MTAB 11083:F3 Nega s | F3 Nega s | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | Experimental Factor: fraction:mCherry /GFP | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP132560 | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | 2874F7-2_210715_D00404_0538_BCD91CANXX_CGATCAGT-CGTCTAAT_L007_R1_001.fastq.gz | fastq | 632305242.0 | 12398142.0 | E MTAB 11083:2874F7 2 210715 D00404 0538 BCD91CANXX CGATCAGT CGTCTAAT L007 | 0:51 1:0 | A:165832174;C:146751895;G:143384539;T:176293313;N:43321 | 51 | 0 | 165832174 | 146751895 | 143384539 | 176293313 | 43321 | ERX6698593 | ERS8070382 | ERA6757553 | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | 1 | 0.81791 | 0.15444 | 0.7151 | 0.52585 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Switzerland | 2021-12-01 | Adult | Adult | Brain | Nervous System | |||||||||||||||||||
| 10269 | 10269 | ERR7131137 | ERX6698592 | ERS8070381 | ERP132560 | PRJEB48218 | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E-MTAB-11083 | Transcriptome Analysis | To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb. | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | F3 mCherry GFP | SAMEA10418597 | Friedrich Miescher Institute for Biomedical Research | ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418597|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F3 mCherry GFP|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP+|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]|individual:pool 3|organism part:olfactory bulb|sample name:E MTAB 11083:F3 mCherry GFP|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E MTAB 11083:F3 mCherry GFP s | F3 mCherry GFP s | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | Experimental Factor: fraction:mCherry+/GFP+ | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP132560 | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | 2874F9-1_210715_D00404_0538_BCD91CANXX_TGCAGCTA-CTCTCTAT_L006_R1_001.fastq.gz | fastq | 660379620.0 | 12948620.0 | E MTAB 11083:2874F9 1 210715 D00404 0538 BCD91CANXX TGCAGCTA CTCTCTAT L006 | 0:51 1:0 | A:178482695;C:147417787;G:143797476;T:190635173;N:46489 | 51 | 0 | 178482695 | 147417787 | 143797476 | 190635173 | 46489 | ERX6698592 | ERS8070381 | ERA6757553 | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | 1 | 0.65635 | 0.17778 | 0.76899 | 0.52957 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Switzerland | 2021-12-01 | Adult | Adult | Brain | Nervous System | |||||||||||||||||||
| 10270 | 10270 | ERR7131138 | ERX6698592 | ERS8070381 | ERP132560 | PRJEB48218 | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E-MTAB-11083 | Transcriptome Analysis | To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb. | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | F3 mCherry GFP | SAMEA10418597 | Friedrich Miescher Institute for Biomedical Research | ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418597|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F3 mCherry GFP|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP+|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]|individual:pool 3|organism part:olfactory bulb|sample name:E MTAB 11083:F3 mCherry GFP|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E MTAB 11083:F3 mCherry GFP s | F3 mCherry GFP s | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | Experimental Factor: fraction:mCherry+/GFP+ | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP132560 | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | 2874F9-2_210715_D00404_0538_BCD91CANXX_TGCAGCTA-CTCTCTAT_L007_R1_001.fastq.gz | fastq | 662411307.0 | 12988457.0 | E MTAB 11083:2874F9 2 210715 D00404 0538 BCD91CANXX TGCAGCTA CTCTCTAT L007 | 0:51 1:0 | A:179158323;C:147942300;G:144319925;T:190945370;N:45389 | 51 | 0 | 179158323 | 147942300 | 144319925 | 190945370 | 45389 | ERX6698592 | ERS8070381 | ERA6757553 | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | 1 | 0.65813 | 0.17896 | 0.77076 | 0.52835 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Switzerland | 2021-12-01 | Adult | Adult | Brain | Nervous System | |||||||||||||||||||
| 10271 | 10271 | ERR7131135 | ERX6698591 | ERS8070380 | ERP132560 | PRJEB48218 | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E-MTAB-11083 | Transcriptome Analysis | To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb. | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | F3 mCherry | SAMEA10418596 | Friedrich Miescher Institute for Biomedical Research | ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418596|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F3 mCherry|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP |genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]|individual:pool 3|organism part:olfactory bulb|sample name:E MTAB 11083:F3 mCherry|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E MTAB 11083:F3 mCherry s | F3 mCherry s | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | Experimental Factor: fraction:mCherry+/GFP | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP132560 | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | 2874F8-1_210715_D00404_0538_BCD91CANXX_CGATCAGT-TCTCTCCG_L006_R1_001.fastq.gz | fastq | 698608353.0 | 13698203.0 | E MTAB 11083:2874F8 1 210715 D00404 0538 BCD91CANXX CGATCAGT TCTCTCCG L006 | 0:51 1:0 | A:188718612;C:156814081;G:151125083;T:201901570;N:49007 | 51 | 0 | 188718612 | 156814081 | 151125083 | 201901570 | 49007 | ERX6698591 | ERS8070380 | ERA6757553 | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | 1 | 0.70185 | 0.21547 | 0.75588 | 0.53853 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Switzerland | 2021-12-01 | Adult | Adult | Brain | Nervous System | |||||||||||||||||||
| 10272 | 10272 | ERR7131136 | ERX6698591 | ERS8070380 | ERP132560 | PRJEB48218 | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E-MTAB-11083 | Transcriptome Analysis | To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb. | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | F3 mCherry | SAMEA10418596 | Friedrich Miescher Institute for Biomedical Research | ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418596|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F3 mCherry|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP |genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]|individual:pool 3|organism part:olfactory bulb|sample name:E MTAB 11083:F3 mCherry|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E MTAB 11083:F3 mCherry s | F3 mCherry s | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | Experimental Factor: fraction:mCherry+/GFP | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP132560 | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | 2874F8-2_210715_D00404_0538_BCD91CANXX_CGATCAGT-TCTCTCCG_L007_R1_001.fastq.gz | fastq | 699869175.0 | 13722925.0 | E MTAB 11083:2874F8 2 210715 D00404 0538 BCD91CANXX CGATCAGT TCTCTCCG L007 | 0:51 1:0 | A:189192315;C:157176897;G:151498983;T:201952867;N:48113 | 51 | 0 | 189192315 | 157176897 | 151498983 | 201952867 | 48113 | ERX6698591 | ERS8070380 | ERA6757553 | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | 1 | 0.70221 | 0.21684 | 0.75621 | 0.53787 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Switzerland | 2021-12-01 | Adult | Adult | Brain | Nervous System | |||||||||||||||||||
| 10273 | 10273 | ERR7131133 | ERX6698590 | ERS8070379 | ERP132560 | PRJEB48218 | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E-MTAB-11083 | Transcriptome Analysis | To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb. | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | F2 Nega | SAMEA10418595 | Friedrich Miescher Institute for Biomedical Research | ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418595|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F2 Nega|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry /GFP |genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]|individual:pool 2|organism part:olfactory bulb|sample name:E MTAB 11083:F2 Nega|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E MTAB 11083:F2 Nega s | F2 Nega s | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | Experimental Factor: fraction:mCherry /GFP | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP132560 | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | 2874F4-1_210715_D00404_0538_BCD91CANXX_CGATCAGT-ACTGCATA_L006_R1_001.fastq.gz | fastq | 573812985.0 | 11251235.0 | E MTAB 11083:2874F4 1 210715 D00404 0538 BCD91CANXX CGATCAGT ACTGCATA L006 | 0:51 1:0 | A:150716404;C:132203167;G:129732968;T:161120057;N:40389 | 51 | 0 | 150716404 | 132203167 | 129732968 | 161120057 | 40389 | ERX6698590 | ERS8070379 | ERA6757553 | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | 1 | 0.81899 | 0.17302 | 0.72281 | 0.54315 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Switzerland | 2021-12-01 | Adult | Adult | Brain | Nervous System | |||||||||||||||||||
| 10274 | 10274 | ERR7131134 | ERX6698590 | ERS8070379 | ERP132560 | PRJEB48218 | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E-MTAB-11083 | Transcriptome Analysis | To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb. | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | F2 Nega | SAMEA10418595 | Friedrich Miescher Institute for Biomedical Research | ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418595|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F2 Nega|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry /GFP |genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]|individual:pool 2|organism part:olfactory bulb|sample name:E MTAB 11083:F2 Nega|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E MTAB 11083:F2 Nega s | F2 Nega s | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | Experimental Factor: fraction:mCherry /GFP | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP132560 | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | 2874F4-2_210715_D00404_0538_BCD91CANXX_CGATCAGT-ACTGCATA_L007_R1_001.fastq.gz | fastq | 576184587.0 | 11297737.0 | E MTAB 11083:2874F4 2 210715 D00404 0538 BCD91CANXX CGATCAGT ACTGCATA L007 | 0:51 1:0 | A:151387408;C:132788210;G:130392043;T:161577529;N:39397 | 51 | 0 | 151387408 | 132788210 | 130392043 | 161577529 | 39397 | ERX6698590 | ERS8070379 | ERA6757553 | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | 1 | 0.81999 | 0.17082 | 0.72196 | 0.54505 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Switzerland | 2021-12-01 | Adult | Adult | Brain | Nervous System | |||||||||||||||||||
| 10275 | 10275 | ERR7131131 | ERX6698589 | ERS8070378 | ERP132560 | PRJEB48218 | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E-MTAB-11083 | Transcriptome Analysis | To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb. | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | F2 mCherry GFP | SAMEA10418594 | Friedrich Miescher Institute for Biomedical Research | ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418594|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F2 mCherry GFP|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP+|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]|individual:pool 2|organism part:olfactory bulb|sample name:E MTAB 11083:F2 mCherry GFP|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E MTAB 11083:F2 mCherry GFP s | F2 mCherry GFP s | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | Experimental Factor: fraction:mCherry+/GFP+ | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP132560 | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | 2874F6-1_210715_D00404_0538_BCD91CANXX_CGATCAGT-CTAAGCCT_L006_R1_001.fastq.gz | fastq | 654811032.0 | 12839432.0 | E MTAB 11083:2874F6 1 210715 D00404 0538 BCD91CANXX CGATCAGT CTAAGCCT L006 | 0:51 1:0 | A:177403486;C:146202733;G:142207545;T:188951373;N:45895 | 51 | 0 | 177403486 | 146202733 | 142207545 | 188951373 | 45895 | ERX6698589 | ERS8070378 | ERA6757553 | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | 1 | 0.67854 | 0.21407 | 0.76104 | 0.52713 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Switzerland | 2021-12-01 | Adult | Adult | Brain | Nervous System | |||||||||||||||||||
| 10276 | 10276 | ERR7131132 | ERX6698589 | ERS8070378 | ERP132560 | PRJEB48218 | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E-MTAB-11083 | Transcriptome Analysis | To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb. | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | F2 mCherry GFP | SAMEA10418594 | Friedrich Miescher Institute for Biomedical Research | ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418594|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F2 mCherry GFP|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP+|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]|individual:pool 2|organism part:olfactory bulb|sample name:E MTAB 11083:F2 mCherry GFP|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E MTAB 11083:F2 mCherry GFP s | F2 mCherry GFP s | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | Experimental Factor: fraction:mCherry+/GFP+ | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP132560 | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | 2874F6-2_210715_D00404_0538_BCD91CANXX_CGATCAGT-CTAAGCCT_L007_R1_001.fastq.gz | fastq | 656911926.0 | 12880626.0 | E MTAB 11083:2874F6 2 210715 D00404 0538 BCD91CANXX CGATCAGT CTAAGCCT L007 | 0:51 1:0 | A:178119212;C:146730132;G:142725348;T:189293212;N:44022 | 51 | 0 | 178119212 | 146730132 | 142725348 | 189293212 | 44022 | ERX6698589 | ERS8070378 | ERA6757553 | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | 1 | 0.68162 | 0.21431 | 0.761 | 0.5071 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Switzerland | 2021-12-01 | Adult | Adult | Brain | Nervous System | |||||||||||||||||||
| 10277 | 10277 | ERR7131129 | ERX6698588 | ERS8070377 | ERP132560 | PRJEB48218 | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E-MTAB-11083 | Transcriptome Analysis | To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb. | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | F2 mCherry | SAMEA10418593 | Friedrich Miescher Institute for Biomedical Research | ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418593|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F2 mCherry|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP |genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]|individual:pool 2|organism part:olfactory bulb|sample name:E MTAB 11083:F2 mCherry|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E MTAB 11083:F2 mCherry s | F2 mCherry s | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | Experimental Factor: fraction:mCherry+/GFP | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP132560 | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | 2874F5-1_210715_D00404_0538_BCD91CANXX_CGATCAGT-AAGGAGTA_L006_R1_001.fastq.gz | fastq | 607851558.0 | 11918658.0 | E MTAB 11083:2874F5 1 210715 D00404 0538 BCD91CANXX CGATCAGT AAGGAGTA L006 | 0:51 1:0 | A:164814138;C:136071648;G:132945950;T:173976881;N:42941 | 51 | 0 | 164814138 | 136071648 | 132945950 | 173976881 | 42941 | ERX6698588 | ERS8070377 | ERA6757553 | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | 1 | 0.78967 | 0.18905 | 0.73241 | 0.52347 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Switzerland | 2021-12-01 | Adult | Adult | Brain | Nervous System | |||||||||||||||||||
| 10278 | 10278 | ERR7131130 | ERX6698588 | ERS8070377 | ERP132560 | PRJEB48218 | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E-MTAB-11083 | Transcriptome Analysis | To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb. | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | F2 mCherry | SAMEA10418593 | Friedrich Miescher Institute for Biomedical Research | ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418593|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F2 mCherry|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP |genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]|individual:pool 2|organism part:olfactory bulb|sample name:E MTAB 11083:F2 mCherry|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E MTAB 11083:F2 mCherry s | F2 mCherry s | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | Experimental Factor: fraction:mCherry+/GFP | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP132560 | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | 2874F5-2_210715_D00404_0538_BCD91CANXX_CGATCAGT-AAGGAGTA_L007_R1_001.fastq.gz | fastq | 610931805.0 | 11979055.0 | E MTAB 11083:2874F5 2 210715 D00404 0538 BCD91CANXX CGATCAGT AAGGAGTA L007 | 0:51 1:0 | A:165714775;C:136822925;G:133684294;T:174667814;N:41997 | 51 | 0 | 165714775 | 136822925 | 133684294 | 174667814 | 41997 | ERX6698588 | ERS8070377 | ERA6757553 | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | 1 | 0.78869 | 0.18885 | 0.73156 | 0.51691 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Switzerland | 2021-12-01 | Adult | Adult | Brain | Nervous System | |||||||||||||||||||
| 10279 | 10279 | ERR7131127 | ERX6698587 | ERS8070376 | ERP132560 | PRJEB48218 | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E-MTAB-11083 | Transcriptome Analysis | To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb. | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | F1 Nega | SAMEA10418592 | Friedrich Miescher Institute for Biomedical Research | ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418592|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F1 Nega|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry /GFP |genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]|individual:pool 1|organism part:olfactory bulb|sample name:E MTAB 11083:F1 Nega|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E MTAB 11083:F1 Nega s | F1 Nega s | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | Experimental Factor: fraction:mCherry /GFP | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP132560 | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | 2874F1-1_210715_D00404_0538_BCD91CANXX_CGATCAGT-CTCTCTAT_L006_R1_001.fastq.gz | fastq | 619561872.0 | 12148272.0 | E MTAB 11083:2874F1 1 210715 D00404 0538 BCD91CANXX CGATCAGT CTCTCTAT L006 | 0:51 1:0 | A:164385545;C:141746313;G:138163219;T:175223323;N:43472 | 51 | 0 | 164385545 | 141746313 | 138163219 | 175223323 | 43472 | ERX6698587 | ERS8070376 | ERA6757553 | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | 1 | 0.80258 | 0.17703 | 0.72614 | 0.53483 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Switzerland | 2021-12-01 | Adult | Adult | Brain | Nervous System | |||||||||||||||||||
| 10280 | 10280 | ERR7131128 | ERX6698587 | ERS8070376 | ERP132560 | PRJEB48218 | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E-MTAB-11083 | Transcriptome Analysis | To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb. | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | F1 Nega | SAMEA10418592 | Friedrich Miescher Institute for Biomedical Research | ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418592|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F1 Nega|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry /GFP |genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]|individual:pool 1|organism part:olfactory bulb|sample name:E MTAB 11083:F1 Nega|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E MTAB 11083:F1 Nega s | F1 Nega s | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | Experimental Factor: fraction:mCherry /GFP | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP132560 | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | 2874F1-2_210715_D00404_0538_BCD91CANXX_CGATCAGT-CTCTCTAT_L007_R1_001.fastq.gz | fastq | 621481971.0 | 12185921.0 | E MTAB 11083:2874F1 2 210715 D00404 0538 BCD91CANXX CGATCAGT CTCTCTAT L007 | 0:51 1:0 | A:165030774;C:142231469;G:138651078;T:175527080;N:41570 | 51 | 0 | 165030774 | 142231469 | 138651078 | 175527080 | 41570 | ERX6698587 | ERS8070376 | ERA6757553 | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | 1 | 0.80248 | 0.17699 | 0.726 | 0.53711 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Switzerland | 2021-12-01 | Adult | Adult | Brain | Nervous System | |||||||||||||||||||
| 10281 | 10281 | ERR7131125 | ERX6698586 | ERS8070375 | ERP132560 | PRJEB48218 | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E-MTAB-11083 | Transcriptome Analysis | To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb. | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | F1 mCherry GFP | SAMEA10418591 | Friedrich Miescher Institute for Biomedical Research | ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418591|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F1 mCherry GFP|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP+|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]|individual:pool 1|organism part:olfactory bulb|sample name:E MTAB 11083:F1 mCherry GFP|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E MTAB 11083:F1 mCherry GFP s | F1 mCherry GFP s | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | Experimental Factor: fraction:mCherry+/GFP+ | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP132560 | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | 2874F3-1_210715_D00404_0538_BCD91CANXX_CGATCAGT-GTAAGGAG_L006_R1_001.fastq.gz | fastq | 651189369.0 | 12768419.0 | E MTAB 11083:2874F3 1 210715 D00404 0538 BCD91CANXX CGATCAGT GTAAGGAG L006 | 0:51 1:0 | A:176398415;C:145659111;G:142137610;T:186948280;N:45953 | 51 | 0 | 176398415 | 145659111 | 142137610 | 186948280 | 45953 | ERX6698586 | ERS8070375 | ERA6757553 | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | 1 | 0.69561 | 0.18489 | 0.75345 | 0.52316 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Switzerland | 2021-12-01 | Adult | Adult | Brain | Nervous System | |||||||||||||||||||
| 10282 | 10282 | ERR7131126 | ERX6698586 | ERS8070375 | ERP132560 | PRJEB48218 | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E-MTAB-11083 | Transcriptome Analysis | To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb. | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | F1 mCherry GFP | SAMEA10418591 | Friedrich Miescher Institute for Biomedical Research | ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418591|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F1 mCherry GFP|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP+|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]|individual:pool 1|organism part:olfactory bulb|sample name:E MTAB 11083:F1 mCherry GFP|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E MTAB 11083:F1 mCherry GFP s | F1 mCherry GFP s | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | Experimental Factor: fraction:mCherry+/GFP+ | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP132560 | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | 2874F3-2_210715_D00404_0538_BCD91CANXX_CGATCAGT-GTAAGGAG_L007_R1_001.fastq.gz | fastq | 653398944.0 | 12811744.0 | E MTAB 11083:2874F3 2 210715 D00404 0538 BCD91CANXX CGATCAGT GTAAGGAG L007 | 0:51 1:0 | A:177139734;C:146171766;G:142707146;T:187335475;N:44823 | 51 | 0 | 177139734 | 146171766 | 142707146 | 187335475 | 44823 | ERX6698586 | ERS8070375 | ERA6757553 | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | 1 | 0.69496 | 0.18414 | 0.75375 | 0.52317 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Switzerland | 2021-12-01 | Adult | Adult | Brain | Nervous System | |||||||||||||||||||
| 10283 | 10283 | ERR7131123 | ERX6698585 | ERS8070374 | ERP132560 | PRJEB48218 | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E-MTAB-11083 | Transcriptome Analysis | To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb. | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | F1 mCherry | SAMEA10418590 | Friedrich Miescher Institute for Biomedical Research | ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418590|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F1 mCherry|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP |genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]|individual:pool 1|organism part:olfactory bulb|sample name:E MTAB 11083:F1 mCherry|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E MTAB 11083:F1 mCherry s | F1 mCherry s | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | Experimental Factor: fraction:mCherry+/GFP | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP132560 | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | 2874F2-1_210715_D00404_0538_BCD91CANXX_CGATCAGT-TATCCTCT_L006_R1_001.fastq.gz | fastq | 613574319.0 | 12030869.0 | E MTAB 11083:2874F2 1 210715 D00404 0538 BCD91CANXX CGATCAGT TATCCTCT L006 | 0:51 1:0 | A:164891629;C:138401759;G:135818073;T:174419828;N:43030 | 51 | 0 | 164891629 | 138401759 | 135818073 | 174419828 | 43030 | ERX6698585 | ERS8070374 | ERA6757553 | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | 1 | 0.79499 | 0.21674 | 0.73359 | 0.52207 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Switzerland | 2021-12-01 | Adult | Adult | Brain | Nervous System | |||||||||||||||||||
| 10284 | 10284 | ERR7131124 | ERX6698585 | ERS8070374 | ERP132560 | PRJEB48218 | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E-MTAB-11083 | Transcriptome Analysis | To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb. | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | F1 mCherry | SAMEA10418590 | Friedrich Miescher Institute for Biomedical Research | ENA first public:2021 12 01|ENA last update:2021 12 01|External Id:SAMEA10418590|INSDC center alias:Friedrich Miescher Institute for Biomedical Research|INSDC center name:Friedrich Miescher Institute for Biomedical Research|INSDC first public:2021 12 01T00:23:59Z|INSDC last update:2021 12 01T00:23:59Z|INSDC status:public|Submitter Id:E MTAB 11083:F1 mCherry|age:9|broker name:ArrayExpress|cell type:GABAergic neuron|common name:zebrafish|developmental stage:adult|fraction:mCherry+/GFP |genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]|individual:pool 1|organism part:olfactory bulb|sample name:E MTAB 11083:F1 mCherry|sex:mixed|stimulus:injected with EnvA RV GFP|strain:Ab x Tu x TL x WIK | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | E MTAB 11083:F1 mCherry s | F1 mCherry s | Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers. | Experimental Factor: fraction:mCherry+/GFP | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | Illumina HiSeq 2500 | ERP132560 | Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb | ENA FIRST PUBLIC:2022 07 07|ENA LAST UPDATE:2022 07 07 | 2874F2-2_210715_D00404_0538_BCD91CANXX_CGATCAGT-TATCCTCT_L007_R1_001.fastq.gz | fastq | 615666798.0 | 12071898.0 | E MTAB 11083:2874F2 2 210715 D00404 0538 BCD91CANXX CGATCAGT TATCCTCT L007 | 0:51 1:0 | A:165536502;C:138952758;G:136375193;T:174760659;N:41686 | 51 | 0 | 165536502 | 138952758 | 136375193 | 174760659 | 41686 | ERX6698585 | ERS8070374 | ERA6757553 | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | Friedrich Miescher Institute for Biomedical Research|European Nucleotide Archive | 1 | 0.7941 | 0.21645 | 0.73494 | 0.50761 | 51 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Switzerland | 2021-12-01 | Adult | Adult | Brain | Nervous System | |||||||||||||||||||
| 19087 | 19087 | ERR13834862 | ERX13237628 | ERS21098715 | ERP164534 | PRJEB80557 | RNAseq of Danio Rerio Photoreceptors Amacrine and Horizontal cells collected 38 48 and 58 hpf | e09e99a9-eabd-4a7d-8f92-2c4cf9f384ed | Other | This analysis was conducted to elucidate potential guidance of retinal horizontal cells HCs by photoreceptors PRs and/or amacrine cells ACs during the retinal lamination. We dissected retinae from three different developmental stages corresponding to different stages in HCs lamination process and separated HCs PRs and HCs based on their differential GFP and DsRed expression in the Lhx1:GFP; ptf1a:DsRed zebrafish transgenic line. Four replicates of each sample were lysed converted to cDNA sequenced using the SMART SEQ2 protocol. | ENA FIRST PUBLIC:2025 01 01|ENA LAST UPDATE:2025 01 01 | retinal neurons | 48HC1 S20 R1 001.fastq.gz | SAMEA116100635 | GIMM | ENA first public:2024 01 01|INSDC center name:GIMM|INSDC status:public|Submitter Id:48 HC1|collected by:Jaakko Lehtimaki|collection date:2021 11 24|common name:zebrafish|dev stage:48 hpf location country and/or sea:Portugal|lab host:Tg 5.5ptf1a:DsRed; Tglhx1a:EGFP|sample name:48 HC1|scientific name:Danio rerio|tissue type:retina | Raw reads: 48 HC1 | webin reads 48 HC1 | RNA-Seq | TRANSCRIPTOMIC | RANDOM | SINGLE | ILLUMINA | Illumina HiSeq X | ERP164534 | Raw reads: 48 HC1 | ENA FIRST PUBLIC:2025 01 01|ENA LAST UPDATE:2025 01 01 | 48HC1_S20_R1_001.fastq.gz | fastq | 3768442091.0 | 38065677.0 | webin reads 48 HC1 | 0:99.00 | A:1055463738;C:792073627;G:817607736;T:1103223790;N:73200 | 99 | 1055463738 | 792073627 | 817607736 | 1103223790 | 73200 | ERX13237628 | ERS21098715 | ERA30883416 | Gulbenkian Institute for Molecular Medicine|European Nucleotide Archive | Gulbenkian Institute for Molecular Medicine | B | usable mapping rate | illumina | hiseq_era | unknown | random_priming | unknown | sc | single_cell_plate | smartseq | Belgium | 2024-01-01 | Hatching | Embryo | Eye | Sensory System | ||||||||||||||||||||||||||||||
| 19088 | 19088 | ERR13834951 | ERX13237717 | ERS21098721 | ERP164534 | PRJEB80557 | RNAseq of Danio Rerio Photoreceptors Amacrine and Horizontal cells collected 38 48 and 58 hpf | e09e99a9-eabd-4a7d-8f92-2c4cf9f384ed | Other | This analysis was conducted to elucidate potential guidance of retinal horizontal cells HCs by photoreceptors PRs and/or amacrine cells ACs during the retinal lamination. We dissected retinae from three different developmental stages corresponding to different stages in HCs lamination process and separated HCs PRs and HCs based on their differential GFP and DsRed expression in the Lhx1:GFP; ptf1a:DsRed zebrafish transgenic line. Four replicates of each sample were lysed converted to cDNA sequenced using the SMART SEQ2 protocol. | ENA FIRST PUBLIC:2025 01 01|ENA LAST UPDATE:2025 01 01 | retinal neurons | 58PR3 S26 R1 001.fastq.gz | 58 PR3 | organism:Danio rerio|collection date:2021 12 02|scientific name:Danio rerio|collected by:Jaakko Lehtimaki|common name:zebrafish|lab host:Tg 5.5ptf1a:DsRed; Tglhx1a:EGFP|dev stage:58 hpf type:retina|geographic location country and/or sea:Portugal | Raw reads: 58 PR3 | webin reads 58 PR3 | RNA-Seq | TRANSCRIPTOMIC | RANDOM | SINGLE | ILLUMINA | Illumina HiSeq X | ERP164534 | Raw reads: 58 PR3 | ENA FIRST PUBLIC:2025 01 01|ENA LAST UPDATE:2025 01 01 | 58PR3_S26_R1_001.fastq.gz | fastq | 3869469736.0 | 38850717.0 | webin reads 58 PR3 | 0:99.60 | A:1103909449;C:804146524;G:827344036;T:1134036010;N:33717 | 99 | 1103909449 | 804146524 | 827344036 | 1134036010 | 33717 | ERX13237717 | ERS21098721 | ERA30883529 | Gulbenkian Institute for Molecular Medicine|European Nucleotide Archive | Gulbenkian Institute for Molecular Medicine | B | usable mapping rate | illumina | hiseq_era | unknown | random_priming | unknown | sc | single_cell_plate | smartseq | Belgium | 2025-01-01 | Hatching | Embryo | Eye | Sensory System | |||||||||||||||||||||||||||||||
| 19089 | 19089 | ERR13835010 | ERX13237776 | ERS21098726 | ERP164534 | PRJEB80557 | RNAseq of Danio Rerio Photoreceptors Amacrine and Horizontal cells collected 38 48 and 58 hpf | e09e99a9-eabd-4a7d-8f92-2c4cf9f384ed | Other | This analysis was conducted to elucidate potential guidance of retinal horizontal cells HCs by photoreceptors PRs and/or amacrine cells ACs during the retinal lamination. We dissected retinae from three different developmental stages corresponding to different stages in HCs lamination process and separated HCs PRs and HCs based on their differential GFP and DsRed expression in the Lhx1:GFP; ptf1a:DsRed zebrafish transgenic line. Four replicates of each sample were lysed converted to cDNA sequenced using the SMART SEQ2 protocol. | ENA FIRST PUBLIC:2025 01 01|ENA LAST UPDATE:2025 01 01 | retinal neurons | 58AC4 S31 R1 001.fastq.gz | SAMEA116100646 | GIMM | ENA first public:2024 01 01|INSDC center name:GIMM|INSDC status:public|Submitter Id:58 AC4|collected by:Jaakko Lehtimaki|collection date:2021 12 02|common name:zebrafish|dev stage:58 hpf location country and/or sea:Portugal|lab host:Tg 5.5ptf1a:DsRed; Tglhx1a:EGFP|sample name:58 AC4|scientific name:Danio rerio|tissue type:retina | Raw reads: 58 AC4 | webin reads 58 AC4 | RNA-Seq | TRANSCRIPTOMIC | RANDOM | SINGLE | ILLUMINA | Illumina HiSeq X | ERP164534 | Raw reads: 58 AC4 | ENA FIRST PUBLIC:2025 01 01|ENA LAST UPDATE:2025 01 01 | 58AC4_S31_R1_001.fastq.gz | fastq | 3607648651.0 | 36331933.0 | webin reads 58 AC4 | 0:99.30 | A:1038047870;C:736262498;G:759315202;T:1073962987;N:60094 | 99 | 1038047870 | 736262498 | 759315202 | 1073962987 | 60094 | ERX13237776 | ERS21098726 | ERA30883721 | Gulbenkian Institute for Molecular Medicine|European Nucleotide Archive | Gulbenkian Institute for Molecular Medicine | B | usable mapping rate | illumina | hiseq_era | unknown | random_priming | unknown | sc | single_cell_plate | smartseq | Belgium | 2024-01-01 | Hatching | Embryo | Eye | Sensory System | ||||||||||||||||||||||||||||||
| 19090 | 19090 | ERR13822794 | ERX13225546 | ERS21098708 | ERP164534 | PRJEB80557 | RNAseq of Danio Rerio Photoreceptors Amacrine and Horizontal cells collected 38 48 and 58 hpf | e09e99a9-eabd-4a7d-8f92-2c4cf9f384ed | Other | This analysis was conducted to elucidate potential guidance of retinal horizontal cells HCs by photoreceptors PRs and/or amacrine cells ACs during the retinal lamination. We dissected retinae from three different developmental stages corresponding to different stages in HCs lamination process and separated HCs PRs and HCs based on their differential GFP and DsRed expression in the Lhx1:GFP; ptf1a:DsRed zebrafish transgenic line. Four replicates of each sample were lysed converted to cDNA sequenced using the SMART SEQ2 protocol. | ENA FIRST PUBLIC:2025 01 01|ENA LAST UPDATE:2025 01 01 | retinal neurons | 48PR2 S13 R1 001.fastq.gz | 48 PR2 | organism:Danio rerio|collection date:2021 11 24|scientific name:Danio rerio|collected by:Jaakko Lehtimaki|common name:zebrafish|lab host:Tg 5.5ptf1a:DsRed; Tglhx1a:EGFP|dev stage:48 hpf type:retina|geographic location country and/or sea:Portugal | Raw reads: 48 PR2 | webin reads 48 PR2 | RNA-Seq | TRANSCRIPTOMIC | RANDOM | SINGLE | ILLUMINA | Illumina HiSeq X | ERP164534 | Raw reads: 48 PR2 | ENA FIRST PUBLIC:2025 01 01|ENA LAST UPDATE:2025 01 01 | 48PR2_S13_R1_001.fastq.gz | fastq | 3809299607.0 | 38404185.0 | webin reads 48 PR2 | 0:99.19 | A:1067728192;C:802585802;G:828435932;T:1110435904;N:113777 | 99 | 1067728192 | 802585802 | 828435932 | 1110435904 | 113777 | ERX13225546 | ERS21098708 | ERA30879682 | Gulbenkian Institute for Molecular Medicine|European Nucleotide Archive | Gulbenkian Institute for Molecular Medicine | B | usable mapping rate | illumina | hiseq_era | unknown | random_priming | unknown | sc | single_cell_plate | smartseq | Belgium | 2025-01-01 | Hatching | Embryo | Eye | Sensory System |
Advanced export
JSON shape: default, array, newline-delimited
CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;