metadata: run_metadata: 2,097 rows where experiment.library_layout = "SINGLE", experiment.platform = "ILLUMINA" and tissue

2,097 rows where experiment.library_layout = "SINGLE", experiment.platform = "ILLUMINA" and tissue_curation = "Spinal Cord"

descending

Link	rowid ▼	run.accession	experiment.accession	sample.accession	study.accession	bioproject	study.title	study.alias	study.type	study.abstract	study.attributes	study.PMIDs	sample.title	sample.alias	sample.attributes	GEOsample.title	GEOsample.dataprocessing	GEOsample.source	GEOsample.treatmentprotocol	GEOsample.extractprotocol	GEOsample.growthprotocol	GEOsample.characteristics	GEOsample.accession	experiment.title	experiment.alias	experiment.library_name	experiment.design_description	experiment.library_construction_protocol	experiment.library_strategy	experiment.library_source	experiment.library_selection	experiment.library_layout	experiment.platform	experiment.instrument_model	experiment.study_ref	run.attributes	run.filename	run.semantic_name	run.total_bases	run.total_spots	run.alias	run.read_lengths	run.base_counts	run.r1_length	run.Acount	run.Ccount	run.Gcount	run.Tcount	run.Ncount	run.experiment	run.pool_member	submission.accession	submission.srasource	submission.bioprojectsource	seqdetective.n_mates	seqdetective.mapping_rate.mate1	seqdetective.nofeature_rate.mate1	seqdetective.sparsity.mate1	seqdetective.pos_strand_rate.mate1	seqdetective.readlen.mate1	seqdetective.judgement.mate1	seqdetective.judgement.reason	platform_family	instrument_generation	read_bias	selection_class	prep_kit	sc_or_bulk	tech_class	technology	submission.bioprojectsource.country	earliest_date	devstage_curation	devstage_curation_coarse	tissue_curation	tissue_curation_coarse
24927	24927	SRR25557778	SRX21286665	SRS18536778	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant XI	GSM7688794	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant XI	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688794	GSM7688794: Morphant XI; Danio rerio; RNA Seq	GSM7688794 r1	GSM7688794	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-XI_S7_L001_R1_001.fastq.gz	fastq	420092501.0	5668059.0	GSM7688794 r1	0:74.12	A:113006440;C:96725832;G:99320773;T:110915967;N:123489	74	113006440	96725832	99320773	110915967	123489	SRX21286665	SRS18536778	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94757	0.06229	0.72364	0.46676	74	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24928	24928	SRR25557779	SRX21286665	SRS18536778	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant XI	GSM7688794	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant XI	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688794	GSM7688794: Morphant XI; Danio rerio; RNA Seq	GSM7688794 r1	GSM7688794	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-XI_S7_L002_R1_001.fastq.gz	fastq	421869780.0	5690053.0	GSM7688794 r2	0:74.14	A:113530489;C:97144227;G:99697959;T:111388539;N:108566	74	113530489	97144227	99697959	111388539	108566	SRX21286665	SRS18536778	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94921	0.06226	0.72462	0.4738	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24929	24929	SRR25557780	SRX21286665	SRS18536778	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant XI	GSM7688794	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant XI	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688794	GSM7688794: Morphant XI; Danio rerio; RNA Seq	GSM7688794 r1	GSM7688794	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-XI_S7_L003_R1_001.fastq.gz	fastq	425064659.0	5734041.0	GSM7688794 r3	0:74.13	A:114342253;C:97873100;G:100532599;T:112196433;N:120274	74	114342253	97873100	100532599	112196433	120274	SRX21286665	SRS18536778	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94886	0.06112	0.72425	0.47055	74	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24930	24930	SRR25557781	SRX21286665	SRS18536778	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant XI	GSM7688794	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant XI	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688794	GSM7688794: Morphant XI; Danio rerio; RNA Seq	GSM7688794 r1	GSM7688794	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-XI_S7_L004_R1_001.fastq.gz	fastq	416990548.0	5624902.0	GSM7688794 r4	0:74.13	A:112153356;C:96009158;G:98613145;T:110097476;N:117413	74	112153356	96009158	98613145	110097476	117413	SRX21286665	SRS18536778	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94869	0.06229	0.72506	0.47222	74	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24931	24931	SRR25557782	SRX21286664	SRS18536777	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant X	GSM7688793	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant X	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688793	GSM7688793: Morphant X; Danio rerio; RNA Seq	GSM7688793 r1	GSM7688793	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-X_S6_L001_R1_001.fastq.gz	fastq	434485284.0	5881416.0	GSM7688793 r1	0:73.87	A:116640351;C:100176557;G:102659919;T:114799536;N:208921	73	116640351	100176557	102659919	114799536	208921	SRX21286664	SRS18536777	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94533	0.07176	0.72464	0.47632	74	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24932	24932	SRR25557783	SRX21286664	SRS18536777	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant X	GSM7688793	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant X	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688793	GSM7688793: Morphant X; Danio rerio; RNA Seq	GSM7688793 r1	GSM7688793	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-X_S6_L002_R1_001.fastq.gz	fastq	435203869.0	5886556.0	GSM7688793 r2	0:73.93	A:116869356;C:100363580;G:102830644;T:114973504;N:166785	73	116869356	100363580	102830644	114973504	166785	SRX21286664	SRS18536777	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94542	0.07203	0.72421	0.47733	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24933	24933	SRR25557784	SRX21286664	SRS18536777	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant X	GSM7688793	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant X	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688793	GSM7688793: Morphant X; Danio rerio; RNA Seq	GSM7688793 r1	GSM7688793	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-X_S6_L003_R1_001.fastq.gz	fastq	439897269.0	5951878.0	GSM7688793 r3	0:73.91	A:118101648;C:101426657;G:103990006;T:116184480;N:194478	73	118101648	101426657	103990006	116184480	194478	SRX21286664	SRS18536777	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94486	0.07224	0.72448	0.47915	74	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24934	24934	SRR25557785	SRX21286664	SRS18536777	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant X	GSM7688793	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant X	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688793	GSM7688793: Morphant X; Danio rerio; RNA Seq	GSM7688793 r1	GSM7688793	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-X_S6_L004_R1_001.fastq.gz	fastq	431385256.0	5836029.0	GSM7688793 r4	0:73.92	A:115804970;C:99459059;G:101962932;T:113975935;N:182360	73	115804970	99459059	101962932	113975935	182360	SRX21286664	SRS18536777	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94432	0.07229	0.7261	0.47463	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24935	24935	SRR25557786	SRX21286663	SRS18536776	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant IX	GSM7688792	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant IX	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688792	GSM7688792: Morphant IX; Danio rerio; RNA Seq	GSM7688792 r1	GSM7688792	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-IX_S16_L001_R1_001.fastq.gz	fastq	513309395.0	6929648.0	GSM7688792 r1	0:74.07	A:137428462;C:118688804;G:122019962;T:134991729;N:180438	74	137428462	118688804	122019962	134991729	180438	SRX21286663	SRS18536776	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94188	0.07029	0.73772	0.47692	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24936	24936	SRR25557787	SRX21286663	SRS18536776	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant IX	GSM7688792	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant IX	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688792	GSM7688792: Morphant IX; Danio rerio; RNA Seq	GSM7688792 r1	GSM7688792	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-IX_S16_L002_R1_001.fastq.gz	fastq	517356735.0	6982196.0	GSM7688792 r2	0:74.10	A:138524037;C:119650852;G:122965491;T:136056171;N:160184	74	138524037	119650852	122965491	136056171	160184	SRX21286663	SRS18536776	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94281	0.06967	0.73963	0.48142	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24937	24937	SRR25557788	SRX21286663	SRS18536776	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant IX	GSM7688792	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant IX	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688792	GSM7688792: Morphant IX; Danio rerio; RNA Seq	GSM7688792 r1	GSM7688792	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-IX_S16_L003_R1_001.fastq.gz	fastq	519422328.0	7010631.0	GSM7688792 r3	0:74.09	A:139040684;C:120128748;G:123529198;T:136551898;N:171800	74	139040684	120128748	123529198	136551898	171800	SRX21286663	SRS18536776	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94297	0.06942	0.73726	0.47499	74	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24938	24938	SRR25557789	SRX21286663	SRS18536776	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant IX	GSM7688792	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant IX	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688792	GSM7688792: Morphant IX; Danio rerio; RNA Seq	GSM7688792 r1	GSM7688792	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-IX_S16_L004_R1_001.fastq.gz	fastq	511640294.0	6905748.0	GSM7688792 r4	0:74.09	A:136914638;C:118302866;G:121704665;T:134543505;N:174620	74	136914638	118302866	121704665	134543505	174620	SRX21286663	SRS18536776	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94176	0.07029	0.73868	0.47987	74	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24939	24939	SRR25557790	SRX21286662	SRS18536775	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant VIII	GSM7688791	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant VIII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688791	GSM7688791: Morphant VIII; Danio rerio; RNA Seq	GSM7688791 r1	GSM7688791	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-VIII_S14_L001_R1_001.fastq.gz	fastq	429446821.0	5803178.0	GSM7688791 r1	0:74.00	A:114793535;C:99506379;G:102226914;T:112748761;N:171232	74	114793535	99506379	102226914	112748761	171232	SRX21286662	SRS18536775	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94175	0.06669	0.73673	0.48179	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24940	24940	SRR25557791	SRX21286662	SRS18536775	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant VIII	GSM7688791	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant VIII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688791	GSM7688791: Morphant VIII; Danio rerio; RNA Seq	GSM7688791 r1	GSM7688791	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-VIII_S14_L002_R1_001.fastq.gz	fastq	434629893.0	5870828.0	GSM7688791 r2	0:74.03	A:116216940;C:100703527;G:103463365;T:114092681;N:153380	74	116216940	100703527	103463365	114092681	153380	SRX21286662	SRS18536775	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94143	0.0676	0.73791	0.48091	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24941	24941	SRR25557792	SRX21286662	SRS18536775	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant VIII	GSM7688791	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant VIII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688791	GSM7688791: Morphant VIII; Danio rerio; RNA Seq	GSM7688791 r1	GSM7688791	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-VIII_S14_L003_R1_001.fastq.gz	fastq	435879881.0	5888685.0	GSM7688791 r3	0:74.02	A:116548094;C:100971153;G:103794902;T:114400770;N:164962	74	116548094	100971153	103794902	114400770	164962	SRX21286662	SRS18536775	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94195	0.06686	0.73785	0.48044	73	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24942	24942	SRR25557793	SRX21286662	SRS18536775	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant VIII	GSM7688791	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant VIII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688791	GSM7688791: Morphant VIII; Danio rerio; RNA Seq	GSM7688791 r1	GSM7688791	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-VIII_S14_L004_R1_001.fastq.gz	fastq	429478475.0	5801978.0	GSM7688791 r4	0:74.02	A:114799280;C:99474677;G:102302775;T:112737475;N:164268	74	114799280	99474677	102302775	112737475	164268	SRX21286662	SRS18536775	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94118	0.06706	0.73892	0.47732	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24943	24943	SRR25557794	SRX21286661	SRS18536774	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant VII	GSM7688790	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant VII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688790	GSM7688790: Morphant VII; Danio rerio; RNA Seq	GSM7688790 r1	GSM7688790	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-VII_S15_L001_R1_001.fastq.gz	fastq	459545188.0	6215897.0	GSM7688790 r1	0:73.93	A:121926568;C:107379723;G:110263606;T:119766429;N:208862	73	121926568	107379723	110263606	119766429	208862	SRX21286661	SRS18536774	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94273	0.06072	0.74582	0.47499	73	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24944	24944	SRR25557795	SRX21286661	SRS18536774	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant VII	GSM7688790	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant VII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688790	GSM7688790: Morphant VII; Danio rerio; RNA Seq	GSM7688790 r1	GSM7688790	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-VII_S15_L002_R1_001.fastq.gz	fastq	463143624.0	6261406.0	GSM7688790 r2	0:73.97	A:122917997;C:108229793;G:111099867;T:120713978;N:181989	73	122917997	108229793	111099867	120713978	181989	SRX21286661	SRS18536774	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94387	0.06093	0.74341	0.47351	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24945	24945	SRR25557796	SRX21286661	SRS18536774	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant VII	GSM7688790	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant VII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688790	GSM7688790: Morphant VII; Danio rerio; RNA Seq	GSM7688790 r1	GSM7688790	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-VII_S15_L003_R1_001.fastq.gz	fastq	465959664.0	6300929.0	GSM7688790 r3	0:73.95	A:123689364;C:108847593;G:111847868;T:121377463;N:197376	73	123689364	108847593	111847868	121377463	197376	SRX21286661	SRS18536774	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94322	0.06219	0.74357	0.47977	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24946	24946	SRR25557797	SRX21286661	SRS18536774	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant VII	GSM7688790	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant VII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688790	GSM7688790: Morphant VII; Danio rerio; RNA Seq	GSM7688790 r1	GSM7688790	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-VII_S15_L004_R1_001.fastq.gz	fastq	459075430.0	6207363.0	GSM7688790 r4	0:73.96	A:121797426;C:107221116;G:110209684;T:119657308;N:189896	73	121797426	107221116	110209684	119657308	189896	SRX21286661	SRS18536774	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94313	0.06211	0.74343	0.47801	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24947	24947	SRR25557798	SRX21286660	SRS18536773	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control XI	GSM7688787	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control XI	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688787	GSM7688787: Control XI; Danio rerio; RNA Seq	GSM7688787 r1	GSM7688787	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-XI_S2_L001_R1_001.fastq.gz	fastq	439719566.0	5947052.0	GSM7688787 r1	0:73.94	A:117482073;C:102083665;G:104685444;T:115272860;N:195524	73	117482073	102083665	104685444	115272860	195524	SRX21286660	SRS18536773	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94829	0.06278	0.72525	0.46494	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24948	24948	SRR25557799	SRX21286660	SRS18536773	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control XI	GSM7688787	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control XI	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688787	GSM7688787: Control XI; Danio rerio; RNA Seq	GSM7688787 r1	GSM7688787	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-XI_S2_L002_R1_001.fastq.gz	fastq	438533503.0	5927990.0	GSM7688787 r2	0:73.98	A:117199594;C:101810881;G:104402169;T:114946611;N:174248	73	117199594	101810881	104402169	114946611	174248	SRX21286660	SRS18536773	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94887	0.06387	0.72827	0.46616	74	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24949	24949	SRR25557800	SRX21286660	SRS18536773	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control XI	GSM7688787	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control XI	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688787	GSM7688787: Control XI; Danio rerio; RNA Seq	GSM7688787 r1	GSM7688787	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-XI_S2_L003_R1_001.fastq.gz	fastq	443995554.0	6003540.0	GSM7688787 r3	0:73.96	A:118663936;C:103031716;G:105723574;T:116387834;N:188494	73	118663936	103031716	105723574	116387834	188494	SRX21286660	SRS18536773	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94788	0.06232	0.72693	0.46653	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24950	24950	SRR25557801	SRX21286660	SRS18536773	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control XI	GSM7688787	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control XI	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688787	GSM7688787: Control XI; Danio rerio; RNA Seq	GSM7688787 r1	GSM7688787	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-XI_S2_L004_R1_001.fastq.gz	fastq	435088869.0	5882642.0	GSM7688787 r4	0:73.96	A:116261447;C:100986653;G:103615584;T:114042354;N:182831	73	116261447	100986653	103615584	114042354	182831	SRX21286660	SRS18536773	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94914	0.06241	0.72829	0.4546	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24951	24951	SRR25557802	SRX21286659	SRS18536772	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control X	GSM7688785	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control X	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688785	GSM7688785: Control X; Danio rerio; RNA Seq	GSM7688785 r1	GSM7688785	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-X_S1_L001_R1_001.fastq.gz	fastq	395130702.0	5338263.0	GSM7688785 r1	0:74.02	A:107005793;C:90183031;G:92316770;T:105476481;N:148627	74	107005793	90183031	92316770	105476481	148627	SRX21286659	SRS18536772	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94534	0.07625	0.73888	0.48135	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24952	24952	SRR25557803	SRX21286659	SRS18536772	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control X	GSM7688785	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control X	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688785	GSM7688785: Control X; Danio rerio; RNA Seq	GSM7688785 r1	GSM7688785	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-X_S1_L002_R1_001.fastq.gz	fastq	396764458.0	5358448.0	GSM7688785 r2	0:74.04	A:107513717;C:90540282;G:92658504;T:105917444;N:134511	74	107513717	90540282	92658504	105917444	134511	SRX21286659	SRS18536772	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94374	0.07709	0.73878	0.47615	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24953	24953	SRR25557804	SRX21286659	SRS18536772	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control X	GSM7688785	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control X	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688785	GSM7688785: Control X; Danio rerio; RNA Seq	GSM7688785 r1	GSM7688785	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-X_S1_L003_R1_001.fastq.gz	fastq	399623551.0	5397520.0	GSM7688785 r3	0:74.04	A:108230540;C:91192011;G:93388052;T:106665106;N:147842	74	108230540	91192011	93388052	106665106	147842	SRX21286659	SRS18536772	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94399	0.07657	0.73797	0.4794	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24954	24954	SRR25557805	SRX21286659	SRS18536772	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control X	GSM7688785	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control X	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688785	GSM7688785: Control X; Danio rerio; RNA Seq	GSM7688785 r1	GSM7688785	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-X_S1_L004_R1_001.fastq.gz	fastq	393298978.0	5312101.0	GSM7688785 r4	0:74.04	A:106518845;C:89734564;G:91901232;T:105004490;N:139847	74	106518845	89734564	91901232	105004490	139847	SRX21286659	SRS18536772	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94423	0.07599	0.73884	0.47905	71	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24955	24955	SRR25557806	SRX21286658	SRS18536771	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control IX	GSM7688783	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control IX	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688783	GSM7688783: Control IX; Danio rerio; RNA Seq	GSM7688783 r1	GSM7688783	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-IX_S22_L001_R1_001.fastq.gz	fastq	366045799.0	4944832.0	GSM7688783 r1	0:74.03	A:98000119;C:84654222;G:86951226;T:96295351;N:144881	74	98000119	84654222	86951226	96295351	144881	SRX21286658	SRS18536771	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94303	0.07499	0.73085	0.47881	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24956	24956	SRR25557807	SRX21286658	SRS18536771	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control IX	GSM7688783	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control IX	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688783	GSM7688783: Control IX; Danio rerio; RNA Seq	GSM7688783 r1	GSM7688783	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-IX_S22_L002_R1_001.fastq.gz	fastq	369429068.0	4988719.0	GSM7688783 r2	0:74.05	A:98907882;C:85446993;G:87729593;T:97216477;N:128123	74	98907882	85446993	87729593	97216477	128123	SRX21286658	SRS18536771	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94261	0.07335	0.72969	0.47867	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24957	24957	SRR25557808	SRX21286658	SRS18536771	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control IX	GSM7688783	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control IX	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688783	GSM7688783: Control IX; Danio rerio; RNA Seq	GSM7688783 r1	GSM7688783	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-IX_S22_L003_R1_001.fastq.gz	fastq	369967330.0	4996710.0	GSM7688783 r3	0:74.04	A:99035743;C:85549878;G:87926587;T:97310812;N:144310	74	99035743	85549878	87926587	97310812	144310	SRX21286658	SRS18536771	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94328	0.0743	0.73034	0.47133	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24958	24958	SRR25557809	SRX21286658	SRS18536771	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control IX	GSM7688783	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control IX	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688783	GSM7688783: Control IX; Danio rerio; RNA Seq	GSM7688783 r1	GSM7688783	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-IX_S22_L004_R1_001.fastq.gz	fastq	365499176.0	4936305.0	GSM7688783 r4	0:74.04	A:97825658;C:84517732;G:86863655;T:96157429;N:134702	74	97825658	84517732	86863655	96157429	134702	SRX21286658	SRS18536771	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94286	0.07288	0.72999	0.4783	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24959	24959	SRR25557810	SRX21286657	SRS18536770	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control VIII	GSM7688782	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control VIII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688782	GSM7688782: Control VIII; Danio rerio; RNA Seq	GSM7688782 r1	GSM7688782	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-VIII_S20_L001_R1_001.fastq.gz	fastq	488585907.0	6585668.0	GSM7688782 r1	0:74.19	A:131727468;C:112349971;G:115189425;T:129203159;N:115884	74	131727468	112349971	115189425	129203159	115884	SRX21286657	SRS18536770	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.93794	0.07381	0.7315	0.47355	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24960	24960	SRR25557811	SRX21286657	SRS18536770	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control VIII	GSM7688782	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control VIII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688782	GSM7688782: Control VIII; Danio rerio; RNA Seq	GSM7688782 r1	GSM7688782	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-VIII_S20_L002_R1_001.fastq.gz	fastq	493766544.0	6653820.0	GSM7688782 r2	0:74.21	A:133135166;C:113551418;G:116398455;T:130575771;N:105734	74	133135166	113551418	116398455	130575771	105734	SRX21286657	SRS18536770	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.93729	0.07312	0.7307	0.47966	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24961	24961	SRR25557812	SRX21286657	SRS18536770	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control VIII	GSM7688782	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control VIII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688782	GSM7688782: Control VIII; Danio rerio; RNA Seq	GSM7688782 r1	GSM7688782	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-VIII_S20_L003_R1_001.fastq.gz	fastq	494935071.0	6670024.0	GSM7688782 r3	0:74.20	A:133406912;C:113769494;G:116771560;T:130871612;N:115493	74	133406912	113769494	116771560	130871612	115493	SRX21286657	SRS18536770	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.93847	0.07383	0.73194	0.47646	74	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24962	24962	SRR25557813	SRX21286657	SRS18536770	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control VIII	GSM7688782	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control VIII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688782	GSM7688782: Control VIII; Danio rerio; RNA Seq	GSM7688782 r1	GSM7688782	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-VIII_S20_L004_R1_001.fastq.gz	fastq	487644286.0	6572100.0	GSM7688782 r4	0:74.20	A:131423055;C:112092623;G:115067911;T:128945959;N:114738	74	131423055	112092623	115067911	128945959	114738	SRX21286657	SRS18536770	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.93708	0.0732	0.73186	0.4781	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24963	24963	SRR25557814	SRX21286656	SRS18536769	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control VII	GSM7688781	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control VII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688781	GSM7688781: Control VII; Danio rerio; RNA Seq	GSM7688781 r1	GSM7688781	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-VII_S21_L001_R1_001.fastq.gz	fastq	419048369.0	5664168.0	GSM7688781 r1	0:73.98	A:111569757;C:97553687;G:100228004;T:109523480;N:173441	73	111569757	97553687	100228004	109523480	173441	SRX21286656	SRS18536769	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94179	0.06596	0.74499	0.46809	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24964	24964	SRR25557815	SRX21286656	SRS18536769	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control VII	GSM7688781	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control VII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688781	GSM7688781: Control VII; Danio rerio; RNA Seq	GSM7688781 r1	GSM7688781	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-VII_S21_L002_R1_001.fastq.gz	fastq	422419362.0	5707444.0	GSM7688781 r2	0:74.01	A:112476977;C:98366185;G:101046586;T:110369882;N:159732	74	112476977	98366185	101046586	110369882	159732	SRX21286656	SRS18536769	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94275	0.06539	0.74523	0.47247	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24965	24965	SRR25557816	SRX21286656	SRS18536769	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control VII	GSM7688781	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control VII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688781	GSM7688781: Control VII; Danio rerio; RNA Seq	GSM7688781 r1	GSM7688781	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-VII_S21_L003_R1_001.fastq.gz	fastq	424260551.0	5733133.0	GSM7688781 r3	0:74.00	A:112957538;C:98789480;G:101496747;T:110850186;N:166600	74	112957538	98789480	101496747	110850186	166600	SRX21286656	SRS18536769	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94174	0.06482	0.74304	0.46935	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24966	24966	SRR25557817	SRX21286656	SRS18536769	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control VII	GSM7688781	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control VII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688781	GSM7688781: Control VII; Danio rerio; RNA Seq	GSM7688781 r1	GSM7688781	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-VII_S21_L004_R1_001.fastq.gz	fastq	417875320.0	5646817.0	GSM7688781 r4	0:74.00	A:111226895;C:97273168;G:100030641;T:109182520;N:162096	74	111226895	97273168	100030641	109182520	162096	SRX21286656	SRS18536769	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94352	0.06524	0.74442	0.47095	74	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
26558	26558	SRR26173859	SRX21885960	SRS18977085	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample2 354 F17 R1	GSM7804200	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample2 354 F17 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804200	GSM7804200: V2a sample2 354 F17 R1; Danio rerio; RNA Seq	GSM7804200 r1	GSM7804200	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_354_F17_R1.fastq.gz	fastq	26979490.0	627430.0	GSM7804200 r1	0:43	A:7493119;C:5872644;G:6013311;T:7600416;N:0	43	7493119	5872644	6013311	7600416	0	SRX21885960	SRS18977085	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.82979	0.33034	0.94253	0.53995	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26559	26559	SRR26173860	SRX21885959	SRS18977083	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample2 354 F16 R1	GSM7804199	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample2 354 F16 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804199	GSM7804199: V2a sample2 354 F16 R1; Danio rerio; RNA Seq	GSM7804199 r1	GSM7804199	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_354_F16_R1.fastq.gz	fastq	26312130.0	611910.0	GSM7804199 r1	0:43	A:7117249;C:5957278;G:6103577;T:7134026;N:0	43	7117249	5957278	6103577	7134026	0	SRX21885959	SRS18977083	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.87071	0.23579	0.90678	0.52226	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26560	26560	SRR26173861	SRX21885958	SRS18977084	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample2 354 F15 R1	GSM7804198	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample2 354 F15 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804198	GSM7804198: V2a sample2 354 F15 R1; Danio rerio; RNA Seq	GSM7804198 r1	GSM7804198	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_354_F15_R1.fastq.gz	fastq	32073872.0	745904.0	GSM7804198 r1	0:43	A:8695962;C:7255833;G:7422516;T:8699561;N:0	43	8695962	7255833	7422516	8699561	0	SRX21885958	SRS18977084	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.86262	0.24391	0.90881	0.52511	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26561	26561	SRR26173862	SRX21885957	SRS18977081	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample2 354 F14 R1	GSM7804197	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample2 354 F14 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804197	GSM7804197: V2a sample2 354 F14 R1; Danio rerio; RNA Seq	GSM7804197 r1	GSM7804197	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_354_F14_R1.fastq.gz	fastq	31158875.0	724625.0	GSM7804197 r1	0:43	A:8769852;C:6707813;G:6866255;T:8814955;N:0	43	8769852	6707813	6866255	8814955	0	SRX21885957	SRS18977081	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.8739	0.27254	0.9246	0.54185	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26562	26562	SRR26173863	SRX21885956	SRS18977082	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample2 354 F13 R1	GSM7804196	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample2 354 F13 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804196	GSM7804196: V2a sample2 354 F13 R1; Danio rerio; RNA Seq	GSM7804196 r1	GSM7804196	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_354_F13_R1.fastq.gz	fastq	41289804.0	960228.0	GSM7804196 r1	0:43	A:11114918;C:9358398;G:9568761;T:11247727;N:0	43	11114918	9358398	9568761	11247727	0	SRX21885956	SRS18977082	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.82861	0.29409	0.93235	0.49485	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26563	26563	SRR26173864	SRX21885955	SRS18977079	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample2 354 F12 R1	GSM7804195	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample2 354 F12 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804195	GSM7804195: V2a sample2 354 F12 R1; Danio rerio; RNA Seq	GSM7804195 r1	GSM7804195	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_354_F12_R1.fastq.gz	fastq	30569259.0	710913.0	GSM7804195 r1	0:43	A:8286806;C:6854804;G:7028453;T:8399196;N:0	43	8286806	6854804	7028453	8399196	0	SRX21885955	SRS18977079	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.80426	0.29136	0.94123	0.54305	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26564	26564	SRR26173865	SRX21885954	SRS18977080	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample2 354 F11 R1	GSM7804194	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample2 354 F11 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804194	GSM7804194: V2a sample2 354 F11 R1; Danio rerio; RNA Seq	GSM7804194 r1	GSM7804194	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_354_F11_R1.fastq.gz	fastq	29626097.0	688979.0	GSM7804194 r1	0:43	A:8063765;C:6645347;G:6803778;T:8113207;N:0	43	8063765	6645347	6803778	8113207	0	SRX21885954	SRS18977080	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.84972	0.26423	0.9234	0.54087	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26565	26565	SRR26173866	SRX21885953	SRS18977078	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample2 354 F10 R1	GSM7804193	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample2 354 F10 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804193	GSM7804193: V2a sample2 354 F10 R1; Danio rerio; RNA Seq	GSM7804193 r1	GSM7804193	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_354_F10_R1.fastq.gz	fastq	24594409.0	571963.0	GSM7804193 r1	0:43	A:6605642;C:5535165;G:5682586;T:6771016;N:0	43	6605642	5535165	5682586	6771016	0	SRX21885953	SRS18977078	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.77683	0.28872	0.94633	0.52513	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26566	26566	SRR26173867	SRX21885952	SRS18977077	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample2 354 E9 R1	GSM7804168	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample2 354 E9 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804168	GSM7804168: V2a sample2 354 E9 R1; Danio rerio; RNA Seq	GSM7804168 r1	GSM7804168	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_354_E9_R1.fastq.gz	fastq	33259941.0	773487.0	GSM7804168 r1	0:43	A:9004615;C:7506729;G:7674909;T:9073688;N:0	43	9004615	7506729	7674909	9073688	0	SRX21885952	SRS18977077	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.85528	0.32094	0.89217	0.50224	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26567	26567	SRR26173868	SRX21885951	SRS18977076	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample2 354 E8 R1	GSM7804167	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample2 354 E8 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804167	GSM7804167: V2a sample2 354 E8 R1; Danio rerio; RNA Seq	GSM7804167 r1	GSM7804167	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_354_E8_R1.fastq.gz	fastq	45348316.0	1054612.0	GSM7804167 r1	0:43	A:12143243;C:10459395;G:10612458;T:12133220;N:0	43	12143243	10459395	10612458	12133220	0	SRX21885951	SRS18977076	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.8783	0.19318	0.88572	0.49101	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26568	26568	SRR26173869	SRX21885950	SRS18977075	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample2 354 E7 R1	GSM7804166	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample2 354 E7 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804166	GSM7804166: V2a sample2 354 E7 R1; Danio rerio; RNA Seq	GSM7804166 r1	GSM7804166	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_354_E7_R1.fastq.gz	fastq	30522002.0	709814.0	GSM7804166 r1	0:43	A:8167984;C:7033955;G:7127866;T:8192197;N:0	43	8167984	7033955	7127866	8192197	0	SRX21885950	SRS18977075	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.87804	0.20762	0.88418	0.51381	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26569	26569	SRR26173870	SRX21885949	SRS18977074	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample2 354 E6 R1	GSM7804165	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample2 354 E6 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804165	GSM7804165: V2a sample2 354 E6 R1; Danio rerio; RNA Seq	GSM7804165 r1	GSM7804165	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_354_E6_R1.fastq.gz	fastq	39095858.0	909206.0	GSM7804165 r1	0:43	A:10597068;C:8804712;G:8974908;T:10719170;N:0	43	10597068	8804712	8974908	10719170	0	SRX21885949	SRS18977074	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.8093	0.38297	0.91545	0.56195	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26570	26570	SRR26173871	SRX21885948	SRS18977073	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample2 354 E5 R1	GSM7804164	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample2 354 E5 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804164	GSM7804164: V2a sample2 354 E5 R1; Danio rerio; RNA Seq	GSM7804164 r1	GSM7804164	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_354_E5_R1.fastq.gz	fastq	33632880.0	782160.0	GSM7804164 r1	0:43	A:9099447;C:7602241;G:7747634;T:9183558;N:0	43	9099447	7602241	7747634	9183558	0	SRX21885948	SRS18977073	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.83226	0.28405	0.90715	0.52148	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26571	26571	SRR26173872	SRX21885947	SRS18977072	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample2 354 E4 R1	GSM7804163	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample2 354 E4 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804163	GSM7804163: V2a sample2 354 E4 R1; Danio rerio; RNA Seq	GSM7804163 r1	GSM7804163	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_354_E4_R1.fastq.gz	fastq	10823057.0	251699.0	GSM7804163 r1	0:43	A:3014035;C:2419189;G:2487845;T:2901988;N:0	43	3014035	2419189	2487845	2901988	0	SRX21885947	SRS18977072	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.85783	0.26946	0.91033	0.52459	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26572	26572	SRR26173873	SRX21885946	SRS18977068	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample2 354 E3 R1	GSM7804162	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample2 354 E3 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804162	GSM7804162: V2a sample2 354 E3 R1; Danio rerio; RNA Seq	GSM7804162 r1	GSM7804162	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_354_E3_R1.fastq.gz	fastq	49775381.0	1157567.0	GSM7804162 r1	0:43	A:13325978;C:11313973;G:11568082;T:13567348;N:0	43	13325978	11313973	11568082	13567348	0	SRX21885946	SRS18977068	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.80873	0.29504	0.93791	0.52789	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26573	26573	SRR26173874	SRX21885945	SRS18977070	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample2 354 E2 R1	GSM7804161	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample2 354 E2 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804161	GSM7804161: V2a sample2 354 E2 R1; Danio rerio; RNA Seq	GSM7804161 r1	GSM7804161	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_354_E2_R1.fastq.gz	fastq	44072334.0	1024938.0	GSM7804161 r1	0:43	A:11780930;C:10068667;G:10185567;T:12037170;N:0	43	11780930	10068667	10185567	12037170	0	SRX21885945	SRS18977070	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.78009	0.2621	0.943	0.54719	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26574	26574	SRR26173875	SRX21885944	SRS18977071	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample2 354 D1 R1	GSM7804136	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample2 354 D1 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804136	GSM7804136: V2a sample2 354 D1 R1; Danio rerio; RNA Seq	GSM7804136 r1	GSM7804136	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_354_D1_R1.fastq.gz	fastq	49923.0	1161.0	GSM7804136 r1	0:43	A:12799;C:11604;G:11134;T:14386;N:0	43	12799	11604	11134	14386	0	SRX21885944	SRS18977071	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.5773	0.18478	0.99472	0.51097	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26575	26575	SRR26173876	SRX21885943	SRS18977069	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample2 354 C24 R1	GSM7804135	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample2 354 C24 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804135	GSM7804135: V2a sample2 354 C24 R1; Danio rerio; RNA Seq	GSM7804135 r1	GSM7804135	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_354_C24_R1.fastq.gz	fastq	30735540.0	714780.0	GSM7804135 r1	0:43	A:7999390;C:7036767;G:7190113;T:8509270;N:0	43	7999390	7036767	7190113	8509270	0	SRX21885943	SRS18977069	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.48457	0.16974	0.99328	0.82979	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26576	26576	SRR26173877	SRX21885942	SRS18977067	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample2 354 C23 R1	GSM7804134	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample2 354 C23 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804134	GSM7804134: V2a sample2 354 C23 R1; Danio rerio; RNA Seq	GSM7804134 r1	GSM7804134	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_354_C23_R1.fastq.gz	fastq	24386031.0	567117.0	GSM7804134 r1	0:43	A:6620599;C:5230020;G:5371347;T:7164065;N:0	43	6620599	5230020	5371347	7164065	0	SRX21885942	SRS18977067	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.55183	0.13531	0.99105	0.54904	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26577	26577	SRR26173878	SRX21885941	SRS18977064	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample2 354 C22 R1	GSM7804133	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample2 354 C22 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804133	GSM7804133: V2a sample2 354 C22 R1; Danio rerio; RNA Seq	GSM7804133 r1	GSM7804133	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_354_C22_R1.fastq.gz	fastq	35984550.0	836850.0	GSM7804133 r1	0:43	A:9917644;C:7959027;G:8126203;T:9981676;N:0	43	9917644	7959027	8126203	9981676	0	SRX21885941	SRS18977064	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.85473	0.2804	0.91165	0.52909	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26578	26578	SRR26173879	SRX21885940	SRS18977065	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample2 354 C21 R1	GSM7804132	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample2 354 C21 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804132	GSM7804132: V2a sample2 354 C21 R1; Danio rerio; RNA Seq	GSM7804132 r1	GSM7804132	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_354_C21_R1.fastq.gz	fastq	32265738.0	750366.0	GSM7804132 r1	0:43	A:8963112;C:7046873;G:7192067;T:9063686;N:0	43	8963112	7046873	7192067	9063686	0	SRX21885940	SRS18977065	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.8426	0.36876	0.91179	0.58759	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26579	26579	SRR26173880	SRX21885939	SRS18977066	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample2 354 C20 R1	GSM7804131	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample2 354 C20 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804131	GSM7804131: V2a sample2 354 C20 R1; Danio rerio; RNA Seq	GSM7804131 r1	GSM7804131	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_354_C20_R1.fastq.gz	fastq	33471157.0	778399.0	GSM7804131 r1	0:43	A:9073629;C:7510863;G:7675381;T:9211284;N:0	43	9073629	7510863	7675381	9211284	0	SRX21885939	SRS18977066	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.82141	0.28926	0.93655	0.49873	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26580	26580	SRR26173881	SRX21885938	SRS18977062	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample2 354 C19 R1	GSM7804130	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample2 354 C19 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804130	GSM7804130: V2a sample2 354 C19 R1; Danio rerio; RNA Seq	GSM7804130 r1	GSM7804130	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_354_C19_R1.fastq.gz	fastq	30131304.0	700728.0	GSM7804130 r1	0:43	A:8036932;C:6893678;G:7034855;T:8165839;N:0	43	8036932	6893678	7034855	8165839	0	SRX21885938	SRS18977062	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.80896	0.25245	0.94067	0.54072	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26581	26581	SRR26173882	SRX21885937	SRS18977061	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample2 354 C18 R1	GSM7804129	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample2 354 C18 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804129	GSM7804129: V2a sample2 354 C18 R1; Danio rerio; RNA Seq	GSM7804129 r1	GSM7804129	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_354_C18_R1.fastq.gz	fastq	31050429.0	722103.0	GSM7804129 r1	0:43	A:8363024;C:7088111;G:7227301;T:8371993;N:0	43	8363024	7088111	7227301	8371993	0	SRX21885937	SRS18977061	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.87399	0.20843	0.89881	0.49682	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26582	26582	SRR26173883	SRX21885936	SRS18977063	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample2 354 B17 R1	GSM7804104	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample2 354 B17 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804104	GSM7804104: V2a sample2 354 B17 R1; Danio rerio; RNA Seq	GSM7804104 r1	GSM7804104	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_354_B17_R1.fastq.gz	fastq	47093729.0	1095203.0	GSM7804104 r1	0:43	A:13057598;C:10185883;G:10457076;T:13393172;N:0	43	13057598	10185883	10457076	13393172	0	SRX21885936	SRS18977063	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.80343	0.36098	0.95059	0.52562	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26583	26583	SRR26173884	SRX21885935	SRS18977060	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample2 354 B16 R1	GSM7804103	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample2 354 B16 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804103	GSM7804103: V2a sample2 354 B16 R1; Danio rerio; RNA Seq	GSM7804103 r1	GSM7804103	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_354_B16_R1.fastq.gz	fastq	34160791.0	794437.0	GSM7804103 r1	0:43	A:9178469;C:7729053;G:7901331;T:9351938;N:0	43	9178469	7729053	7901331	9351938	0	SRX21885935	SRS18977060	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.79028	0.25695	0.94627	0.51668	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26584	26584	SRR26173885	SRX21885934	SRS18977059	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample2 354 B15 R1	GSM7804102	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample2 354 B15 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804102	GSM7804102: V2a sample2 354 B15 R1; Danio rerio; RNA Seq	GSM7804102 r1	GSM7804102	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_354_B15_R1.fastq.gz	fastq	29152495.0	677965.0	GSM7804102 r1	0:43	A:7966546;C:6516464;G:6675123;T:7994362;N:0	43	7966546	6516464	6675123	7994362	0	SRX21885934	SRS18977059	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.83832	0.25969	0.92673	0.51661	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26585	26585	SRR26173886	SRX21885933	SRS18977057	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample2 354 B14 R1	GSM7804101	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample2 354 B14 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804101	GSM7804101: V2a sample2 354 B14 R1; Danio rerio; RNA Seq	GSM7804101 r1	GSM7804101	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_354_B14_R1.fastq.gz	fastq	23811379.0	553753.0	GSM7804101 r1	0:43	A:6532691;C:5215122;G:5353003;T:6710563;N:0	43	6532691	5215122	5353003	6710563	0	SRX21885933	SRS18977057	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.74067	0.3282	0.95272	0.49582	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26586	26586	SRR26173887	SRX21885932	SRS18977058	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample2 354 B13 R1	GSM7804100	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample2 354 B13 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804100	GSM7804100: V2a sample2 354 B13 R1; Danio rerio; RNA Seq	GSM7804100 r1	GSM7804100	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_354_B13_R1.fastq.gz	fastq	18141356.0	421892.0	GSM7804100 r1	0:43	A:4926550;C:4092334;G:4186281;T:4936191;N:0	43	4926550	4092334	4186281	4936191	0	SRX21885932	SRS18977058	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.87463	0.22642	0.89826	0.50541	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26587	26587	SRR26173888	SRX21885931	SRS18977056	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample2 354 B12 R1	GSM7804099	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample2 354 B12 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804099	GSM7804099: V2a sample2 354 B12 R1; Danio rerio; RNA Seq	GSM7804099 r1	GSM7804099	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_354_B12_R1.fastq.gz	fastq	34932039.0	812373.0	GSM7804099 r1	0:43	A:9555191;C:7704451;G:7897587;T:9774810;N:0	43	9555191	7704451	7897587	9774810	0	SRX21885931	SRS18977056	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.80402	0.30224	0.93592	0.53659	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26588	26588	SRR26173889	SRX21885930	SRS18977055	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample2 354 B11 R1	GSM7804098	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample2 354 B11 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804098	GSM7804098: V2a sample2 354 B11 R1; Danio rerio; RNA Seq	GSM7804098 r1	GSM7804098	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_354_B11_R1.fastq.gz	fastq	35987087.0	836909.0	GSM7804098 r1	0:43	A:9801738;C:8047161;G:8248020;T:9890168;N:0	43	9801738	8047161	8248020	9890168	0	SRX21885930	SRS18977055	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.81805	0.24526	0.92092	0.54523	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26589	26589	SRR26173890	SRX21885929	SRS18977054	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample2 354 B10 R1	GSM7804097	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample2 354 B10 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804097	GSM7804097: V2a sample2 354 B10 R1; Danio rerio; RNA Seq	GSM7804097 r1	GSM7804097	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_354_B10_R1.fastq.gz	fastq	33252846.0	773322.0	GSM7804097 r1	0:43	A:8996915;C:7433025;G:7633859;T:9189047;N:0	43	8996915	7433025	7633859	9189047	0	SRX21885929	SRS18977054	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.78892	0.28622	0.94237	0.53023	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26590	26590	SRR26173891	SRX21885928	SRS18977053	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample2 354 A9 R1	GSM7804072	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample2 354 A9 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804072	GSM7804072: V2a sample2 354 A9 R1; Danio rerio; RNA Seq	GSM7804072 r1	GSM7804072	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_354_A9_R1.fastq.gz	fastq	23658600.0	550200.0	GSM7804072 r1	0:43	A:6447300;C:5342358;G:5472128;T:6396814;N:0	43	6447300	5342358	5472128	6396814	0	SRX21885928	SRS18977053	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.86727	0.23136	0.8996	0.52692	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26591	26591	SRR26173892	SRX21885927	SRS18977051	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample2 354 A8 R1	GSM7804071	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample2 354 A8 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804071	GSM7804071: V2a sample2 354 A8 R1; Danio rerio; RNA Seq	GSM7804071 r1	GSM7804071	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_354_A8_R1.fastq.gz	fastq	18645187.0	433609.0	GSM7804071 r1	0:43	A:5151340;C:4145072;G:4243308;T:5105467;N:0	43	5151340	4145072	4243308	5105467	0	SRX21885927	SRS18977051	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.86561	0.28633	0.89438	0.53463	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26592	26592	SRR26173893	SRX21885926	SRS18977052	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample2 354 A7 R1	GSM7804070	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample2 354 A7 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804070	GSM7804070: V2a sample2 354 A7 R1; Danio rerio; RNA Seq	GSM7804070 r1	GSM7804070	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_354_A7_R1.fastq.gz	fastq	42340466.0	984662.0	GSM7804070 r1	0:43	A:11373539;C:9660020;G:9840242;T:11466665;N:0	43	11373539	9660020	9840242	11466665	0	SRX21885926	SRS18977052	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.81646	0.24599	0.93833	0.57817	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26593	26593	SRR26173894	SRX21885925	SRS18977050	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample2 354 A6 R1	GSM7804069	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample2 354 A6 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804069	GSM7804069: V2a sample2 354 A6 R1; Danio rerio; RNA Seq	GSM7804069 r1	GSM7804069	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_354_A6_R1.fastq.gz	fastq	23486858.0	546206.0	GSM7804069 r1	0:43	A:6654369;C:4998242;G:5115579;T:6718668;N:0	43	6654369	4998242	5115579	6718668	0	SRX21885925	SRS18977050	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.84122	0.57245	0.77794	0.53266	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26594	26594	SRR26173895	SRX21885924	SRS18977048	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample2 354 A5 R1	GSM7804068	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample2 354 A5 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804068	GSM7804068: V2a sample2 354 A5 R1; Danio rerio; RNA Seq	GSM7804068 r1	GSM7804068	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_354_A5_R1.fastq.gz	fastq	46876450.0	1090150.0	GSM7804068 r1	0:43	A:12599291;C:10693086;G:10940020;T:12644053;N:0	43	12599291	10693086	10940020	12644053	0	SRX21885924	SRS18977048	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.86707	0.22085	0.89412	0.51257	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26595	26595	SRR26173896	SRX21885923	SRS18977049	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample2 354 A4 R1	GSM7804067	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample2 354 A4 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804067	GSM7804067: V2a sample2 354 A4 R1; Danio rerio; RNA Seq	GSM7804067 r1	GSM7804067	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_354_A4_R1.fastq.gz	fastq	43487233.0	1011331.0	GSM7804067 r1	0:43	A:11900913;C:9677048;G:9921622;T:11987650;N:0	43	11900913	9677048	9921622	11987650	0	SRX21885923	SRS18977049	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.8409	0.27122	0.91165	0.55221	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26596	26596	SRR26173897	SRX21885922	SRS18977047	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample2 354 A3 R1	GSM7804066	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample2 354 A3 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804066	GSM7804066: V2a sample2 354 A3 R1; Danio rerio; RNA Seq	GSM7804066 r1	GSM7804066	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_354_A3_R1.fastq.gz	fastq	44287248.0	1029936.0	GSM7804066 r1	0:43	A:12065729;C:9907516;G:10143806;T:12170197;N:0	43	12065729	9907516	10143806	12170197	0	SRX21885922	SRS18977047	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.80982	0.29232	0.93675	0.5661	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26597	26597	SRR26173898	SRX21885921	SRS18977046	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample2 354 A2 R1	GSM7804065	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample2 354 A2 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804065	GSM7804065: V2a sample2 354 A2 R1; Danio rerio; RNA Seq	GSM7804065 r1	GSM7804065	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_354_A2_R1.fastq.gz	fastq	39822515.0	926105.0	GSM7804065 r1	0:43	A:10662390;C:9155016;G:9361757;T:10643352;N:0	43	10662390	9155016	9361757	10643352	0	SRX21885921	SRS18977046	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.88377	0.19244	0.88627	0.52412	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26598	26598	SRR26173899	SRX21885920	SRS18977044	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample1 353 P1 R1	GSM7804040	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample1 353 P1 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804040	GSM7804040: V2a sample1 353 P1 R1; Danio rerio; RNA Seq	GSM7804040 r1	GSM7804040	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_353_P1_R1.fastq.gz	fastq	35622877.0	828439.0	GSM7804040 r1	0:43	A:10094838;C:7580955;G:7760837;T:10186247;N:0	43	10094838	7580955	7760837	10186247	0	SRX21885920	SRS18977044	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.82753	0.38743	0.94085	0.70753	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26599	26599	SRR26173900	SRX21885919	SRS18977045	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample1 353 O24 R1	GSM7804039	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample1 353 O24 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804039	GSM7804039: V2a sample1 353 O24 R1; Danio rerio; RNA Seq	GSM7804039 r1	GSM7804039	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_353_O24_R1.fastq.gz	fastq	25162482.0	585174.0	GSM7804039 r1	0:43	A:6589034;C:5708817;G:5862315;T:7002316;N:0	43	6589034	5708817	5862315	7002316	0	SRX21885919	SRS18977045	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.50646	0.15797	0.99086	0.48626	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26600	26600	SRR26173901	SRX21885918	SRS18977043	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample1 353 O23 R1	GSM7804038	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample1 353 O23 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804038	GSM7804038: V2a sample1 353 O23 R1; Danio rerio; RNA Seq	GSM7804038 r1	GSM7804038	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_353_O23_R1.fastq.gz	fastq	21378396.0	497172.0	GSM7804038 r1	0:43	A:5419690;C:4870276;G:5019946;T:6068484;N:0	43	5419690	4870276	5019946	6068484	0	SRX21885918	SRS18977043	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.4177	0.18826	0.99344	0.78066	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26601	26601	SRR26173902	SRX21885917	SRS18977042	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample1 353 O22 R1	GSM7804037	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample1 353 O22 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804037	GSM7804037: V2a sample1 353 O22 R1; Danio rerio; RNA Seq	GSM7804037 r1	GSM7804037	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_353_O22_R1.fastq.gz	fastq	30321665.0	705155.0	GSM7804037 r1	0:43	A:8123534;C:6839326;G:6921711;T:8437094;N:0	43	8123534	6839326	6921711	8437094	0	SRX21885917	SRS18977042	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.76574	0.24445	0.94014	0.51811	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26602	26602	SRR26173903	SRX21885916	SRS18977041	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample1 353 O21 R1	GSM7804036	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample1 353 O21 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804036	GSM7804036: V2a sample1 353 O21 R1; Danio rerio; RNA Seq	GSM7804036 r1	GSM7804036	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_353_O21_R1.fastq.gz	fastq	24544916.0	570812.0	GSM7804036 r1	0:43	A:6528543;C:5656479;G:5771413;T:6588481;N:0	43	6528543	5656479	5771413	6588481	0	SRX21885916	SRS18977041	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.87756	0.17329	0.88124	0.51427	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26603	26603	SRR26173904	SRX21885915	SRS18977040	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample1 353 O20 R1	GSM7804035	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample1 353 O20 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804035	GSM7804035: V2a sample1 353 O20 R1; Danio rerio; RNA Seq	GSM7804035 r1	GSM7804035	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_353_O20_R1.fastq.gz	fastq	27471324.0	638868.0	GSM7804035 r1	0:43	A:7349212;C:6154048;G:6323796;T:7644268;N:0	43	7349212	6154048	6323796	7644268	0	SRX21885915	SRS18977040	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.7529	0.26778	0.94635	0.5148	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26604	26604	SRR26173905	SRX21885914	SRS18977039	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample1 353 O19 R1	GSM7804034	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample1 353 O19 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804034	GSM7804034: V2a sample1 353 O19 R1; Danio rerio; RNA Seq	GSM7804034 r1	GSM7804034	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_353_O19_R1.fastq.gz	fastq	24908137.0	579259.0	GSM7804034 r1	0:43	A:6706594;C:5634956;G:5764632;T:6801955;N:0	43	6706594	5634956	5764632	6801955	0	SRX21885914	SRS18977039	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.8525	0.23739	0.90694	0.5194	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26605	26605	SRR26173906	SRX21885913	SRS18977038	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample1 353 O18 R1	GSM7804033	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample1 353 O18 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804033	GSM7804033: V2a sample1 353 O18 R1; Danio rerio; RNA Seq	GSM7804033 r1	GSM7804033	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_353_O18_R1.fastq.gz	fastq	23328790.0	542530.0	GSM7804033 r1	0:43	A:6296932;C:5290824;G:5423100;T:6317934;N:0	43	6296932	5290824	5423100	6317934	0	SRX21885913	SRS18977038	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.87485	0.19256	0.88422	0.46891	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26606	26606	SRR26173907	SRX21885912	SRS18977037	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample1 353 N17 R1	GSM7804008	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample1 353 N17 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804008	GSM7804008: V2a sample1 353 N17 R1; Danio rerio; RNA Seq	GSM7804008 r1	GSM7804008	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_353_N17_R1.fastq.gz	fastq	20379592.0	473944.0	GSM7804008 r1	0:43	A:5592768;C:4503044;G:4602811;T:5680969;N:0	43	5592768	4503044	4602811	5680969	0	SRX21885912	SRS18977037	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.84619	0.24373	0.94095	0.4423	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26607	26607	SRR26173908	SRX21885911	SRS18977035	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample1 353 N16 R1	GSM7804007	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample1 353 N16 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804007	GSM7804007: V2a sample1 353 N16 R1; Danio rerio; RNA Seq	GSM7804007 r1	GSM7804007	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_353_N16_R1.fastq.gz	fastq	14151343.0	329101.0	GSM7804007 r1	0:43	A:3796916;C:3223155;G:3290919;T:3840353;N:0	43	3796916	3223155	3290919	3840353	0	SRX21885911	SRS18977035	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.85097	0.21705	0.93097	0.52334	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26608	26608	SRR26173909	SRX21885910	SRS18977036	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample1 353 N15 R1	GSM7804006	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample1 353 N15 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804006	GSM7804006: V2a sample1 353 N15 R1; Danio rerio; RNA Seq	GSM7804006 r1	GSM7804006	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_353_N15_R1.fastq.gz	fastq	16536209.0	384563.0	GSM7804006 r1	0:43	A:4473687;C:3744698;G:3838620;T:4479204;N:0	43	4473687	3744698	3838620	4479204	0	SRX21885910	SRS18977036	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.88744	0.19834	0.89966	0.5281	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26609	26609	SRR26173910	SRX21885909	SRS18977034	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample1 353 N14 R1	GSM7804005	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample1 353 N14 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804005	GSM7804005: V2a sample1 353 N14 R1; Danio rerio; RNA Seq	GSM7804005 r1	GSM7804005	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_353_N14_R1.fastq.gz	fastq	16039215.0	373005.0	GSM7804005 r1	0:43	A:4355837;C:3605999;G:3695364;T:4382015;N:0	43	4355837	3605999	3695364	4382015	0	SRX21885909	SRS18977034	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.86632	0.22226	0.90268	0.5092	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26610	26610	SRR26173911	SRX21885908	SRS18977033	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample1 353 N13 R1	GSM7804004	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample1 353 N13 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804004	GSM7804004: V2a sample1 353 N13 R1; Danio rerio; RNA Seq	GSM7804004 r1	GSM7804004	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_353_N13_R1.fastq.gz	fastq	15280910.0	355370.0	GSM7804004 r1	0:43	A:4072742;C:3469231;G:3555056;T:4183881;N:0	43	4072742	3469231	3555056	4183881	0	SRX21885908	SRS18977033	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.73874	0.31529	0.95988	0.5442	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26611	26611	SRR26173912	SRX21885907	SRS18977032	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample1 353 N12 R1	GSM7804003	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample1 353 N12 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804003	GSM7804003: V2a sample1 353 N12 R1; Danio rerio; RNA Seq	GSM7804003 r1	GSM7804003	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_353_N12_R1.fastq.gz	fastq	10529926.0	244882.0	GSM7804003 r1	0:43	A:2835885;C:2354590;G:2390746;T:2948705;N:0	43	2835885	2354590	2390746	2948705	0	SRX21885907	SRS18977032	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.74571	0.36729	0.9443	0.77069	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26612	26612	SRR26173913	SRX21885906	SRS18977030	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample1 353 N11 R1	GSM7804002	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample1 353 N11 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804002	GSM7804002: V2a sample1 353 N11 R1; Danio rerio; RNA Seq	GSM7804002 r1	GSM7804002	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_353_N11_R1.fastq.gz	fastq	21706271.0	504797.0	GSM7804002 r1	0:43	A:5853146;C:4922477;G:5009970;T:5920678;N:0	43	5853146	4922477	5009970	5920678	0	SRX21885906	SRS18977030	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.8394	0.23984	0.93468	0.51881	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26613	26613	SRR26173914	SRX21885905	SRS18977031	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample1 353 N10 R1	GSM7804001	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample1 353 N10 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7804001	GSM7804001: V2a sample1 353 N10 R1; Danio rerio; RNA Seq	GSM7804001 r1	GSM7804001	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_353_N10_R1.fastq.gz	fastq	22772585.0	529595.0	GSM7804001 r1	0:43	A:6225918;C:5071489;G:5184079;T:6291099;N:0	43	6225918	5071489	5184079	6291099	0	SRX21885905	SRS18977031	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.83486	0.27703	0.92433	0.54887	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26614	26614	SRR26173915	SRX21885904	SRS18977029	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample1 353 M9 R1	GSM7803976	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample1 353 M9 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7803976	GSM7803976: V2a sample1 353 M9 R1; Danio rerio; RNA Seq	GSM7803976 r1	GSM7803976	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_353_M9_R1.fastq.gz	fastq	19698730.0	458110.0	GSM7803976 r1	0:43	A:5282525;C:4494162;G:4591316;T:5330727;N:0	43	5282525	4494162	4591316	5330727	0	SRX21885904	SRS18977029	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.8598	0.23744	0.90871	0.52081	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26615	26615	SRR26173916	SRX21885903	SRS18977028	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample1 353 M8 R1	GSM7803975	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample1 353 M8 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7803975	GSM7803975: V2a sample1 353 M8 R1; Danio rerio; RNA Seq	GSM7803975 r1	GSM7803975	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_353_M8_R1.fastq.gz	fastq	19646485.0	456895.0	GSM7803975 r1	0:43	A:5214519;C:4539724;G:4616920;T:5275322;N:0	43	5214519	4539724	4616920	5275322	0	SRX21885903	SRS18977028	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.82407	0.22367	0.94298	0.50209	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26616	26616	SRR26173917	SRX21885902	SRS18977025	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample1 353 M7 R1	GSM7803974	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample1 353 M7 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7803974	GSM7803974: V2a sample1 353 M7 R1; Danio rerio; RNA Seq	GSM7803974 r1	GSM7803974	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_353_M7_R1.fastq.gz	fastq	7333994.0	170558.0	GSM7803974 r1	0:43	A:1958042;C:1671444;G:1690497;T:2014011;N:0	43	1958042	1671444	1690497	2014011	0	SRX21885902	SRS18977025	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.77392	0.29548	0.95114	0.51367	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System
26617	26617	SRR26173918	SRX21885901	SRS18977027	SRP463130	PRJNA1020854	Molecular blueprints for spinal circuit modules controlling locomotor speed	GSE243993	Transcriptome Analysis	The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.		pubmed:37919423	V2a sample1 353 M6 R1	GSM7803973	source name:Spinal cord\|tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons\|geo loc name:missing\|collection date:missing	V2a sample1 353 M6 R1	The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis	Spinal cord		Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2		tissue:Spinal cord\|cell line:Chx10:GFP\|cell type:V2a interneurons	GSM7803973	GSM7803973: V2a sample1 353 M6 R1; Danio rerio; RNA Seq	GSM7803973 r1	GSM7803973	1	Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2	RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP463130		SS2_18_353_M6_R1.fastq.gz	fastq	23546413.0	547591.0	GSM7803973 r1	0:43	A:6369803;C:5317401;G:5430197;T:6429012;N:0	43	6369803	5317401	5430197	6429012	0	SRX21885901	SRS18977027	SRA1719948	Neuroscience, Karolinaska Institutet	Neuroscience, Karolinaska Institutet	1	0.85602	0.25223	0.92654	0.5306	43	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	Sweden	2023-09-25	Juvenile	Juvenile	Spinal Cord	Nervous System

Advanced export

JSON shape: default, array, newline-delimited

CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;