metadata: run_metadata: 562 rows where experiment.library_layout = "SINGLE", experiment.library_source = "TRANSCRIPTOMIC" and tissue

562 rows where experiment.library_layout = "SINGLE", experiment.library_source = "TRANSCRIPTOMIC" and tissue_curation = "Spinal Cord"

descending

Link	rowid ▼	run.accession	experiment.accession	sample.accession	study.accession	bioproject	study.title	study.alias	study.type	study.abstract	study.attributes	study.PMIDs	sample.title	sample.alias	sample.attributes	GEOsample.title	GEOsample.dataprocessing	GEOsample.source	GEOsample.treatmentprotocol	GEOsample.extractprotocol	GEOsample.growthprotocol	GEOsample.characteristics	GEOsample.accession	experiment.title	experiment.alias	experiment.library_name	experiment.design_description	experiment.library_construction_protocol	experiment.attributes	experiment.library_strategy	experiment.library_source	experiment.library_selection	experiment.library_layout	experiment.platform	experiment.instrument_model	experiment.study_ref	run.attributes	run.filename	run.semantic_name	run.total_bases	run.total_spots	run.alias	run.read_lengths	run.base_counts	run.r1_length	run.r2_length	run.Acount	run.Ccount	run.Gcount	run.Tcount	run.Ncount	run.experiment	run.pool_member	submission.accession	submission.srasource	submission.bioprojectsource	seqdetective.n_mates	seqdetective.mapping_rate.mate1	seqdetective.nofeature_rate.mate1	seqdetective.sparsity.mate1	seqdetective.pos_strand_rate.mate1	seqdetective.readlen.mate1	seqdetective.judgement.mate1	seqdetective.judgement.reason	platform_family	instrument_generation	read_bias	selection_class	prep_kit	sc_or_bulk	tech_class	technology	submission.bioprojectsource.country	earliest_date	devstage_curation	devstage_curation_coarse	tissue_curation	tissue_curation_coarse
24927	24927	SRR25557778	SRX21286665	SRS18536778	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant XI	GSM7688794	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant XI	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688794	GSM7688794: Morphant XI; Danio rerio; RNA Seq	GSM7688794 r1	GSM7688794	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-XI_S7_L001_R1_001.fastq.gz	fastq	420092501.0	5668059.0	GSM7688794 r1	0:74.12	A:113006440;C:96725832;G:99320773;T:110915967;N:123489	74		113006440	96725832	99320773	110915967	123489	SRX21286665	SRS18536778	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94757	0.06229	0.72364	0.46676	74	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24928	24928	SRR25557779	SRX21286665	SRS18536778	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant XI	GSM7688794	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant XI	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688794	GSM7688794: Morphant XI; Danio rerio; RNA Seq	GSM7688794 r1	GSM7688794	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-XI_S7_L002_R1_001.fastq.gz	fastq	421869780.0	5690053.0	GSM7688794 r2	0:74.14	A:113530489;C:97144227;G:99697959;T:111388539;N:108566	74		113530489	97144227	99697959	111388539	108566	SRX21286665	SRS18536778	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94921	0.06226	0.72462	0.4738	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24929	24929	SRR25557780	SRX21286665	SRS18536778	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant XI	GSM7688794	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant XI	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688794	GSM7688794: Morphant XI; Danio rerio; RNA Seq	GSM7688794 r1	GSM7688794	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-XI_S7_L003_R1_001.fastq.gz	fastq	425064659.0	5734041.0	GSM7688794 r3	0:74.13	A:114342253;C:97873100;G:100532599;T:112196433;N:120274	74		114342253	97873100	100532599	112196433	120274	SRX21286665	SRS18536778	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94886	0.06112	0.72425	0.47055	74	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24930	24930	SRR25557781	SRX21286665	SRS18536778	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant XI	GSM7688794	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant XI	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688794	GSM7688794: Morphant XI; Danio rerio; RNA Seq	GSM7688794 r1	GSM7688794	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-XI_S7_L004_R1_001.fastq.gz	fastq	416990548.0	5624902.0	GSM7688794 r4	0:74.13	A:112153356;C:96009158;G:98613145;T:110097476;N:117413	74		112153356	96009158	98613145	110097476	117413	SRX21286665	SRS18536778	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94869	0.06229	0.72506	0.47222	74	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24931	24931	SRR25557782	SRX21286664	SRS18536777	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant X	GSM7688793	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant X	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688793	GSM7688793: Morphant X; Danio rerio; RNA Seq	GSM7688793 r1	GSM7688793	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-X_S6_L001_R1_001.fastq.gz	fastq	434485284.0	5881416.0	GSM7688793 r1	0:73.87	A:116640351;C:100176557;G:102659919;T:114799536;N:208921	73		116640351	100176557	102659919	114799536	208921	SRX21286664	SRS18536777	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94533	0.07176	0.72464	0.47632	74	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24932	24932	SRR25557783	SRX21286664	SRS18536777	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant X	GSM7688793	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant X	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688793	GSM7688793: Morphant X; Danio rerio; RNA Seq	GSM7688793 r1	GSM7688793	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-X_S6_L002_R1_001.fastq.gz	fastq	435203869.0	5886556.0	GSM7688793 r2	0:73.93	A:116869356;C:100363580;G:102830644;T:114973504;N:166785	73		116869356	100363580	102830644	114973504	166785	SRX21286664	SRS18536777	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94542	0.07203	0.72421	0.47733	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24933	24933	SRR25557784	SRX21286664	SRS18536777	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant X	GSM7688793	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant X	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688793	GSM7688793: Morphant X; Danio rerio; RNA Seq	GSM7688793 r1	GSM7688793	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-X_S6_L003_R1_001.fastq.gz	fastq	439897269.0	5951878.0	GSM7688793 r3	0:73.91	A:118101648;C:101426657;G:103990006;T:116184480;N:194478	73		118101648	101426657	103990006	116184480	194478	SRX21286664	SRS18536777	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94486	0.07224	0.72448	0.47915	74	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24934	24934	SRR25557785	SRX21286664	SRS18536777	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant X	GSM7688793	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant X	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688793	GSM7688793: Morphant X; Danio rerio; RNA Seq	GSM7688793 r1	GSM7688793	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-X_S6_L004_R1_001.fastq.gz	fastq	431385256.0	5836029.0	GSM7688793 r4	0:73.92	A:115804970;C:99459059;G:101962932;T:113975935;N:182360	73		115804970	99459059	101962932	113975935	182360	SRX21286664	SRS18536777	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94432	0.07229	0.7261	0.47463	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24935	24935	SRR25557786	SRX21286663	SRS18536776	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant IX	GSM7688792	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant IX	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688792	GSM7688792: Morphant IX; Danio rerio; RNA Seq	GSM7688792 r1	GSM7688792	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-IX_S16_L001_R1_001.fastq.gz	fastq	513309395.0	6929648.0	GSM7688792 r1	0:74.07	A:137428462;C:118688804;G:122019962;T:134991729;N:180438	74		137428462	118688804	122019962	134991729	180438	SRX21286663	SRS18536776	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94188	0.07029	0.73772	0.47692	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24936	24936	SRR25557787	SRX21286663	SRS18536776	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant IX	GSM7688792	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant IX	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688792	GSM7688792: Morphant IX; Danio rerio; RNA Seq	GSM7688792 r1	GSM7688792	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-IX_S16_L002_R1_001.fastq.gz	fastq	517356735.0	6982196.0	GSM7688792 r2	0:74.10	A:138524037;C:119650852;G:122965491;T:136056171;N:160184	74		138524037	119650852	122965491	136056171	160184	SRX21286663	SRS18536776	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94281	0.06967	0.73963	0.48142	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24937	24937	SRR25557788	SRX21286663	SRS18536776	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant IX	GSM7688792	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant IX	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688792	GSM7688792: Morphant IX; Danio rerio; RNA Seq	GSM7688792 r1	GSM7688792	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-IX_S16_L003_R1_001.fastq.gz	fastq	519422328.0	7010631.0	GSM7688792 r3	0:74.09	A:139040684;C:120128748;G:123529198;T:136551898;N:171800	74		139040684	120128748	123529198	136551898	171800	SRX21286663	SRS18536776	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94297	0.06942	0.73726	0.47499	74	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24938	24938	SRR25557789	SRX21286663	SRS18536776	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant IX	GSM7688792	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant IX	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688792	GSM7688792: Morphant IX; Danio rerio; RNA Seq	GSM7688792 r1	GSM7688792	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-IX_S16_L004_R1_001.fastq.gz	fastq	511640294.0	6905748.0	GSM7688792 r4	0:74.09	A:136914638;C:118302866;G:121704665;T:134543505;N:174620	74		136914638	118302866	121704665	134543505	174620	SRX21286663	SRS18536776	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94176	0.07029	0.73868	0.47987	74	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24939	24939	SRR25557790	SRX21286662	SRS18536775	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant VIII	GSM7688791	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant VIII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688791	GSM7688791: Morphant VIII; Danio rerio; RNA Seq	GSM7688791 r1	GSM7688791	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-VIII_S14_L001_R1_001.fastq.gz	fastq	429446821.0	5803178.0	GSM7688791 r1	0:74.00	A:114793535;C:99506379;G:102226914;T:112748761;N:171232	74		114793535	99506379	102226914	112748761	171232	SRX21286662	SRS18536775	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94175	0.06669	0.73673	0.48179	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24940	24940	SRR25557791	SRX21286662	SRS18536775	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant VIII	GSM7688791	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant VIII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688791	GSM7688791: Morphant VIII; Danio rerio; RNA Seq	GSM7688791 r1	GSM7688791	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-VIII_S14_L002_R1_001.fastq.gz	fastq	434629893.0	5870828.0	GSM7688791 r2	0:74.03	A:116216940;C:100703527;G:103463365;T:114092681;N:153380	74		116216940	100703527	103463365	114092681	153380	SRX21286662	SRS18536775	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94143	0.0676	0.73791	0.48091	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24941	24941	SRR25557792	SRX21286662	SRS18536775	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant VIII	GSM7688791	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant VIII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688791	GSM7688791: Morphant VIII; Danio rerio; RNA Seq	GSM7688791 r1	GSM7688791	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-VIII_S14_L003_R1_001.fastq.gz	fastq	435879881.0	5888685.0	GSM7688791 r3	0:74.02	A:116548094;C:100971153;G:103794902;T:114400770;N:164962	74		116548094	100971153	103794902	114400770	164962	SRX21286662	SRS18536775	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94195	0.06686	0.73785	0.48044	73	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24942	24942	SRR25557793	SRX21286662	SRS18536775	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant VIII	GSM7688791	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant VIII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688791	GSM7688791: Morphant VIII; Danio rerio; RNA Seq	GSM7688791 r1	GSM7688791	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-VIII_S14_L004_R1_001.fastq.gz	fastq	429478475.0	5801978.0	GSM7688791 r4	0:74.02	A:114799280;C:99474677;G:102302775;T:112737475;N:164268	74		114799280	99474677	102302775	112737475	164268	SRX21286662	SRS18536775	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94118	0.06706	0.73892	0.47732	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24943	24943	SRR25557794	SRX21286661	SRS18536774	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant VII	GSM7688790	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant VII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688790	GSM7688790: Morphant VII; Danio rerio; RNA Seq	GSM7688790 r1	GSM7688790	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-VII_S15_L001_R1_001.fastq.gz	fastq	459545188.0	6215897.0	GSM7688790 r1	0:73.93	A:121926568;C:107379723;G:110263606;T:119766429;N:208862	73		121926568	107379723	110263606	119766429	208862	SRX21286661	SRS18536774	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94273	0.06072	0.74582	0.47499	73	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24944	24944	SRR25557795	SRX21286661	SRS18536774	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant VII	GSM7688790	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant VII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688790	GSM7688790: Morphant VII; Danio rerio; RNA Seq	GSM7688790 r1	GSM7688790	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-VII_S15_L002_R1_001.fastq.gz	fastq	463143624.0	6261406.0	GSM7688790 r2	0:73.97	A:122917997;C:108229793;G:111099867;T:120713978;N:181989	73		122917997	108229793	111099867	120713978	181989	SRX21286661	SRS18536774	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94387	0.06093	0.74341	0.47351	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24945	24945	SRR25557796	SRX21286661	SRS18536774	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant VII	GSM7688790	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant VII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688790	GSM7688790: Morphant VII; Danio rerio; RNA Seq	GSM7688790 r1	GSM7688790	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-VII_S15_L003_R1_001.fastq.gz	fastq	465959664.0	6300929.0	GSM7688790 r3	0:73.95	A:123689364;C:108847593;G:111847868;T:121377463;N:197376	73		123689364	108847593	111847868	121377463	197376	SRX21286661	SRS18536774	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94322	0.06219	0.74357	0.47977	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24946	24946	SRR25557797	SRX21286661	SRS18536774	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant VII	GSM7688790	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant VII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688790	GSM7688790: Morphant VII; Danio rerio; RNA Seq	GSM7688790 r1	GSM7688790	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-VII_S15_L004_R1_001.fastq.gz	fastq	459075430.0	6207363.0	GSM7688790 r4	0:73.96	A:121797426;C:107221116;G:110209684;T:119657308;N:189896	73		121797426	107221116	110209684	119657308	189896	SRX21286661	SRS18536774	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94313	0.06211	0.74343	0.47801	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24947	24947	SRR25557798	SRX21286660	SRS18536773	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control XI	GSM7688787	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control XI	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688787	GSM7688787: Control XI; Danio rerio; RNA Seq	GSM7688787 r1	GSM7688787	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-XI_S2_L001_R1_001.fastq.gz	fastq	439719566.0	5947052.0	GSM7688787 r1	0:73.94	A:117482073;C:102083665;G:104685444;T:115272860;N:195524	73		117482073	102083665	104685444	115272860	195524	SRX21286660	SRS18536773	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94829	0.06278	0.72525	0.46494	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24948	24948	SRR25557799	SRX21286660	SRS18536773	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control XI	GSM7688787	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control XI	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688787	GSM7688787: Control XI; Danio rerio; RNA Seq	GSM7688787 r1	GSM7688787	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-XI_S2_L002_R1_001.fastq.gz	fastq	438533503.0	5927990.0	GSM7688787 r2	0:73.98	A:117199594;C:101810881;G:104402169;T:114946611;N:174248	73		117199594	101810881	104402169	114946611	174248	SRX21286660	SRS18536773	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94887	0.06387	0.72827	0.46616	74	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24949	24949	SRR25557800	SRX21286660	SRS18536773	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control XI	GSM7688787	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control XI	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688787	GSM7688787: Control XI; Danio rerio; RNA Seq	GSM7688787 r1	GSM7688787	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-XI_S2_L003_R1_001.fastq.gz	fastq	443995554.0	6003540.0	GSM7688787 r3	0:73.96	A:118663936;C:103031716;G:105723574;T:116387834;N:188494	73		118663936	103031716	105723574	116387834	188494	SRX21286660	SRS18536773	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94788	0.06232	0.72693	0.46653	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24950	24950	SRR25557801	SRX21286660	SRS18536773	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control XI	GSM7688787	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control XI	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688787	GSM7688787: Control XI; Danio rerio; RNA Seq	GSM7688787 r1	GSM7688787	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-XI_S2_L004_R1_001.fastq.gz	fastq	435088869.0	5882642.0	GSM7688787 r4	0:73.96	A:116261447;C:100986653;G:103615584;T:114042354;N:182831	73		116261447	100986653	103615584	114042354	182831	SRX21286660	SRS18536773	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94914	0.06241	0.72829	0.4546	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24951	24951	SRR25557802	SRX21286659	SRS18536772	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control X	GSM7688785	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control X	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688785	GSM7688785: Control X; Danio rerio; RNA Seq	GSM7688785 r1	GSM7688785	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-X_S1_L001_R1_001.fastq.gz	fastq	395130702.0	5338263.0	GSM7688785 r1	0:74.02	A:107005793;C:90183031;G:92316770;T:105476481;N:148627	74		107005793	90183031	92316770	105476481	148627	SRX21286659	SRS18536772	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94534	0.07625	0.73888	0.48135	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24952	24952	SRR25557803	SRX21286659	SRS18536772	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control X	GSM7688785	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control X	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688785	GSM7688785: Control X; Danio rerio; RNA Seq	GSM7688785 r1	GSM7688785	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-X_S1_L002_R1_001.fastq.gz	fastq	396764458.0	5358448.0	GSM7688785 r2	0:74.04	A:107513717;C:90540282;G:92658504;T:105917444;N:134511	74		107513717	90540282	92658504	105917444	134511	SRX21286659	SRS18536772	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94374	0.07709	0.73878	0.47615	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24953	24953	SRR25557804	SRX21286659	SRS18536772	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control X	GSM7688785	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control X	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688785	GSM7688785: Control X; Danio rerio; RNA Seq	GSM7688785 r1	GSM7688785	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-X_S1_L003_R1_001.fastq.gz	fastq	399623551.0	5397520.0	GSM7688785 r3	0:74.04	A:108230540;C:91192011;G:93388052;T:106665106;N:147842	74		108230540	91192011	93388052	106665106	147842	SRX21286659	SRS18536772	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94399	0.07657	0.73797	0.4794	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24954	24954	SRR25557805	SRX21286659	SRS18536772	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control X	GSM7688785	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control X	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688785	GSM7688785: Control X; Danio rerio; RNA Seq	GSM7688785 r1	GSM7688785	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-X_S1_L004_R1_001.fastq.gz	fastq	393298978.0	5312101.0	GSM7688785 r4	0:74.04	A:106518845;C:89734564;G:91901232;T:105004490;N:139847	74		106518845	89734564	91901232	105004490	139847	SRX21286659	SRS18536772	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94423	0.07599	0.73884	0.47905	71	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24955	24955	SRR25557806	SRX21286658	SRS18536771	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control IX	GSM7688783	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control IX	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688783	GSM7688783: Control IX; Danio rerio; RNA Seq	GSM7688783 r1	GSM7688783	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-IX_S22_L001_R1_001.fastq.gz	fastq	366045799.0	4944832.0	GSM7688783 r1	0:74.03	A:98000119;C:84654222;G:86951226;T:96295351;N:144881	74		98000119	84654222	86951226	96295351	144881	SRX21286658	SRS18536771	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94303	0.07499	0.73085	0.47881	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24956	24956	SRR25557807	SRX21286658	SRS18536771	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control IX	GSM7688783	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control IX	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688783	GSM7688783: Control IX; Danio rerio; RNA Seq	GSM7688783 r1	GSM7688783	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-IX_S22_L002_R1_001.fastq.gz	fastq	369429068.0	4988719.0	GSM7688783 r2	0:74.05	A:98907882;C:85446993;G:87729593;T:97216477;N:128123	74		98907882	85446993	87729593	97216477	128123	SRX21286658	SRS18536771	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94261	0.07335	0.72969	0.47867	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24957	24957	SRR25557808	SRX21286658	SRS18536771	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control IX	GSM7688783	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control IX	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688783	GSM7688783: Control IX; Danio rerio; RNA Seq	GSM7688783 r1	GSM7688783	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-IX_S22_L003_R1_001.fastq.gz	fastq	369967330.0	4996710.0	GSM7688783 r3	0:74.04	A:99035743;C:85549878;G:87926587;T:97310812;N:144310	74		99035743	85549878	87926587	97310812	144310	SRX21286658	SRS18536771	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94328	0.0743	0.73034	0.47133	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24958	24958	SRR25557809	SRX21286658	SRS18536771	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control IX	GSM7688783	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control IX	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688783	GSM7688783: Control IX; Danio rerio; RNA Seq	GSM7688783 r1	GSM7688783	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-IX_S22_L004_R1_001.fastq.gz	fastq	365499176.0	4936305.0	GSM7688783 r4	0:74.04	A:97825658;C:84517732;G:86863655;T:96157429;N:134702	74		97825658	84517732	86863655	96157429	134702	SRX21286658	SRS18536771	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94286	0.07288	0.72999	0.4783	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24959	24959	SRR25557810	SRX21286657	SRS18536770	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control VIII	GSM7688782	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control VIII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688782	GSM7688782: Control VIII; Danio rerio; RNA Seq	GSM7688782 r1	GSM7688782	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-VIII_S20_L001_R1_001.fastq.gz	fastq	488585907.0	6585668.0	GSM7688782 r1	0:74.19	A:131727468;C:112349971;G:115189425;T:129203159;N:115884	74		131727468	112349971	115189425	129203159	115884	SRX21286657	SRS18536770	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.93794	0.07381	0.7315	0.47355	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24960	24960	SRR25557811	SRX21286657	SRS18536770	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control VIII	GSM7688782	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control VIII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688782	GSM7688782: Control VIII; Danio rerio; RNA Seq	GSM7688782 r1	GSM7688782	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-VIII_S20_L002_R1_001.fastq.gz	fastq	493766544.0	6653820.0	GSM7688782 r2	0:74.21	A:133135166;C:113551418;G:116398455;T:130575771;N:105734	74		133135166	113551418	116398455	130575771	105734	SRX21286657	SRS18536770	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.93729	0.07312	0.7307	0.47966	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24961	24961	SRR25557812	SRX21286657	SRS18536770	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control VIII	GSM7688782	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control VIII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688782	GSM7688782: Control VIII; Danio rerio; RNA Seq	GSM7688782 r1	GSM7688782	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-VIII_S20_L003_R1_001.fastq.gz	fastq	494935071.0	6670024.0	GSM7688782 r3	0:74.20	A:133406912;C:113769494;G:116771560;T:130871612;N:115493	74		133406912	113769494	116771560	130871612	115493	SRX21286657	SRS18536770	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.93847	0.07383	0.73194	0.47646	74	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24962	24962	SRR25557813	SRX21286657	SRS18536770	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control VIII	GSM7688782	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control VIII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688782	GSM7688782: Control VIII; Danio rerio; RNA Seq	GSM7688782 r1	GSM7688782	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-VIII_S20_L004_R1_001.fastq.gz	fastq	487644286.0	6572100.0	GSM7688782 r4	0:74.20	A:131423055;C:112092623;G:115067911;T:128945959;N:114738	74		131423055	112092623	115067911	128945959	114738	SRX21286657	SRS18536770	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.93708	0.0732	0.73186	0.4781	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24963	24963	SRR25557814	SRX21286656	SRS18536769	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control VII	GSM7688781	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control VII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688781	GSM7688781: Control VII; Danio rerio; RNA Seq	GSM7688781 r1	GSM7688781	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-VII_S21_L001_R1_001.fastq.gz	fastq	419048369.0	5664168.0	GSM7688781 r1	0:73.98	A:111569757;C:97553687;G:100228004;T:109523480;N:173441	73		111569757	97553687	100228004	109523480	173441	SRX21286656	SRS18536769	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94179	0.06596	0.74499	0.46809	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24964	24964	SRR25557815	SRX21286656	SRS18536769	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control VII	GSM7688781	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control VII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688781	GSM7688781: Control VII; Danio rerio; RNA Seq	GSM7688781 r1	GSM7688781	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-VII_S21_L002_R1_001.fastq.gz	fastq	422419362.0	5707444.0	GSM7688781 r2	0:74.01	A:112476977;C:98366185;G:101046586;T:110369882;N:159732	74		112476977	98366185	101046586	110369882	159732	SRX21286656	SRS18536769	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94275	0.06539	0.74523	0.47247	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24965	24965	SRR25557816	SRX21286656	SRS18536769	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control VII	GSM7688781	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control VII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688781	GSM7688781: Control VII; Danio rerio; RNA Seq	GSM7688781 r1	GSM7688781	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-VII_S21_L003_R1_001.fastq.gz	fastq	424260551.0	5733133.0	GSM7688781 r3	0:74.00	A:112957538;C:98789480;G:101496747;T:110850186;N:166600	74		112957538	98789480	101496747	110850186	166600	SRX21286656	SRS18536769	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94174	0.06482	0.74304	0.46935	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24966	24966	SRR25557817	SRX21286656	SRS18536769	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control VII	GSM7688781	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control VII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688781	GSM7688781: Control VII; Danio rerio; RNA Seq	GSM7688781 r1	GSM7688781	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-VII_S21_L004_R1_001.fastq.gz	fastq	417875320.0	5646817.0	GSM7688781 r4	0:74.00	A:111226895;C:97273168;G:100030641;T:109182520;N:162096	74		111226895	97273168	100030641	109182520	162096	SRX21286656	SRS18536769	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94352	0.06524	0.74442	0.47095	74	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
40356	40356	SRR3109810	SRX1538264	SRS1254843	SRP068656	PRJNA309293	RNA sequencing of adult zebrafish spinal cord	GSE77025	Transcriptome Analysis	The goal of this study is to determine gene expression changes in the adult zebrafish spinal cord at 2 weeks post complete transection. Overall design: 2 samples were analyzed in duplicates: sham injured spinal cord and transected spinal cord at 2 xxx post injury		pubmed:27811277	transected spinal cord b	GSM2042684	source name:spinal cord transected 2 xxx post injury\|age:6 month\|tissue:spinal cord\|tratment:2 weeks post transection injury	transected spinal cord b	Quality QC using Fastx Trimming of adapters and short sequences using Fastx Mapping using Bowtie2 Assembly using Cufflinks Quantification using Cuffdiff Genome build: zebrafish Zv9 genome Supplementary files format and content: gene exp.diff file includes gene expression data of injured spinal cord tissue relative to sham injured control tissue	spinal cord transected 2 xxx post injury	Animals underwent complete cervical spinal cord transection and spinal cord tissue was collected 2 xxx post injury. Control animals were sham injured and spinal cord was collected at 2 wks post sham.	RNA was extracted with Trizol reagent followed by clean up and DNase I treatment with QIAGEN RNeasy mini kit in accordance with the prescribed protocol provided with the kit. Quality control was performed with Agilent Bioanalyser. TruSeq libraries were constructed according to manufacturer's instructions	Adult 6 mpf wild type zebrafish were used for this study	age:6 month\|tissue:spinal cord\|tratment:2 weeks post transection injury	GSM2042684	GSM2042684: transected spinal cord b; Danio rerio; RNA Seq	GSM2042684		1	RNA was extracted with Trizol reagent followed by clean up and DNase I treatment with QIAGEN RNeasy mini kit in accordance with the prescribed protocol provided with the kit. Quality control was performed with Agilent Bioanalyser. TruSeq libraries were constructed according to manufacturer's instructions	GEO Accession:GSM2042684	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP068656		Sample_mm4b.bam	bam	1171337622.0	23961004.0	GSM2042684 r1	0:48.89	A:316224903;C:272433131;G:255385026;T:327251225;N:43337	48		316224903	272433131	255385026	327251225	43337	SRX1538264	SRS1254843	SRA336740	GEO	Ken Poss Lab, Cell Biology, Duke University Medical Center	1	0.95542	0.0725	0.68816	0.45919	50	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	trueseq	bulk	unknown	unknown	United States	2016-01-20	Adult	Adult	Spinal Cord	Nervous System
40357	40357	SRR3109809	SRX1538263	SRS1254842	SRP068656	PRJNA309293	RNA sequencing of adult zebrafish spinal cord	GSE77025	Transcriptome Analysis	The goal of this study is to determine gene expression changes in the adult zebrafish spinal cord at 2 weeks post complete transection. Overall design: 2 samples were analyzed in duplicates: sham injured spinal cord and transected spinal cord at 2 xxx post injury		pubmed:27811277	transected spinal cord a	GSM2042683	source name:spinal cord transected 2 xxx post injury\|age:6 month\|tissue:spinal cord\|tratment:2 weeks post transection injury	transected spinal cord a	Quality QC using Fastx Trimming of adapters and short sequences using Fastx Mapping using Bowtie2 Assembly using Cufflinks Quantification using Cuffdiff Genome build: zebrafish Zv9 genome Supplementary files format and content: gene exp.diff file includes gene expression data of injured spinal cord tissue relative to sham injured control tissue	spinal cord transected 2 xxx post injury	Animals underwent complete cervical spinal cord transection and spinal cord tissue was collected 2 xxx post injury. Control animals were sham injured and spinal cord was collected at 2 wks post sham.	RNA was extracted with Trizol reagent followed by clean up and DNase I treatment with QIAGEN RNeasy mini kit in accordance with the prescribed protocol provided with the kit. Quality control was performed with Agilent Bioanalyser. TruSeq libraries were constructed according to manufacturer's instructions	Adult 6 mpf wild type zebrafish were used for this study	age:6 month\|tissue:spinal cord\|tratment:2 weeks post transection injury	GSM2042683	GSM2042683: transected spinal cord a; Danio rerio; RNA Seq	GSM2042683		1	RNA was extracted with Trizol reagent followed by clean up and DNase I treatment with QIAGEN RNeasy mini kit in accordance with the prescribed protocol provided with the kit. Quality control was performed with Agilent Bioanalyser. TruSeq libraries were constructed according to manufacturer's instructions	GEO Accession:GSM2042683	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP068656		Sample_mm4a.bam	bam	906559320.0	18557265.0	GSM2042683 r1										SRX1538263	SRS1254842	SRA336740	GEO	Ken Poss Lab, Cell Biology, Duke University Medical Center	1	0.9696	0.06993	0.68913	0.4662	50	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	trueseq	bulk	unknown	unknown	United States	2016-01-20	Adult	Adult	Spinal Cord	Nervous System
40358	40358	SRR3109808	SRX1538262	SRS1254844	SRP068656	PRJNA309293	RNA sequencing of adult zebrafish spinal cord	GSE77025	Transcriptome Analysis	The goal of this study is to determine gene expression changes in the adult zebrafish spinal cord at 2 weeks post complete transection. Overall design: 2 samples were analyzed in duplicates: sham injured spinal cord and transected spinal cord at 2 xxx post injury		pubmed:27811277	sham spinal cord b	GSM2042682	source name:spinal cord sham control 2 wks post sham\|age:6 month\|tissue:spinal cord\|tratment:2 wks post sham injury	sham spinal cord b	Quality QC using Fastx Trimming of adapters and short sequences using Fastx Mapping using Bowtie2 Assembly using Cufflinks Quantification using Cuffdiff Genome build: zebrafish Zv9 genome Supplementary files format and content: gene exp.diff file includes gene expression data of injured spinal cord tissue relative to sham injured control tissue	spinal cord sham control 2 wks post sham	Animals underwent complete cervical spinal cord transection and spinal cord tissue was collected 2 xxx post injury. Control animals were sham injured and spinal cord was collected at 2 wks post sham.	RNA was extracted with Trizol reagent followed by clean up and DNase I treatment with QIAGEN RNeasy mini kit in accordance with the prescribed protocol provided with the kit. Quality control was performed with Agilent Bioanalyser. TruSeq libraries were constructed according to manufacturer's instructions	Adult 6 mpf wild type zebrafish were used for this study	age:6 month\|tissue:spinal cord\|tratment:2 wks post sham injury	GSM2042682	GSM2042682: sham spinal cord b; Danio rerio; RNA Seq	GSM2042682		1	RNA was extracted with Trizol reagent followed by clean up and DNase I treatment with QIAGEN RNeasy mini kit in accordance with the prescribed protocol provided with the kit. Quality control was performed with Agilent Bioanalyser. TruSeq libraries were constructed according to manufacturer's instructions	GEO Accession:GSM2042682	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP068656		Sample_mm2b.bam	bam	976598317.0	19979953.0	GSM2042682 r1	0:48.88	A:269123614;C:222873099;G:208746430;T:275819417;N:35757	48		269123614	222873099	208746430	275819417	35757	SRX1538262	SRS1254844	SRA336740	GEO	Ken Poss Lab, Cell Biology, Duke University Medical Center	1	0.95785	0.09352	0.71433	0.48637	50	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	trueseq	bulk	unknown	unknown	United States	2016-01-20	Adult	Adult	Spinal Cord	Nervous System
40359	40359	SRR3109807	SRX1538261	SRS1254845	SRP068656	PRJNA309293	RNA sequencing of adult zebrafish spinal cord	GSE77025	Transcriptome Analysis	The goal of this study is to determine gene expression changes in the adult zebrafish spinal cord at 2 weeks post complete transection. Overall design: 2 samples were analyzed in duplicates: sham injured spinal cord and transected spinal cord at 2 xxx post injury		pubmed:27811277	sham spinal cord a	GSM2042681	source name:spinal cord sham control 2 wks post sham\|age:6 month\|tissue:spinal cord\|tratment:2 wks post sham injury	sham spinal cord a	Quality QC using Fastx Trimming of adapters and short sequences using Fastx Mapping using Bowtie2 Assembly using Cufflinks Quantification using Cuffdiff Genome build: zebrafish Zv9 genome Supplementary files format and content: gene exp.diff file includes gene expression data of injured spinal cord tissue relative to sham injured control tissue	spinal cord sham control 2 wks post sham	Animals underwent complete cervical spinal cord transection and spinal cord tissue was collected 2 xxx post injury. Control animals were sham injured and spinal cord was collected at 2 wks post sham.	RNA was extracted with Trizol reagent followed by clean up and DNase I treatment with QIAGEN RNeasy mini kit in accordance with the prescribed protocol provided with the kit. Quality control was performed with Agilent Bioanalyser. TruSeq libraries were constructed according to manufacturer's instructions	Adult 6 mpf wild type zebrafish were used for this study	age:6 month\|tissue:spinal cord\|tratment:2 wks post sham injury	GSM2042681	GSM2042681: sham spinal cord a; Danio rerio; RNA Seq	GSM2042681		1	RNA was extracted with Trizol reagent followed by clean up and DNase I treatment with QIAGEN RNeasy mini kit in accordance with the prescribed protocol provided with the kit. Quality control was performed with Agilent Bioanalyser. TruSeq libraries were constructed according to manufacturer's instructions	GEO Accession:GSM2042681	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000	SRP068656		Sample_mm2a.bam	bam	1576837523.0	32234481.0	GSM2042681 r1	0:48.92	A:437851706;C:356136709;G:337965564;T:444822016;N:61528	48		437851706	356136709	337965564	444822016	61528	SRX1538261	SRS1254845	SRA336740	GEO	Ken Poss Lab, Cell Biology, Duke University Medical Center	1	0.95904	0.09551	0.71486	0.48699	50	B	usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	trueseq	bulk	unknown	unknown	United States	2016-01-20	Adult	Adult	Spinal Cord	Nervous System
42545	42545	SRR5805915	SRX2985081	SRS2337741	SRP111129	PRJNA393181	Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro	GSE100821	Transcriptome Analysis	Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population		pubmed:28959189	OL5	GSM2694027	tissue:adult spinal cord\|cell type:oligodendrocyte	OL5	basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates	adult spinal cord		Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…		cell type:oligodendrocyte	GSM2694027	GSM2694027: OL5; Danio rerio; RNA Seq	GSM2694027		1	Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…	GEO Accession:GSM2694027	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP111129		L13381_Track-36588_R1.fastq.gz	fastq	367232608.0	4832008.0	GSM2694027 r1	0:76	A:108020448;C:77176838;G:77161902;T:104867470;N:5950	76		108020448	77176838	77161902	104867470	5950	SRX2985081	SRS2337741	SRA584085	GEO	Reimer Lab, CRT Dresden, TU Dresden	1	0.90504	0.10694	0.81897	0.34015	76	B	usable mapping rate	illumina	hiseq_era	full_length	random_priming	nebnext	bulk	unknown	unknown	Germany	2017-07-05	Adult	Adult	Spinal Cord	Nervous System
42546	42546	SRR5805916	SRX2985081	SRS2337741	SRP111129	PRJNA393181	Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro	GSE100821	Transcriptome Analysis	Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population		pubmed:28959189	OL5	GSM2694027	tissue:adult spinal cord\|cell type:oligodendrocyte	OL5	basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates	adult spinal cord		Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…		cell type:oligodendrocyte	GSM2694027	GSM2694027: OL5; Danio rerio; RNA Seq	GSM2694027		1	Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…	GEO Accession:GSM2694027	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP111129		L13381_Track-36601_R1.fastq.gz	fastq	1112803020.0	14642145.0	GSM2694027 r2	0:76	A:327618064;C:233631080;G:233528495;T:318005605;N:19776	76		327618064	233631080	233528495	318005605	19776	SRX2985081	SRS2337741	SRA584085	GEO	Reimer Lab, CRT Dresden, TU Dresden	1	0.90398	0.10742	0.81895	0.3387	76	B	usable mapping rate	illumina	hiseq_era	full_length	random_priming	nebnext	bulk	unknown	unknown	Germany	2017-07-05	Adult	Adult	Spinal Cord	Nervous System
42547	42547	SRR5805917	SRX2985081	SRS2337741	SRP111129	PRJNA393181	Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro	GSE100821	Transcriptome Analysis	Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population		pubmed:28959189	OL5	GSM2694027	tissue:adult spinal cord\|cell type:oligodendrocyte	OL5	basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates	adult spinal cord		Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…		cell type:oligodendrocyte	GSM2694027	GSM2694027: OL5; Danio rerio; RNA Seq	GSM2694027		1	Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…	GEO Accession:GSM2694027	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP111129		L13381_Track-36721_R1.fastq.gz	fastq	1366015412.0	17973887.0	GSM2694027 r3	0:76	A:404748086;C:283771453;G:285083287;T:392327918;N:84668	76		404748086	283771453	285083287	392327918	84668	SRX2985081	SRS2337741	SRA584085	GEO	Reimer Lab, CRT Dresden, TU Dresden	1	0.90185	0.11132	0.82154	0.34006	76	B	usable mapping rate	illumina	hiseq_era	full_length	random_priming	nebnext	bulk	unknown	unknown	Germany	2017-07-05	Adult	Adult	Spinal Cord	Nervous System
42548	42548	SRR5805912	SRX2985080	SRS2337740	SRP111129	PRJNA393181	Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro	GSE100821	Transcriptome Analysis	Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population		pubmed:28959189	OL4	GSM2694026	tissue:adult spinal cord\|cell type:oligodendrocyte	OL4	basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates	adult spinal cord		Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…		cell type:oligodendrocyte	GSM2694026	GSM2694026: OL4; Danio rerio; RNA Seq	GSM2694026		1	Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…	GEO Accession:GSM2694026	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP111129		L13380_Track-36587_R1.fastq.gz	fastq	360675556.0	4745731.0	GSM2694026 r1	0:76	A:106025824;C:75705006;G:76148954;T:102789747;N:6025	76		106025824	75705006	76148954	102789747	6025	SRX2985080	SRS2337740	SRA584085	GEO	Reimer Lab, CRT Dresden, TU Dresden	1	0.86855	0.08794	0.82112	0.32375	76	B	usable mapping rate	illumina	hiseq_era	full_length	random_priming	nebnext	bulk	unknown	unknown	Germany	2017-07-05	Adult	Adult	Spinal Cord	Nervous System
42549	42549	SRR5805913	SRX2985080	SRS2337740	SRP111129	PRJNA393181	Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro	GSE100821	Transcriptome Analysis	Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population		pubmed:28959189	OL4	GSM2694026	tissue:adult spinal cord\|cell type:oligodendrocyte	OL4	basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates	adult spinal cord		Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…		cell type:oligodendrocyte	GSM2694026	GSM2694026: OL4; Danio rerio; RNA Seq	GSM2694026		1	Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…	GEO Accession:GSM2694026	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP111129		L13380_Track-36600_R1.fastq.gz	fastq	1098926332.0	14459557.0	GSM2694026 r2	0:76	A:323251709;C:230498299;G:231757231;T:313399836;N:19257	76		323251709	230498299	231757231	313399836	19257	SRX2985080	SRS2337740	SRA584085	GEO	Reimer Lab, CRT Dresden, TU Dresden	1	0.90618	0.09414	0.82215	0.32432	76	B	usable mapping rate	illumina	hiseq_era	full_length	random_priming	nebnext	bulk	unknown	unknown	Germany	2017-07-05	Adult	Adult	Spinal Cord	Nervous System
42550	42550	SRR5805914	SRX2985080	SRS2337740	SRP111129	PRJNA393181	Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro	GSE100821	Transcriptome Analysis	Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population		pubmed:28959189	OL4	GSM2694026	tissue:adult spinal cord\|cell type:oligodendrocyte	OL4	basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates	adult spinal cord		Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…		cell type:oligodendrocyte	GSM2694026	GSM2694026: OL4; Danio rerio; RNA Seq	GSM2694026		1	Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…	GEO Accession:GSM2694026	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP111129		L13380_Track-36720_R1.fastq.gz	fastq	1193782464.0	15707664.0	GSM2694026 r3	0:76	A:353125594;C:247908840;G:250316138;T:342359001;N:72891	76		353125594	247908840	250316138	342359001	72891	SRX2985080	SRS2337740	SRA584085	GEO	Reimer Lab, CRT Dresden, TU Dresden	1	0.90544	0.09556	0.82233	0.32116	76	B	usable mapping rate	illumina	hiseq_era	full_length	random_priming	nebnext	bulk	unknown	unknown	Germany	2017-07-05	Adult	Adult	Spinal Cord	Nervous System
42551	42551	SRR5805909	SRX2985079	SRS2337739	SRP111129	PRJNA393181	Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro	GSE100821	Transcriptome Analysis	Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population		pubmed:28959189	OL3	GSM2694025	tissue:adult spinal cord\|cell type:oligodendrocyte	OL3	basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates	adult spinal cord		Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…		cell type:oligodendrocyte	GSM2694025	GSM2694025: OL3; Danio rerio; RNA Seq	GSM2694025		1	Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…	GEO Accession:GSM2694025	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP111129		L13379_Track-36586_R1.fastq.gz	fastq	312102360.0	4106610.0	GSM2694025 r1	0:76	A:91621229;C:65883338;G:65770808;T:88821893;N:5092	76		91621229	65883338	65770808	88821893	5092	SRX2985079	SRS2337739	SRA584085	GEO	Reimer Lab, CRT Dresden, TU Dresden	1	0.86402	0.09444	0.82181	0.33279	76	B	usable mapping rate	illumina	hiseq_era	full_length	random_priming	nebnext	bulk	unknown	unknown	Germany	2017-07-05	Adult	Adult	Spinal Cord	Nervous System
42552	42552	SRR5805910	SRX2985079	SRS2337739	SRP111129	PRJNA393181	Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro	GSE100821	Transcriptome Analysis	Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population		pubmed:28959189	OL3	GSM2694025	tissue:adult spinal cord\|cell type:oligodendrocyte	OL3	basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates	adult spinal cord		Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…		cell type:oligodendrocyte	GSM2694025	GSM2694025: OL3; Danio rerio; RNA Seq	GSM2694025		1	Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…	GEO Accession:GSM2694025	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP111129		L13379_Track-36599_R1.fastq.gz	fastq	994629328.0	13087228.0	GSM2694025 r2	0:76	A:292173588;C:209769693;G:209444134;T:283224496;N:17417	76		292173588	209769693	209444134	283224496	17417	SRX2985079	SRS2337739	SRA584085	GEO	Reimer Lab, CRT Dresden, TU Dresden	1	0.90872	0.10051	0.82233	0.32123	76	B	usable mapping rate	illumina	hiseq_era	full_length	random_priming	nebnext	bulk	unknown	unknown	Germany	2017-07-05	Adult	Adult	Spinal Cord	Nervous System
42553	42553	SRR5805911	SRX2985079	SRS2337739	SRP111129	PRJNA393181	Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro	GSE100821	Transcriptome Analysis	Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population		pubmed:28959189	OL3	GSM2694025	tissue:adult spinal cord\|cell type:oligodendrocyte	OL3	basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates	adult spinal cord		Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…		cell type:oligodendrocyte	GSM2694025	GSM2694025: OL3; Danio rerio; RNA Seq	GSM2694025		1	Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…	GEO Accession:GSM2694025	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP111129		L13379_Track-36719_R1.fastq.gz	fastq	1183535688.0	15572838.0	GSM2694025 r3	0:76	A:349531521;C:247172348;G:248019907;T:338738175;N:73737	76		349531521	247172348	248019907	338738175	73737	SRX2985079	SRS2337739	SRA584085	GEO	Reimer Lab, CRT Dresden, TU Dresden	1	0.90617	0.10315	0.82329	0.33103	76	B	usable mapping rate	illumina	hiseq_era	full_length	random_priming	nebnext	bulk	unknown	unknown	Germany	2017-07-05	Adult	Adult	Spinal Cord	Nervous System
42554	42554	SRR5805906	SRX2985078	SRS2337738	SRP111129	PRJNA393181	Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro	GSE100821	Transcriptome Analysis	Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population		pubmed:28959189	OL2	GSM2694024	tissue:adult spinal cord\|cell type:oligodendrocyte	OL2	basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates	adult spinal cord		Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…		cell type:oligodendrocyte	GSM2694024	GSM2694024: OL2; Danio rerio; RNA Seq	GSM2694024		1	Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…	GEO Accession:GSM2694024	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP111129		L13378_Track-36585_R1.fastq.gz	fastq	405537748.0	5336023.0	GSM2694024 r1	0:76	A:118435711;C:85437254;G:85942337;T:115715820;N:6626	76		118435711	85437254	85942337	115715820	6626	SRX2985078	SRS2337738	SRA584085	GEO	Reimer Lab, CRT Dresden, TU Dresden	1	0.8695	0.09795	0.82189	0.33413	76	B	usable mapping rate	illumina	hiseq_era	full_length	random_priming	nebnext	bulk	unknown	unknown	Germany	2017-07-05	Adult	Adult	Spinal Cord	Nervous System
42555	42555	SRR5805907	SRX2985078	SRS2337738	SRP111129	PRJNA393181	Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro	GSE100821	Transcriptome Analysis	Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population		pubmed:28959189	OL2	GSM2694024	tissue:adult spinal cord\|cell type:oligodendrocyte	OL2	basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates	adult spinal cord		Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…		cell type:oligodendrocyte	GSM2694024	GSM2694024: OL2; Danio rerio; RNA Seq	GSM2694024		1	Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…	GEO Accession:GSM2694024	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP111129		L13378_Track-36598_R1.fastq.gz	fastq	1228952756.0	16170431.0	GSM2694024 r2	0:76	A:359305067;C:258652975;G:260090708;T:350882129;N:21877	76		359305067	258652975	260090708	350882129	21877	SRX2985078	SRS2337738	SRA584085	GEO	Reimer Lab, CRT Dresden, TU Dresden	1	0.90938	0.10251	0.82031	0.32861	76	B	usable mapping rate	illumina	hiseq_era	full_length	random_priming	nebnext	bulk	unknown	unknown	Germany	2017-07-05	Adult	Adult	Spinal Cord	Nervous System
42556	42556	SRR5805908	SRX2985078	SRS2337738	SRP111129	PRJNA393181	Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro	GSE100821	Transcriptome Analysis	Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population		pubmed:28959189	OL2	GSM2694024	tissue:adult spinal cord\|cell type:oligodendrocyte	OL2	basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates	adult spinal cord		Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…		cell type:oligodendrocyte	GSM2694024	GSM2694024: OL2; Danio rerio; RNA Seq	GSM2694024		1	Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…	GEO Accession:GSM2694024	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP111129		L13378_Track-36718_R1.fastq.gz	fastq	1468733440.0	19325440.0	GSM2694024 r3	0:76	A:431919690;C:306294778;G:309065028;T:421362107;N:91837	76		431919690	306294778	309065028	421362107	91837	SRX2985078	SRS2337738	SRA584085	GEO	Reimer Lab, CRT Dresden, TU Dresden	1	0.90756	0.10615	0.81949	0.33644	76	B	usable mapping rate	illumina	hiseq_era	full_length	random_priming	nebnext	bulk	unknown	unknown	Germany	2017-07-05	Adult	Adult	Spinal Cord	Nervous System
42557	42557	SRR5805903	SRX2985077	SRS2337737	SRP111129	PRJNA393181	Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro	GSE100821	Transcriptome Analysis	Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population		pubmed:28959189	OL1	GSM2694023	tissue:adult spinal cord\|cell type:oligodendrocyte	OL1	basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates	adult spinal cord		Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…		cell type:oligodendrocyte	GSM2694023	GSM2694023: OL1; Danio rerio; RNA Seq	GSM2694023		1	Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…	GEO Accession:GSM2694023	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP111129		L13377_Track-36584_R1.fastq.gz	fastq	466135360.0	6133360.0	GSM2694023 r1	0:76	A:135755208;C:99052881;G:99001624;T:132317853;N:7794	76		135755208	99052881	99001624	132317853	7794	SRX2985077	SRS2337737	SRA584085	GEO	Reimer Lab, CRT Dresden, TU Dresden	1	0.87348	0.07763	0.81844	0.31419	76	B	usable mapping rate	illumina	hiseq_era	full_length	random_priming	nebnext	bulk	unknown	unknown	Germany	2017-07-05	Adult	Adult	Spinal Cord	Nervous System
42558	42558	SRR5805904	SRX2985077	SRS2337737	SRP111129	PRJNA393181	Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro	GSE100821	Transcriptome Analysis	Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population		pubmed:28959189	OL1	GSM2694023	tissue:adult spinal cord\|cell type:oligodendrocyte	OL1	basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates	adult spinal cord		Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…		cell type:oligodendrocyte	GSM2694023	GSM2694023: OL1; Danio rerio; RNA Seq	GSM2694023		1	Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…	GEO Accession:GSM2694023	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP111129		L13377_Track-36597_R1.fastq.gz	fastq	1411330868.0	18570143.0	GSM2694023 r2	0:76	A:411208825;C:299646339;G:299445590;T:401005116;N:24998	76		411208825	299646339	299445590	401005116	24998	SRX2985077	SRS2337737	SRA584085	GEO	Reimer Lab, CRT Dresden, TU Dresden	1	0.91442	0.08129	0.81868	0.31098	76	B	usable mapping rate	illumina	hiseq_era	full_length	random_priming	nebnext	bulk	unknown	unknown	Germany	2017-07-05	Adult	Adult	Spinal Cord	Nervous System
42559	42559	SRR5805905	SRX2985077	SRS2337737	SRP111129	PRJNA393181	Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro	GSE100821	Transcriptome Analysis	Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population		pubmed:28959189	OL1	GSM2694023	tissue:adult spinal cord\|cell type:oligodendrocyte	OL1	basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates	adult spinal cord		Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…		cell type:oligodendrocyte	GSM2694023	GSM2694023: OL1; Danio rerio; RNA Seq	GSM2694023		1	Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…	GEO Accession:GSM2694023	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP111129		L13377_Track-36717_R1.fastq.gz	fastq	1694230988.0	22292513.0	GSM2694023 r3	0:76	A:496435234;C:356390144;G:357718951;T:483580476;N:106183	76		496435234	356390144	357718951	483580476	106183	SRX2985077	SRS2337737	SRA584085	GEO	Reimer Lab, CRT Dresden, TU Dresden	1	0.91116	0.0827	0.81854	0.31198	76	B	usable mapping rate	illumina	hiseq_era	full_length	random_priming	nebnext	bulk	unknown	unknown	Germany	2017-07-05	Adult	Adult	Spinal Cord	Nervous System
42560	42560	SRR5805900	SRX2985076	SRS2337736	SRP111129	PRJNA393181	Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro	GSE100821	Transcriptome Analysis	Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population		pubmed:28959189	OPC5	GSM2694022	tissue:adult spinal cord\|cell type:oligodendrocyte precursor cell	OPC5	basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates	adult spinal cord		Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…		cell type:oligodendrocyte precursor cell	GSM2694022	GSM2694022: OPC5; Danio rerio; RNA Seq	GSM2694022		1	Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…	GEO Accession:GSM2694022	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP111129		L13376_Track-36583_R1.fastq.gz	fastq	280153404.0	3686229.0	GSM2694022 r1	0:76	A:81451669;C:59566227;G:59669362;T:79461530;N:4616	76		81451669	59566227	59669362	79461530	4616	SRX2985076	SRS2337736	SRA584085	GEO	Reimer Lab, CRT Dresden, TU Dresden	1	0.87692	0.11958	0.78683	0.37449	76	B	usable mapping rate	illumina	hiseq_era	full_length	random_priming	nebnext	bulk	unknown	unknown	Germany	2017-07-05	Adult	Adult	Spinal Cord	Nervous System
42561	42561	SRR5805901	SRX2985076	SRS2337736	SRP111129	PRJNA393181	Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro	GSE100821	Transcriptome Analysis	Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population		pubmed:28959189	OPC5	GSM2694022	tissue:adult spinal cord\|cell type:oligodendrocyte precursor cell	OPC5	basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates	adult spinal cord		Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…		cell type:oligodendrocyte precursor cell	GSM2694022	GSM2694022: OPC5; Danio rerio; RNA Seq	GSM2694022		1	Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…	GEO Accession:GSM2694022	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP111129		L13376_Track-36596_R1.fastq.gz	fastq	905919164.0	11919989.0	GSM2694022 r2	0:76	A:263683260;C:192386277;G:192756447;T:257077269;N:15911	76		263683260	192386277	192756447	257077269	15911	SRX2985076	SRS2337736	SRA584085	GEO	Reimer Lab, CRT Dresden, TU Dresden	1	0.91322	0.12482	0.78695	0.38581	76	B	usable mapping rate	illumina	hiseq_era	full_length	random_priming	nebnext	bulk	unknown	unknown	Germany	2017-07-05	Adult	Adult	Spinal Cord	Nervous System
42562	42562	SRR5805902	SRX2985076	SRS2337736	SRP111129	PRJNA393181	Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro	GSE100821	Transcriptome Analysis	Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population		pubmed:28959189	OPC5	GSM2694022	tissue:adult spinal cord\|cell type:oligodendrocyte precursor cell	OPC5	basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates	adult spinal cord		Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…		cell type:oligodendrocyte precursor cell	GSM2694022	GSM2694022: OPC5; Danio rerio; RNA Seq	GSM2694022		1	Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…	GEO Accession:GSM2694022	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP111129		L13376_Track-36716_R1.fastq.gz	fastq	1102695932.0	14509157.0	GSM2694022 r3	0:76	A:322423795;C:232167818;G:233489197;T:314545918;N:69204	76		322423795	232167818	233489197	314545918	69204	SRX2985076	SRS2337736	SRA584085	GEO	Reimer Lab, CRT Dresden, TU Dresden	1	0.91113	0.12832	0.78902	0.38324	76	B	usable mapping rate	illumina	hiseq_era	full_length	random_priming	nebnext	bulk	unknown	unknown	Germany	2017-07-05	Adult	Adult	Spinal Cord	Nervous System
42563	42563	SRR5805897	SRX2985075	SRS2337735	SRP111129	PRJNA393181	Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro	GSE100821	Transcriptome Analysis	Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population		pubmed:28959189	OPC4	GSM2694021	tissue:adult spinal cord\|cell type:oligodendrocyte precursor cell	OPC4	basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates	adult spinal cord		Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…		cell type:oligodendrocyte precursor cell	GSM2694021	GSM2694021: OPC4; Danio rerio; RNA Seq	GSM2694021		1	Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…	GEO Accession:GSM2694021	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP111129		L13375_Track-36582_R1.fastq.gz	fastq	281755636.0	3707311.0	GSM2694021 r1	0:76	A:82997556;C:58935470;G:59188963;T:80628803;N:4844	76		82997556	58935470	59188963	80628803	4844	SRX2985075	SRS2337735	SRA584085	GEO	Reimer Lab, CRT Dresden, TU Dresden	1	0.87083	0.12585	0.79042	0.35633	76	B	usable mapping rate	illumina	hiseq_era	full_length	random_priming	nebnext	bulk	unknown	unknown	Germany	2017-07-05	Adult	Adult	Spinal Cord	Nervous System
42564	42564	SRR5805898	SRX2985075	SRS2337735	SRP111129	PRJNA393181	Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro	GSE100821	Transcriptome Analysis	Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population		pubmed:28959189	OPC4	GSM2694021	tissue:adult spinal cord\|cell type:oligodendrocyte precursor cell	OPC4	basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates	adult spinal cord		Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…		cell type:oligodendrocyte precursor cell	GSM2694021	GSM2694021: OPC4; Danio rerio; RNA Seq	GSM2694021		1	Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…	GEO Accession:GSM2694021	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP111129		L13375_Track-36595_R1.fastq.gz	fastq	856872336.0	11274636.0	GSM2694021 r2	0:76	A:252638777;C:179079271;G:179782360;T:245356644;N:15284	76		252638777	179079271	179782360	245356644	15284	SRX2985075	SRS2337735	SRA584085	GEO	Reimer Lab, CRT Dresden, TU Dresden	1	0.91479	0.1324	0.78959	0.36277	76	B	usable mapping rate	illumina	hiseq_era	full_length	random_priming	nebnext	bulk	unknown	unknown	Germany	2017-07-05	Adult	Adult	Spinal Cord	Nervous System
42565	42565	SRR5805899	SRX2985075	SRS2337735	SRP111129	PRJNA393181	Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro	GSE100821	Transcriptome Analysis	Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population		pubmed:28959189	OPC4	GSM2694021	tissue:adult spinal cord\|cell type:oligodendrocyte precursor cell	OPC4	basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates	adult spinal cord		Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…		cell type:oligodendrocyte precursor cell	GSM2694021	GSM2694021: OPC4; Danio rerio; RNA Seq	GSM2694021		1	Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…	GEO Accession:GSM2694021	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP111129		L13375_Track-36715_R1.fastq.gz	fastq	1067787080.0	14049830.0	GSM2694021 r3	0:76	A:316592408;C:220986701;G:222738880;T:307403458;N:65633	76		316592408	220986701	222738880	307403458	65633	SRX2985075	SRS2337735	SRA584085	GEO	Reimer Lab, CRT Dresden, TU Dresden	1	0.91223	0.13673	0.78957	0.36042	76	B	usable mapping rate	illumina	hiseq_era	full_length	random_priming	nebnext	bulk	unknown	unknown	Germany	2017-07-05	Adult	Adult	Spinal Cord	Nervous System
42566	42566	SRR5805894	SRX2985074	SRS2337734	SRP111129	PRJNA393181	Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro	GSE100821	Transcriptome Analysis	Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population		pubmed:28959189	OPC3	GSM2694020	tissue:adult spinal cord\|cell type:oligodendrocyte precursor cell	OPC3	basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates	adult spinal cord		Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…		cell type:oligodendrocyte precursor cell	GSM2694020	GSM2694020: OPC3; Danio rerio; RNA Seq	GSM2694020		1	Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…	GEO Accession:GSM2694020	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP111129		L13374_Track-36581_R1.fastq.gz	fastq	258394604.0	3399929.0	GSM2694020 r1	0:76	A:75988348;C:54232048;G:54304534;T:73865549;N:4125	76		75988348	54232048	54304534	73865549	4125	SRX2985074	SRS2337734	SRA584085	GEO	Reimer Lab, CRT Dresden, TU Dresden	1	0.86675	0.10485	0.79166	0.35524	76	B	usable mapping rate	illumina	hiseq_era	full_length	random_priming	nebnext	bulk	unknown	unknown	Germany	2017-07-05	Adult	Adult	Spinal Cord	Nervous System
42567	42567	SRR5805895	SRX2985074	SRS2337734	SRP111129	PRJNA393181	Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro	GSE100821	Transcriptome Analysis	Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population		pubmed:28959189	OPC3	GSM2694020	tissue:adult spinal cord\|cell type:oligodendrocyte precursor cell	OPC3	basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates	adult spinal cord		Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…		cell type:oligodendrocyte precursor cell	GSM2694020	GSM2694020: OPC3; Danio rerio; RNA Seq	GSM2694020		1	Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…	GEO Accession:GSM2694020	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP111129		L13374_Track-36594_R1.fastq.gz	fastq	802809356.0	10563281.0	GSM2694020 r2	0:76	A:236297052;C:168384708;G:168556277;T:229557436;N:13883	76		236297052	168384708	168556277	229557436	13883	SRX2985074	SRS2337734	SRA584085	GEO	Reimer Lab, CRT Dresden, TU Dresden	1	0.90891	0.11028	0.79115	0.35162	76	B	usable mapping rate	illumina	hiseq_era	full_length	random_priming	nebnext	bulk	unknown	unknown	Germany	2017-07-05	Adult	Adult	Spinal Cord	Nervous System
42568	42568	SRR5805896	SRX2985074	SRS2337734	SRP111129	PRJNA393181	Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro	GSE100821	Transcriptome Analysis	Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population		pubmed:28959189	OPC3	GSM2694020	tissue:adult spinal cord\|cell type:oligodendrocyte precursor cell	OPC3	basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates	adult spinal cord		Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…		cell type:oligodendrocyte precursor cell	GSM2694020	GSM2694020: OPC3; Danio rerio; RNA Seq	GSM2694020		1	Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…	GEO Accession:GSM2694020	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP111129		L13374_Track-36714_R1.fastq.gz	fastq	996263860.0	13108735.0	GSM2694020 r3	0:76	A:294853084;C:206867581;G:208047523;T:286432957;N:62715	76		294853084	206867581	208047523	286432957	62715	SRX2985074	SRS2337734	SRA584085	GEO	Reimer Lab, CRT Dresden, TU Dresden	1	0.90671	0.1148	0.78993	0.36115	76	B	usable mapping rate	illumina	hiseq_era	full_length	random_priming	nebnext	bulk	unknown	unknown	Germany	2017-07-05	Adult	Adult	Spinal Cord	Nervous System
42569	42569	SRR5805891	SRX2985073	SRS2337733	SRP111129	PRJNA393181	Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro	GSE100821	Transcriptome Analysis	Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population		pubmed:28959189	OPC2	GSM2694019	tissue:adult spinal cord\|cell type:oligodendrocyte precursor cell	OPC2	basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates	adult spinal cord		Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…		cell type:oligodendrocyte precursor cell	GSM2694019	GSM2694019: OPC2; Danio rerio; RNA Seq	GSM2694019		1	Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…	GEO Accession:GSM2694019	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP111129		L13373_Track-36580_R1.fastq.gz	fastq	290268624.0	3819324.0	GSM2694019 r1	0:76	A:83225179;C:62931491;G:62628688;T:81478215;N:5051	76		83225179	62931491	62628688	81478215	5051	SRX2985073	SRS2337733	SRA584085	GEO	Reimer Lab, CRT Dresden, TU Dresden	1	0.84469	0.11786	0.78742	0.38555	76	B	usable mapping rate	illumina	hiseq_era	full_length	random_priming	nebnext	bulk	unknown	unknown	Germany	2017-07-05	Adult	Adult	Spinal Cord	Nervous System
42570	42570	SRR5805892	SRX2985073	SRS2337733	SRP111129	PRJNA393181	Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro	GSE100821	Transcriptome Analysis	Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population		pubmed:28959189	OPC2	GSM2694019	tissue:adult spinal cord\|cell type:oligodendrocyte precursor cell	OPC2	basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates	adult spinal cord		Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…		cell type:oligodendrocyte precursor cell	GSM2694019	GSM2694019: OPC2; Danio rerio; RNA Seq	GSM2694019		1	Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…	GEO Accession:GSM2694019	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP111129		L13373_Track-36593_R1.fastq.gz	fastq	872053640.0	11474390.0	GSM2694019 r2	0:76	A:250248044;C:188809860;G:187959005;T:245021560;N:15171	76		250248044	188809860	187959005	245021560	15171	SRX2985073	SRS2337733	SRA584085	GEO	Reimer Lab, CRT Dresden, TU Dresden	1	0.87823	0.12293	0.78699	0.38395	76	B	usable mapping rate	illumina	hiseq_era	full_length	random_priming	nebnext	bulk	unknown	unknown	Germany	2017-07-05	Adult	Adult	Spinal Cord	Nervous System
42571	42571	SRR5805893	SRX2985073	SRS2337733	SRP111129	PRJNA393181	Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro	GSE100821	Transcriptome Analysis	Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population		pubmed:28959189	OPC2	GSM2694019	tissue:adult spinal cord\|cell type:oligodendrocyte precursor cell	OPC2	basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates	adult spinal cord		Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…		cell type:oligodendrocyte precursor cell	GSM2694019	GSM2694019: OPC2; Danio rerio; RNA Seq	GSM2694019		1	Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…	GEO Accession:GSM2694019	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP111129		L13373_Track-36713_R1.fastq.gz	fastq	1035504180.0	13625055.0	GSM2694019 r3	0:76	A:298790829;C:222016282;G:222262419;T:292369013;N:65637	76		298790829	222016282	222262419	292369013	65637	SRX2985073	SRS2337733	SRA584085	GEO	Reimer Lab, CRT Dresden, TU Dresden	1	0.88262	0.12859	0.78707	0.36444	76	B	usable mapping rate	illumina	hiseq_era	full_length	random_priming	nebnext	bulk	unknown	unknown	Germany	2017-07-05	Adult	Adult	Spinal Cord	Nervous System
42572	42572	SRR5805888	SRX2985072	SRS2337732	SRP111129	PRJNA393181	Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro	GSE100821	Transcriptome Analysis	Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population		pubmed:28959189	OPC1	GSM2694018	tissue:adult spinal cord\|cell type:oligodendrocyte precursor cell	OPC1	basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates	adult spinal cord		Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…		cell type:oligodendrocyte precursor cell	GSM2694018	GSM2694018: OPC1; Danio rerio; RNA Seq	GSM2694018		1	Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…	GEO Accession:GSM2694018	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP111129		L13372_Track-36579_R1.fastq.gz	fastq	275307568.0	3622468.0	GSM2694018 r1	0:76	A:80768745;C:57628302;G:57760609;T:79145252;N:4660	76		80768745	57628302	57760609	79145252	4660	SRX2985072	SRS2337732	SRA584085	GEO	Reimer Lab, CRT Dresden, TU Dresden	1	0.87887	0.12197	0.79807	0.35871	76	B	usable mapping rate	illumina	hiseq_era	full_length	random_priming	nebnext	bulk	unknown	unknown	Germany	2017-07-05	Adult	Adult	Spinal Cord	Nervous System
42573	42573	SRR5805889	SRX2985072	SRS2337732	SRP111129	PRJNA393181	Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro	GSE100821	Transcriptome Analysis	Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population		pubmed:28959189	OPC1	GSM2694018	tissue:adult spinal cord\|cell type:oligodendrocyte precursor cell	OPC1	basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates	adult spinal cord		Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…		cell type:oligodendrocyte precursor cell	GSM2694018	GSM2694018: OPC1; Danio rerio; RNA Seq	GSM2694018		1	Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…	GEO Accession:GSM2694018	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP111129		L13372_Track-36592_R1.fastq.gz	fastq	844153204.0	11107279.0	GSM2694018 r2	0:76	A:247798416;C:176560506;G:176978398;T:242800972;N:14912	76		247798416	176560506	176978398	242800972	14912	SRX2985072	SRS2337732	SRA584085	GEO	Reimer Lab, CRT Dresden, TU Dresden	1	0.912	0.12665	0.79742	0.36358	76	B	usable mapping rate	illumina	hiseq_era	full_length	random_priming	nebnext	bulk	unknown	unknown	Germany	2017-07-05	Adult	Adult	Spinal Cord	Nervous System
42574	42574	SRR5805890	SRX2985072	SRS2337732	SRP111129	PRJNA393181	Primary spinal OPC culture system from adult zebrafish to study oligodendrocyte differentiation in vitro	GSE100821	Transcriptome Analysis	Endogenous oligodendrocyte progenitor cells OPCs are a promising target to improve functional recovery post spinal cord injury SCI by remyelinating denuded and therefore vulnerable axons. Demyelination is the result of a primary insult and secondary injury leading to conduction blocks and long term degeneration of the axons which subsequently can lead to the loss of their neuron. In response to SCI dormant OPCs can be activated and subsequently start to proliferate and differentiate into mature myelinating oligodendrocytes OLs. Therefore researchers strive to control OPC responses and utilize small molecule screening approaches in order to identify mechanisms of OPC activation proliferation migration and differentiation. Overall design: DEG analysis of primary OPC and OL populations 5 biological replicates per population		pubmed:28959189	OPC1	GSM2694018	tissue:adult spinal cord\|cell type:oligodendrocyte precursor cell	OPC1	basecalling: bcl2fastq 2.17.1.14 alignment: Libraries were mapped to GRCz10 with GSNAP v 2016 09 23; splice site were supported by using Ensembl version 81 fragment count: fragments were counted with featureCounts v1.5.2 based on Ensembl version 81 Genome build: GRCz10 Supplementary files format and content: tab delimited file from featureCounts bfx684.GRCz10.e81.txt.gz; columns are in the following order: Ensembl Gene ID Chromosom Exon Start Coordinates Exon End Coordinates Gene Length; Counts from the 2 Conditions and their 5 replicates	adult spinal cord		Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…		cell type:oligodendrocyte precursor cell	GSM2694018	GSM2694018: OPC1; Danio rerio; RNA Seq	GSM2694018		1	Spinal cord dissection tissue dissociation and nuclear labelling: Adult zebrafish were terminally anesthetized their spinal cords exposed and the spinal cord tissue was carefully removed. Up to 5 spinal cords were dissected at once and placed in 1ml of Hanks´ Buffered Salt Solution HBSS Gibco. For the dissociation of spinal cords into a single cell suspension at room temperature the tissue was incubated for 3 min with 100 µL 0.25% Trypsin Sigma; T4549 / 1mM EDTA and triturated using a 200 µL pipette during the whole incubation time avoiding the formation of air bubbles. Then tissue digestion was stopped by adding 100 µL of 20% fetal calf serum Sigma; F0804 in 2 mM CaCl2 and 300 µL HBSS. postwards the cell suspension was allowed to sit for 5’ at on ice before it was applied to a 20 µm OPCs Miltenyi Biotec # 130 101 812 or a 35 µm OL Corning # 352235 cell strainer respectively. post washing with 9 ml of HBSS the cells were pelleted by centrifugation for 5’ at RT at 300g. The supernatant was removed cells were resuspended in 1 ml HBSS including 1 µl Vybrant™ DyeCycle™ Violet Stain Molecular Probes Invitrogen V35003 and incubated for 30´ at 28 °C to stain cellular nuclei. FACsorting of myelin rich spinal cord tissue: Cell suspensions were sorted directly into 96 well plates filled with culture media only or pre seeded with MN using a BD FACSAria sorter. For the detection of GFP a 488 nm excitation laser and a 530/30 bandpass filter were used. DsRed was detected with a 582/15 bandpass filter post excitation with a 561 nm laser. Vybrant™ DyeCycle™ Violet Stain was detected post 405 nm excitation and a 450/40 bandpass filter. Cellular events were defined by forward and side scatter profile and by the dsRed or GFP signal of the corresponding transgenic line. From this selection all events that showed incorporation of the Vybrant™ DyeCycle™ Violet Stain were gated because this proved to be an ideal selection to separate the small zebrafish CNS cells from remaining cellular and myelin debris. For the R…	GEO Accession:GSM2694018	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2500	SRP111129		L13372_Track-36712_R1.fastq.gz	fastq	990996528.0	13039428.0	GSM2694018 r3	0:76	A:292539296;C:205334965;G:206678725;T:286381798;N:61744	76		292539296	205334965	206678725	286381798	61744	SRX2985072	SRS2337732	SRA584085	GEO	Reimer Lab, CRT Dresden, TU Dresden	1	0.90825	0.1314	0.80004	0.3635	76	B	usable mapping rate	illumina	hiseq_era	full_length	random_priming	nebnext	bulk	unknown	unknown	Germany	2017-07-05	Adult	Adult	Spinal Cord	Nervous System
61886	61886	SRR13074872	SRX9521915	SRS7729122	SRP292929	PRJNA678983	Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]	GSE161642	Transcriptome Analysis	Spinal cord injury SCI results in loss of neurons oligodendrocytes and myelin sheaths all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres which leaves axons denuded impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals zebrafish can functionally regenerate the spinal cord. Yet little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here we report that in adult zebrafish SCI results in axonal oligodendrocyte and myelin sheath loss. We find that OPCs the oligodendorocyte progenitor cells survive the injury enter a reactive state proliferate and differentiate into oligodendrocytes. Concomitantly the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly global reduction of axonal tracts and partial re myelination relative to pre injury levels persist at later stages of regeneration yet suffices for functional recovery. Taken together these findings imply that in the zebrafish spinal cord OPCs replace lost oligodendrocytes and thus re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.	parent bioproject:PRJNA679077	pubmed:33158923	SDPL.1X 01 D12	GSM4911711	source name:OPC\|age:adult\|genotype:Tgolig2:eGFP\|tissue:spinal cord\|cell type:olig2:eGFP+ OPCs\|treatment:7 dpl	SDPL.1X 01 D12	Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters: gunzip A sam t 14 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 N 0 n 1 s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters: a EnsemblGene 87.GRCz10.TR.gtf s 0 Q 1 T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID Chromosome Gene Start Gene End Gene Length then all sample counts; comments start with '#'	OPC	Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction as previously described Becker et al. 1997 . Sham lesioned fish were treated equally except that the spinal cord was left intact.	Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks’ Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r…		age:adult\|genotype:Tgolig2:eGFP\|tissue:spinal cord\|cell type:olig2:eGFP+ OPCs\|treatment:7 dpl	GSM4911711	GSM4911711: SDPL.1X 01 D12; Danio rerio; RNA Seq	GSM4911711		1	Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r…	GEO Accession:GSM4911711	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP292929		L31855_Track-65510_R1.fastq.gz	fastq	34606372.0	455347.0	GSM4911711 r1	0:76 1:0	A:9797047;C:7514433;G:7529128;T:9765391;N:373	76	0	9797047	7514433	7529128	9765391	373	SRX9521915	SRS7729122	SRA1160306	GEO	Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden	1	0.88569	0.07951	0.91212	0.42432	76	B	usable mapping rate	illumina	nextseq	full_length	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	Germany	2020-11-17	Adult	Adult	Spinal Cord	Nervous System
61887	61887	SRR13074871	SRX9521914	SRS7729121	SRP292929	PRJNA678983	Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]	GSE161642	Transcriptome Analysis	Spinal cord injury SCI results in loss of neurons oligodendrocytes and myelin sheaths all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres which leaves axons denuded impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals zebrafish can functionally regenerate the spinal cord. Yet little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here we report that in adult zebrafish SCI results in axonal oligodendrocyte and myelin sheath loss. We find that OPCs the oligodendorocyte progenitor cells survive the injury enter a reactive state proliferate and differentiate into oligodendrocytes. Concomitantly the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly global reduction of axonal tracts and partial re myelination relative to pre injury levels persist at later stages of regeneration yet suffices for functional recovery. Taken together these findings imply that in the zebrafish spinal cord OPCs replace lost oligodendrocytes and thus re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.	parent bioproject:PRJNA679077	pubmed:33158923	SDPL.1X 01 G10	GSM4911710	source name:OPC\|age:adult\|genotype:Tgolig2:eGFP\|tissue:spinal cord\|cell type:olig2:eGFP+ OPCs\|treatment:7 dpl	SDPL.1X 01 G10	Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters: gunzip A sam t 14 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 N 0 n 1 s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters: a EnsemblGene 87.GRCz10.TR.gtf s 0 Q 1 T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID Chromosome Gene Start Gene End Gene Length then all sample counts; comments start with '#'	OPC	Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction as previously described Becker et al. 1997 . Sham lesioned fish were treated equally except that the spinal cord was left intact.	Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks’ Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r…		age:adult\|genotype:Tgolig2:eGFP\|tissue:spinal cord\|cell type:olig2:eGFP+ OPCs\|treatment:7 dpl	GSM4911710	GSM4911710: SDPL.1X 01 G10; Danio rerio; RNA Seq	GSM4911710		1	Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r…	GEO Accession:GSM4911710	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP292929		L31846_Track-65507_R1.fastq.gz	fastq	40850608.0	537508.0	GSM4911710 r1	0:76 1:0	A:11503051;C:8892746;G:8924384;T:11530029;N:398	76	0	11503051	8892746	8924384	11530029	398	SRX9521914	SRS7729121	SRA1160306	GEO	Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden	1	0.87161	0.06824	0.94123	0.43306	76	B	usable mapping rate	illumina	nextseq	full_length	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	Germany	2020-11-17	Adult	Adult	Spinal Cord	Nervous System
61888	61888	SRR13074870	SRX9521913	SRS7729120	SRP292929	PRJNA678983	Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]	GSE161642	Transcriptome Analysis	Spinal cord injury SCI results in loss of neurons oligodendrocytes and myelin sheaths all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres which leaves axons denuded impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals zebrafish can functionally regenerate the spinal cord. Yet little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here we report that in adult zebrafish SCI results in axonal oligodendrocyte and myelin sheath loss. We find that OPCs the oligodendorocyte progenitor cells survive the injury enter a reactive state proliferate and differentiate into oligodendrocytes. Concomitantly the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly global reduction of axonal tracts and partial re myelination relative to pre injury levels persist at later stages of regeneration yet suffices for functional recovery. Taken together these findings imply that in the zebrafish spinal cord OPCs replace lost oligodendrocytes and thus re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.	parent bioproject:PRJNA679077	pubmed:33158923	SDPL.1X 01 E11	GSM4911709	source name:OPC\|age:adult\|genotype:Tgolig2:eGFP\|tissue:spinal cord\|cell type:olig2:eGFP+ OPCs\|treatment:7 dpl	SDPL.1X 01 E11	Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters: gunzip A sam t 14 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 N 0 n 1 s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters: a EnsemblGene 87.GRCz10.TR.gtf s 0 Q 1 T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID Chromosome Gene Start Gene End Gene Length then all sample counts; comments start with '#'	OPC	Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction as previously described Becker et al. 1997 . Sham lesioned fish were treated equally except that the spinal cord was left intact.	Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks’ Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r…		age:adult\|genotype:Tgolig2:eGFP\|tissue:spinal cord\|cell type:olig2:eGFP+ OPCs\|treatment:7 dpl	GSM4911709	GSM4911709: SDPL.1X 01 E11; Danio rerio; RNA Seq	GSM4911709		1	Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r…	GEO Accession:GSM4911709	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP292929		L31850_Track-65519_R1.fastq.gz	fastq	50048660.0	658535.0	GSM4911709 r1	0:76 1:0	A:13622067;C:11406781;G:11303440;T:13715844;N:528	76	0	13622067	11406781	11303440	13715844	528	SRX9521913	SRS7729120	SRA1160306	GEO	Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden	1	0.86014	0.09565	0.96252	0.45301	76	B	usable mapping rate	illumina	nextseq	full_length	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	Germany	2020-11-17	Adult	Adult	Spinal Cord	Nervous System
61889	61889	SRR13074869	SRX9521912	SRS7729119	SRP292929	PRJNA678983	Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]	GSE161642	Transcriptome Analysis	Spinal cord injury SCI results in loss of neurons oligodendrocytes and myelin sheaths all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres which leaves axons denuded impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals zebrafish can functionally regenerate the spinal cord. Yet little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here we report that in adult zebrafish SCI results in axonal oligodendrocyte and myelin sheath loss. We find that OPCs the oligodendorocyte progenitor cells survive the injury enter a reactive state proliferate and differentiate into oligodendrocytes. Concomitantly the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly global reduction of axonal tracts and partial re myelination relative to pre injury levels persist at later stages of regeneration yet suffices for functional recovery. Taken together these findings imply that in the zebrafish spinal cord OPCs replace lost oligodendrocytes and thus re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.	parent bioproject:PRJNA679077	pubmed:33158923	SDPL.1X 01 H10	GSM4911708	source name:OPC\|age:adult\|genotype:Tgolig2:eGFP\|tissue:spinal cord\|cell type:olig2:eGFP+ OPCs\|treatment:7 dpl	SDPL.1X 01 H10	Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters: gunzip A sam t 14 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 N 0 n 1 s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters: a EnsemblGene 87.GRCz10.TR.gtf s 0 Q 1 T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID Chromosome Gene Start Gene End Gene Length then all sample counts; comments start with '#'	OPC	Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction as previously described Becker et al. 1997 . Sham lesioned fish were treated equally except that the spinal cord was left intact.	Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks’ Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r…		age:adult\|genotype:Tgolig2:eGFP\|tissue:spinal cord\|cell type:olig2:eGFP+ OPCs\|treatment:7 dpl	GSM4911708	GSM4911708: SDPL.1X 01 H10; Danio rerio; RNA Seq	GSM4911708		1	Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r…	GEO Accession:GSM4911708	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP292929		L31847_Track-65513_R1.fastq.gz	fastq	54199552.0	713152.0	GSM4911708 r1	0:76 1:0	A:14613140;C:12664231;G:12481214;T:14440413;N:554	76	0	14613140	12664231	12481214	14440413	554	SRX9521912	SRS7729119	SRA1160306	GEO	Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden	1	0.83847	0.0463	0.95465	0.4661	76	B	usable mapping rate	illumina	nextseq	full_length	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	Germany	2020-11-17	Adult	Adult	Spinal Cord	Nervous System
61890	61890	SRR13074868	SRX9521911	SRS7729118	SRP292929	PRJNA678983	Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]	GSE161642	Transcriptome Analysis	Spinal cord injury SCI results in loss of neurons oligodendrocytes and myelin sheaths all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres which leaves axons denuded impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals zebrafish can functionally regenerate the spinal cord. Yet little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here we report that in adult zebrafish SCI results in axonal oligodendrocyte and myelin sheath loss. We find that OPCs the oligodendorocyte progenitor cells survive the injury enter a reactive state proliferate and differentiate into oligodendrocytes. Concomitantly the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly global reduction of axonal tracts and partial re myelination relative to pre injury levels persist at later stages of regeneration yet suffices for functional recovery. Taken together these findings imply that in the zebrafish spinal cord OPCs replace lost oligodendrocytes and thus re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.	parent bioproject:PRJNA679077	pubmed:33158923	SDPL.1X 01 C11	GSM4911707	source name:OPC\|age:adult\|genotype:Tgolig2:eGFP\|tissue:spinal cord\|cell type:olig2:eGFP+ OPCs\|treatment:7 dpl	SDPL.1X 01 C11	Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters: gunzip A sam t 14 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 N 0 n 1 s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters: a EnsemblGene 87.GRCz10.TR.gtf s 0 Q 1 T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID Chromosome Gene Start Gene End Gene Length then all sample counts; comments start with '#'	OPC	Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction as previously described Becker et al. 1997 . Sham lesioned fish were treated equally except that the spinal cord was left intact.	Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks’ Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r…		age:adult\|genotype:Tgolig2:eGFP\|tissue:spinal cord\|cell type:olig2:eGFP+ OPCs\|treatment:7 dpl	GSM4911707	GSM4911707: SDPL.1X 01 C11; Danio rerio; RNA Seq	GSM4911707		1	Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r…	GEO Accession:GSM4911707	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP292929		L31848_Track-65516_R1.fastq.gz	fastq	50085216.0	659016.0	GSM4911707 r1	0:76 1:0	A:13748335;C:11332042;G:11277617;T:13726702;N:520	76	0	13748335	11332042	11277617	13726702	520	SRX9521911	SRS7729118	SRA1160306	GEO	Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden	1	0.85163	0.06643	0.94866	0.41876	76	B	usable mapping rate	illumina	nextseq	full_length	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	Germany	2020-11-17	Adult	Adult	Spinal Cord	Nervous System
61891	61891	SRR13074867	SRX9521910	SRS7729116	SRP292929	PRJNA678983	Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]	GSE161642	Transcriptome Analysis	Spinal cord injury SCI results in loss of neurons oligodendrocytes and myelin sheaths all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres which leaves axons denuded impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals zebrafish can functionally regenerate the spinal cord. Yet little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here we report that in adult zebrafish SCI results in axonal oligodendrocyte and myelin sheath loss. We find that OPCs the oligodendorocyte progenitor cells survive the injury enter a reactive state proliferate and differentiate into oligodendrocytes. Concomitantly the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly global reduction of axonal tracts and partial re myelination relative to pre injury levels persist at later stages of regeneration yet suffices for functional recovery. Taken together these findings imply that in the zebrafish spinal cord OPCs replace lost oligodendrocytes and thus re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.	parent bioproject:PRJNA679077	pubmed:33158923	SDPL.1X 01 F10	GSM4911706	source name:OPC\|age:adult\|genotype:Tgolig2:eGFP\|tissue:spinal cord\|cell type:olig2:eGFP+ OPCs\|treatment:7 dpl	SDPL.1X 01 F10	Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters: gunzip A sam t 14 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 N 0 n 1 s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters: a EnsemblGene 87.GRCz10.TR.gtf s 0 Q 1 T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID Chromosome Gene Start Gene End Gene Length then all sample counts; comments start with '#'	OPC	Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction as previously described Becker et al. 1997 . Sham lesioned fish were treated equally except that the spinal cord was left intact.	Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks’ Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r…		age:adult\|genotype:Tgolig2:eGFP\|tissue:spinal cord\|cell type:olig2:eGFP+ OPCs\|treatment:7 dpl	GSM4911706	GSM4911706: SDPL.1X 01 F10; Danio rerio; RNA Seq	GSM4911706		1	Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r…	GEO Accession:GSM4911706	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP292929		L31845_Track-65521_R1.fastq.gz	fastq	62281620.0	819495.0	GSM4911706 r1	0:76 1:0	A:17609719;C:13581841;G:13554360;T:17535048;N:652	76	0	17609719	13581841	13554360	17535048	652	SRX9521910	SRS7729116	SRA1160306	GEO	Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden	1	0.888	0.07076	0.94373	0.40445	76	B	usable mapping rate	illumina	nextseq	full_length	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	Germany	2020-11-17	Adult	Adult	Spinal Cord	Nervous System
61892	61892	SRR13074866	SRX9521909	SRS7729117	SRP292929	PRJNA678983	Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]	GSE161642	Transcriptome Analysis	Spinal cord injury SCI results in loss of neurons oligodendrocytes and myelin sheaths all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres which leaves axons denuded impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals zebrafish can functionally regenerate the spinal cord. Yet little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here we report that in adult zebrafish SCI results in axonal oligodendrocyte and myelin sheath loss. We find that OPCs the oligodendorocyte progenitor cells survive the injury enter a reactive state proliferate and differentiate into oligodendrocytes. Concomitantly the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly global reduction of axonal tracts and partial re myelination relative to pre injury levels persist at later stages of regeneration yet suffices for functional recovery. Taken together these findings imply that in the zebrafish spinal cord OPCs replace lost oligodendrocytes and thus re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.	parent bioproject:PRJNA679077	pubmed:33158923	SDPL.1X 01 D10	GSM4911705	source name:OPC\|age:adult\|genotype:Tgolig2:eGFP\|tissue:spinal cord\|cell type:olig2:eGFP+ OPCs\|treatment:7 dpl	SDPL.1X 01 D10	Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters: gunzip A sam t 14 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 N 0 n 1 s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters: a EnsemblGene 87.GRCz10.TR.gtf s 0 Q 1 T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID Chromosome Gene Start Gene End Gene Length then all sample counts; comments start with '#'	OPC	Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction as previously described Becker et al. 1997 . Sham lesioned fish were treated equally except that the spinal cord was left intact.	Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks’ Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r…		age:adult\|genotype:Tgolig2:eGFP\|tissue:spinal cord\|cell type:olig2:eGFP+ OPCs\|treatment:7 dpl	GSM4911705	GSM4911705: SDPL.1X 01 D10; Danio rerio; RNA Seq	GSM4911705		1	Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r…	GEO Accession:GSM4911705	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP292929		L31843_Track-65494_R1.fastq.gz	fastq	50016664.0	658114.0	GSM4911705 r1	0:76 1:0	A:13556216;C:11587501;G:11405855;T:13466527;N:565	76	0	13556216	11587501	11405855	13466527	565	SRX9521909	SRS7729117	SRA1160306	GEO	Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden	1	0.86173	0.07254	0.9585	0.4398	76	B	usable mapping rate	illumina	nextseq	full_length	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	Germany	2020-11-17	Adult	Adult	Spinal Cord	Nervous System
61893	61893	SRR13074865	SRX9521908	SRS7729115	SRP292929	PRJNA678983	Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]	GSE161642	Transcriptome Analysis	Spinal cord injury SCI results in loss of neurons oligodendrocytes and myelin sheaths all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres which leaves axons denuded impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals zebrafish can functionally regenerate the spinal cord. Yet little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here we report that in adult zebrafish SCI results in axonal oligodendrocyte and myelin sheath loss. We find that OPCs the oligodendorocyte progenitor cells survive the injury enter a reactive state proliferate and differentiate into oligodendrocytes. Concomitantly the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly global reduction of axonal tracts and partial re myelination relative to pre injury levels persist at later stages of regeneration yet suffices for functional recovery. Taken together these findings imply that in the zebrafish spinal cord OPCs replace lost oligodendrocytes and thus re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.	parent bioproject:PRJNA679077	pubmed:33158923	SDPL.1X 01 H09	GSM4911704	source name:OPC\|age:adult\|genotype:Tgolig2:eGFP\|tissue:spinal cord\|cell type:olig2:eGFP+ OPCs\|treatment:7 dpl	SDPL.1X 01 H09	Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters: gunzip A sam t 14 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 N 0 n 1 s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters: a EnsemblGene 87.GRCz10.TR.gtf s 0 Q 1 T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID Chromosome Gene Start Gene End Gene Length then all sample counts; comments start with '#'	OPC	Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction as previously described Becker et al. 1997 . Sham lesioned fish were treated equally except that the spinal cord was left intact.	Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks’ Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r…		age:adult\|genotype:Tgolig2:eGFP\|tissue:spinal cord\|cell type:olig2:eGFP+ OPCs\|treatment:7 dpl	GSM4911704	GSM4911704: SDPL.1X 01 H09; Danio rerio; RNA Seq	GSM4911704		1	Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r…	GEO Accession:GSM4911704	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP292929		L31841_Track-65517_R1.fastq.gz	fastq	57497800.0	756550.0	GSM4911704 r1	0:76 1:0	A:15234361;C:13740258;G:13485376;T:15037204;N:601	76	0	15234361	13740258	13485376	15037204	601	SRX9521908	SRS7729115	SRA1160306	GEO	Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden	1	0.80337	0.07149	0.96197	0.46562	76	B	usable mapping rate	illumina	nextseq	full_length	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	Germany	2020-11-17	Adult	Adult	Spinal Cord	Nervous System
61894	61894	SRR13074864	SRX9521907	SRS7729114	SRP292929	PRJNA678983	Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]	GSE161642	Transcriptome Analysis	Spinal cord injury SCI results in loss of neurons oligodendrocytes and myelin sheaths all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres which leaves axons denuded impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals zebrafish can functionally regenerate the spinal cord. Yet little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here we report that in adult zebrafish SCI results in axonal oligodendrocyte and myelin sheath loss. We find that OPCs the oligodendorocyte progenitor cells survive the injury enter a reactive state proliferate and differentiate into oligodendrocytes. Concomitantly the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly global reduction of axonal tracts and partial re myelination relative to pre injury levels persist at later stages of regeneration yet suffices for functional recovery. Taken together these findings imply that in the zebrafish spinal cord OPCs replace lost oligodendrocytes and thus re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.	parent bioproject:PRJNA679077	pubmed:33158923	SDPL.1X 01 D09	GSM4911703	source name:OPC\|age:adult\|genotype:Tgolig2:eGFP\|tissue:spinal cord\|cell type:olig2:eGFP+ OPCs\|treatment:7 dpl	SDPL.1X 01 D09	Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters: gunzip A sam t 14 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 N 0 n 1 s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters: a EnsemblGene 87.GRCz10.TR.gtf s 0 Q 1 T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID Chromosome Gene Start Gene End Gene Length then all sample counts; comments start with '#'	OPC	Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction as previously described Becker et al. 1997 . Sham lesioned fish were treated equally except that the spinal cord was left intact.	Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks’ Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r…		age:adult\|genotype:Tgolig2:eGFP\|tissue:spinal cord\|cell type:olig2:eGFP+ OPCs\|treatment:7 dpl	GSM4911703	GSM4911703: SDPL.1X 01 D09; Danio rerio; RNA Seq	GSM4911703		1	Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r…	GEO Accession:GSM4911703	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP292929		L31837_Track-65520_R1.fastq.gz	fastq	39290632.0	516982.0	GSM4911703 r1	0:76 1:0	A:10705956;C:9062965;G:9013523;T:10507818;N:370	76	0	10705956	9062965	9013523	10507818	370	SRX9521907	SRS7729114	SRA1160306	GEO	Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden	1	0.84931	0.06191	0.94844	0.43923	76	B	usable mapping rate	illumina	nextseq	full_length	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	Germany	2020-11-17	Adult	Adult	Spinal Cord	Nervous System
61895	61895	SRR13074863	SRX9521906	SRS7729113	SRP292929	PRJNA678983	Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]	GSE161642	Transcriptome Analysis	Spinal cord injury SCI results in loss of neurons oligodendrocytes and myelin sheaths all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres which leaves axons denuded impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals zebrafish can functionally regenerate the spinal cord. Yet little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here we report that in adult zebrafish SCI results in axonal oligodendrocyte and myelin sheath loss. We find that OPCs the oligodendorocyte progenitor cells survive the injury enter a reactive state proliferate and differentiate into oligodendrocytes. Concomitantly the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly global reduction of axonal tracts and partial re myelination relative to pre injury levels persist at later stages of regeneration yet suffices for functional recovery. Taken together these findings imply that in the zebrafish spinal cord OPCs replace lost oligodendrocytes and thus re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.	parent bioproject:PRJNA679077	pubmed:33158923	SDPL.1X 01 E09	GSM4911702	source name:OPC\|age:adult\|genotype:Tgolig2:eGFP\|tissue:spinal cord\|cell type:olig2:eGFP+ OPCs\|treatment:7 dpl	SDPL.1X 01 E09	Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters: gunzip A sam t 14 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 N 0 n 1 s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters: a EnsemblGene 87.GRCz10.TR.gtf s 0 Q 1 T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID Chromosome Gene Start Gene End Gene Length then all sample counts; comments start with '#'	OPC	Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction as previously described Becker et al. 1997 . Sham lesioned fish were treated equally except that the spinal cord was left intact.	Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks’ Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r…		age:adult\|genotype:Tgolig2:eGFP\|tissue:spinal cord\|cell type:olig2:eGFP+ OPCs\|treatment:7 dpl	GSM4911702	GSM4911702: SDPL.1X 01 E09; Danio rerio; RNA Seq	GSM4911702		1	Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r…	GEO Accession:GSM4911702	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP292929		L31838_Track-65491_R1.fastq.gz	fastq	61965460.0	815335.0	GSM4911702 r1	0:76 1:0	A:16477650;C:14685380;G:14442373;T:16359327;N:730	76	0	16477650	14685380	14442373	16359327	730	SRX9521906	SRS7729113	SRA1160306	GEO	Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden	1	0.84168	0.07136	0.95994	0.4496	76	B	usable mapping rate	illumina	nextseq	full_length	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	Germany	2020-11-17	Adult	Adult	Spinal Cord	Nervous System
61896	61896	SRR13074862	SRX9521905	SRS7729112	SRP292929	PRJNA678983	Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]	GSE161642	Transcriptome Analysis	Spinal cord injury SCI results in loss of neurons oligodendrocytes and myelin sheaths all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres which leaves axons denuded impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals zebrafish can functionally regenerate the spinal cord. Yet little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here we report that in adult zebrafish SCI results in axonal oligodendrocyte and myelin sheath loss. We find that OPCs the oligodendorocyte progenitor cells survive the injury enter a reactive state proliferate and differentiate into oligodendrocytes. Concomitantly the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly global reduction of axonal tracts and partial re myelination relative to pre injury levels persist at later stages of regeneration yet suffices for functional recovery. Taken together these findings imply that in the zebrafish spinal cord OPCs replace lost oligodendrocytes and thus re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.	parent bioproject:PRJNA679077	pubmed:33158923	SDPL.1X 01 H08	GSM4911701	source name:OPC\|age:adult\|genotype:Tgolig2:eGFP\|tissue:spinal cord\|cell type:olig2:eGFP+ OPCs\|treatment:7 dpl	SDPL.1X 01 H08	Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters: gunzip A sam t 14 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 N 0 n 1 s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters: a EnsemblGene 87.GRCz10.TR.gtf s 0 Q 1 T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID Chromosome Gene Start Gene End Gene Length then all sample counts; comments start with '#'	OPC	Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction as previously described Becker et al. 1997 . Sham lesioned fish were treated equally except that the spinal cord was left intact.	Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks’ Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r…		age:adult\|genotype:Tgolig2:eGFP\|tissue:spinal cord\|cell type:olig2:eGFP+ OPCs\|treatment:7 dpl	GSM4911701	GSM4911701: SDPL.1X 01 H08; Danio rerio; RNA Seq	GSM4911701		1	Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r…	GEO Accession:GSM4911701	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP292929		L31835_Track-65524_R1.fastq.gz	fastq	43124528.0	567428.0	GSM4911701 r1	0:76 1:0	A:12087543;C:9503663;G:9433604;T:12099295;N:423	76	0	12087543	9503663	9433604	12099295	423	SRX9521905	SRS7729112	SRA1160306	GEO	Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden	1	0.87346	0.06823	0.91319	0.44132	76	B	usable mapping rate	illumina	nextseq	full_length	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	Germany	2020-11-17	Adult	Adult	Spinal Cord	Nervous System
61897	61897	SRR13074861	SRX9521904	SRS7729111	SRP292929	PRJNA678983	Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]	GSE161642	Transcriptome Analysis	Spinal cord injury SCI results in loss of neurons oligodendrocytes and myelin sheaths all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres which leaves axons denuded impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals zebrafish can functionally regenerate the spinal cord. Yet little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here we report that in adult zebrafish SCI results in axonal oligodendrocyte and myelin sheath loss. We find that OPCs the oligodendorocyte progenitor cells survive the injury enter a reactive state proliferate and differentiate into oligodendrocytes. Concomitantly the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly global reduction of axonal tracts and partial re myelination relative to pre injury levels persist at later stages of regeneration yet suffices for functional recovery. Taken together these findings imply that in the zebrafish spinal cord OPCs replace lost oligodendrocytes and thus re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.	parent bioproject:PRJNA679077	pubmed:33158923	SDPL.1X 01 G08	GSM4911700	source name:OPC\|age:adult\|genotype:Tgolig2:eGFP\|tissue:spinal cord\|cell type:olig2:eGFP+ OPCs\|treatment:7 dpl	SDPL.1X 01 G08	Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters: gunzip A sam t 14 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 N 0 n 1 s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters: a EnsemblGene 87.GRCz10.TR.gtf s 0 Q 1 T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID Chromosome Gene Start Gene End Gene Length then all sample counts; comments start with '#'	OPC	Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction as previously described Becker et al. 1997 . Sham lesioned fish were treated equally except that the spinal cord was left intact.	Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks’ Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r…		age:adult\|genotype:Tgolig2:eGFP\|tissue:spinal cord\|cell type:olig2:eGFP+ OPCs\|treatment:7 dpl	GSM4911700	GSM4911700: SDPL.1X 01 G08; Danio rerio; RNA Seq	GSM4911700		1	Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r…	GEO Accession:GSM4911700	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP292929		L31834_Track-65815_R1.fastq.gz	fastq	68812680.0	905430.0	GSM4911700 r1	0:76 1:0	A:18393172;C:16321163;G:16311394;T:17786188;N:763	76	0	18393172	16321163	16311394	17786188	763	SRX9521904	SRS7729111	SRA1160306	GEO	Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden	1	0.77544	0.02505	0.98599	0.37319	76	B	usable mapping rate	illumina	nextseq	full_length	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	Germany	2020-11-17	Adult	Adult	Spinal Cord	Nervous System
61898	61898	SRR13074860	SRX9521903	SRS7729110	SRP292929	PRJNA678983	Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]	GSE161642	Transcriptome Analysis	Spinal cord injury SCI results in loss of neurons oligodendrocytes and myelin sheaths all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres which leaves axons denuded impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals zebrafish can functionally regenerate the spinal cord. Yet little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here we report that in adult zebrafish SCI results in axonal oligodendrocyte and myelin sheath loss. We find that OPCs the oligodendorocyte progenitor cells survive the injury enter a reactive state proliferate and differentiate into oligodendrocytes. Concomitantly the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly global reduction of axonal tracts and partial re myelination relative to pre injury levels persist at later stages of regeneration yet suffices for functional recovery. Taken together these findings imply that in the zebrafish spinal cord OPCs replace lost oligodendrocytes and thus re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.	parent bioproject:PRJNA679077	pubmed:33158923	SDPL.1X 01 F08	GSM4911699	source name:OPC\|age:adult\|genotype:Tgolig2:eGFP\|tissue:spinal cord\|cell type:olig2:eGFP+ OPCs\|treatment:7 dpl	SDPL.1X 01 F08	Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters: gunzip A sam t 14 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 N 0 n 1 s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters: a EnsemblGene 87.GRCz10.TR.gtf s 0 Q 1 T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID Chromosome Gene Start Gene End Gene Length then all sample counts; comments start with '#'	OPC	Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction as previously described Becker et al. 1997 . Sham lesioned fish were treated equally except that the spinal cord was left intact.	Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks’ Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r…		age:adult\|genotype:Tgolig2:eGFP\|tissue:spinal cord\|cell type:olig2:eGFP+ OPCs\|treatment:7 dpl	GSM4911699	GSM4911699: SDPL.1X 01 F08; Danio rerio; RNA Seq	GSM4911699		1	Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r…	GEO Accession:GSM4911699	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP292929		L31833_Track-65514_R1.fastq.gz	fastq	57341240.0	754490.0	GSM4911699 r1	0:76 1:0	A:16401241;C:12304778;G:12249825;T:16384848;N:548	76	0	16401241	12304778	12249825	16384848	548	SRX9521903	SRS7729110	SRA1160306	GEO	Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden	1	0.83611	0.13643	0.94211	0.45347	76	B	usable mapping rate	illumina	nextseq	full_length	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	Germany	2020-11-17	Adult	Adult	Spinal Cord	Nervous System
61899	61899	SRR13074859	SRX9521902	SRS7729109	SRP292929	PRJNA678983	Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]	GSE161642	Transcriptome Analysis	Spinal cord injury SCI results in loss of neurons oligodendrocytes and myelin sheaths all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres which leaves axons denuded impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals zebrafish can functionally regenerate the spinal cord. Yet little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here we report that in adult zebrafish SCI results in axonal oligodendrocyte and myelin sheath loss. We find that OPCs the oligodendorocyte progenitor cells survive the injury enter a reactive state proliferate and differentiate into oligodendrocytes. Concomitantly the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly global reduction of axonal tracts and partial re myelination relative to pre injury levels persist at later stages of regeneration yet suffices for functional recovery. Taken together these findings imply that in the zebrafish spinal cord OPCs replace lost oligodendrocytes and thus re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.	parent bioproject:PRJNA679077	pubmed:33158923	SDPL.1X 01 B08	GSM4911698	source name:OPC\|age:adult\|genotype:Tgolig2:eGFP\|tissue:spinal cord\|cell type:olig2:eGFP+ OPCs\|treatment:7 dpl	SDPL.1X 01 B08	Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters: gunzip A sam t 14 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 N 0 n 1 s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters: a EnsemblGene 87.GRCz10.TR.gtf s 0 Q 1 T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID Chromosome Gene Start Gene End Gene Length then all sample counts; comments start with '#'	OPC	Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction as previously described Becker et al. 1997 . Sham lesioned fish were treated equally except that the spinal cord was left intact.	Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks’ Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r…		age:adult\|genotype:Tgolig2:eGFP\|tissue:spinal cord\|cell type:olig2:eGFP+ OPCs\|treatment:7 dpl	GSM4911698	GSM4911698: SDPL.1X 01 B08; Danio rerio; RNA Seq	GSM4911698		1	Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r…	GEO Accession:GSM4911698	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP292929		L31829_Track-65480_R1.fastq.gz	fastq	44584412.0	586637.0	GSM4911698 r1	0:76 1:0	A:12539371;C:9753168;G:9731686;T:12559767;N:420	76	0	12539371	9753168	9731686	12559767	420	SRX9521902	SRS7729109	SRA1160306	GEO	Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden	1	0.86975	0.07528	0.94381	0.42299	76	B	usable mapping rate	illumina	nextseq	full_length	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	Germany	2020-11-17	Adult	Adult	Spinal Cord	Nervous System
61900	61900	SRR13074858	SRX9521901	SRS7729108	SRP292929	PRJNA678983	Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]	GSE161642	Transcriptome Analysis	Spinal cord injury SCI results in loss of neurons oligodendrocytes and myelin sheaths all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres which leaves axons denuded impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals zebrafish can functionally regenerate the spinal cord. Yet little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here we report that in adult zebrafish SCI results in axonal oligodendrocyte and myelin sheath loss. We find that OPCs the oligodendorocyte progenitor cells survive the injury enter a reactive state proliferate and differentiate into oligodendrocytes. Concomitantly the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly global reduction of axonal tracts and partial re myelination relative to pre injury levels persist at later stages of regeneration yet suffices for functional recovery. Taken together these findings imply that in the zebrafish spinal cord OPCs replace lost oligodendrocytes and thus re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.	parent bioproject:PRJNA679077	pubmed:33158923	SDPL.1X 01 G07	GSM4911697	source name:OPC\|age:adult\|genotype:Tgolig2:eGFP\|tissue:spinal cord\|cell type:olig2:eGFP+ OPCs\|treatment:7 dpl	SDPL.1X 01 G07	Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters: gunzip A sam t 14 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 N 0 n 1 s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters: a EnsemblGene 87.GRCz10.TR.gtf s 0 Q 1 T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID Chromosome Gene Start Gene End Gene Length then all sample counts; comments start with '#'	OPC	Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction as previously described Becker et al. 1997 . Sham lesioned fish were treated equally except that the spinal cord was left intact.	Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks’ Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r…		age:adult\|genotype:Tgolig2:eGFP\|tissue:spinal cord\|cell type:olig2:eGFP+ OPCs\|treatment:7 dpl	GSM4911697	GSM4911697: SDPL.1X 01 G07; Danio rerio; RNA Seq	GSM4911697		1	Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r…	GEO Accession:GSM4911697	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP292929		L31827_Track-65495_R1.fastq.gz	fastq	37037536.0	487336.0	GSM4911697 r1	0:76 1:0	A:10509543;C:7993320;G:8002174;T:10532156;N:343	76	0	10509543	7993320	8002174	10532156	343	SRX9521901	SRS7729108	SRA1160306	GEO	Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden	1	0.88425	0.07297	0.91778	0.42613	76	B	usable mapping rate	illumina	nextseq	full_length	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	Germany	2020-11-17	Adult	Adult	Spinal Cord	Nervous System
61901	61901	SRR13074857	SRX9521900	SRS7729107	SRP292929	PRJNA678983	Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]	GSE161642	Transcriptome Analysis	Spinal cord injury SCI results in loss of neurons oligodendrocytes and myelin sheaths all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres which leaves axons denuded impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals zebrafish can functionally regenerate the spinal cord. Yet little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here we report that in adult zebrafish SCI results in axonal oligodendrocyte and myelin sheath loss. We find that OPCs the oligodendorocyte progenitor cells survive the injury enter a reactive state proliferate and differentiate into oligodendrocytes. Concomitantly the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly global reduction of axonal tracts and partial re myelination relative to pre injury levels persist at later stages of regeneration yet suffices for functional recovery. Taken together these findings imply that in the zebrafish spinal cord OPCs replace lost oligodendrocytes and thus re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.	parent bioproject:PRJNA679077	pubmed:33158923	SDPL.1X 01 F07	GSM4911696	source name:OPC\|age:adult\|genotype:Tgolig2:eGFP\|tissue:spinal cord\|cell type:olig2:eGFP+ OPCs\|treatment:7 dpl	SDPL.1X 01 F07	Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters: gunzip A sam t 14 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 N 0 n 1 s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters: a EnsemblGene 87.GRCz10.TR.gtf s 0 Q 1 T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID Chromosome Gene Start Gene End Gene Length then all sample counts; comments start with '#'	OPC	Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction as previously described Becker et al. 1997 . Sham lesioned fish were treated equally except that the spinal cord was left intact.	Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks’ Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r…		age:adult\|genotype:Tgolig2:eGFP\|tissue:spinal cord\|cell type:olig2:eGFP+ OPCs\|treatment:7 dpl	GSM4911696	GSM4911696: SDPL.1X 01 F07; Danio rerio; RNA Seq	GSM4911696		1	Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r…	GEO Accession:GSM4911696	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP292929		L31826_Track-65533_R1.fastq.gz	fastq	57925148.0	762173.0	GSM4911696 r1	0:76 1:0	A:16001688;C:12966467;G:12816135;T:16140226;N:632	76	0	16001688	12966467	12816135	16140226	632	SRX9521900	SRS7729107	SRA1160306	GEO	Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden	1	0.88397	0.06671	0.90544	0.46916	76	B	usable mapping rate	illumina	nextseq	full_length	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	Germany	2020-11-17	Adult	Adult	Spinal Cord	Nervous System
61902	61902	SRR13074856	SRX9521899	SRS7729106	SRP292929	PRJNA678983	Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]	GSE161642	Transcriptome Analysis	Spinal cord injury SCI results in loss of neurons oligodendrocytes and myelin sheaths all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres which leaves axons denuded impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals zebrafish can functionally regenerate the spinal cord. Yet little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here we report that in adult zebrafish SCI results in axonal oligodendrocyte and myelin sheath loss. We find that OPCs the oligodendorocyte progenitor cells survive the injury enter a reactive state proliferate and differentiate into oligodendrocytes. Concomitantly the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly global reduction of axonal tracts and partial re myelination relative to pre injury levels persist at later stages of regeneration yet suffices for functional recovery. Taken together these findings imply that in the zebrafish spinal cord OPCs replace lost oligodendrocytes and thus re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.	parent bioproject:PRJNA679077	pubmed:33158923	SHAM.1X 01 C03	GSM4911695	source name:OPC\|age:adult\|genotype:Tgolig2:eGFP\|tissue:spinal cord\|cell type:olig2:eGFP+ OPCs\|treatment:sham control	SHAM.1X 01 C03	Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters: gunzip A sam t 14 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 N 0 n 1 s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters: a EnsemblGene 87.GRCz10.TR.gtf s 0 Q 1 T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID Chromosome Gene Start Gene End Gene Length then all sample counts; comments start with '#'	OPC	Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction as previously described Becker et al. 1997 . Sham lesioned fish were treated equally except that the spinal cord was left intact.	Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks’ Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r…		age:adult\|genotype:Tgolig2:eGFP\|tissue:spinal cord\|cell type:olig2:eGFP+ OPCs\|treatment:sham control	GSM4911695	GSM4911695: SHAM.1X 01 C03; Danio rerio; RNA Seq	GSM4911695		1	Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r…	GEO Accession:GSM4911695	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP292929		L31798_Track-65475_R1.fastq.gz	fastq	31934972.0	420197.0	GSM4911695 r1	0:76 1:0	A:8769567;C:7288144;G:7242972;T:8633980;N:309	76	0	8769567	7288144	7242972	8633980	309	SRX9521899	SRS7729106	SRA1160306	GEO	Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden	1	0.83696	0.07569	0.94564	0.40838	76	B	usable mapping rate	illumina	nextseq	full_length	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	Germany	2020-11-17	Adult	Adult	Spinal Cord	Nervous System
61903	61903	SRR13074855	SRX9521898	SRS7729105	SRP292929	PRJNA678983	Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]	GSE161642	Transcriptome Analysis	Spinal cord injury SCI results in loss of neurons oligodendrocytes and myelin sheaths all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres which leaves axons denuded impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals zebrafish can functionally regenerate the spinal cord. Yet little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here we report that in adult zebrafish SCI results in axonal oligodendrocyte and myelin sheath loss. We find that OPCs the oligodendorocyte progenitor cells survive the injury enter a reactive state proliferate and differentiate into oligodendrocytes. Concomitantly the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly global reduction of axonal tracts and partial re myelination relative to pre injury levels persist at later stages of regeneration yet suffices for functional recovery. Taken together these findings imply that in the zebrafish spinal cord OPCs replace lost oligodendrocytes and thus re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.	parent bioproject:PRJNA679077	pubmed:33158923	SDPL.1X 01 G11	GSM4911694	source name:OPC\|age:adult\|genotype:Tgolig2:eGFP\|tissue:spinal cord\|cell type:olig2:eGFP+ OPCs\|treatment:7 dpl	SDPL.1X 01 G11	Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters: gunzip A sam t 14 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 N 0 n 1 s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters: a EnsemblGene 87.GRCz10.TR.gtf s 0 Q 1 T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID Chromosome Gene Start Gene End Gene Length then all sample counts; comments start with '#'	OPC	Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction as previously described Becker et al. 1997 . Sham lesioned fish were treated equally except that the spinal cord was left intact.	Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks’ Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r…		age:adult\|genotype:Tgolig2:eGFP\|tissue:spinal cord\|cell type:olig2:eGFP+ OPCs\|treatment:7 dpl	GSM4911694	GSM4911694: SDPL.1X 01 G11; Danio rerio; RNA Seq	GSM4911694		1	Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r…	GEO Accession:GSM4911694	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP292929		L31852_Track-65485_R1.fastq.gz	fastq	54897992.0	722342.0	GSM4911694 r1	0:76 1:0	A:14668879;C:12847119;G:12672757;T:14708712;N:525	76	0	14668879	12847119	12672757	14708712	525	SRX9521898	SRS7729105	SRA1160306	GEO	Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden	1	0.85646	0.04938	0.97061	0.49581	76	B	usable mapping rate	illumina	nextseq	full_length	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	Germany	2020-11-17	Adult	Adult	Spinal Cord	Nervous System
61904	61904	SRR13074854	SRX9521897	SRS7729104	SRP292929	PRJNA678983	Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]	GSE161642	Transcriptome Analysis	Spinal cord injury SCI results in loss of neurons oligodendrocytes and myelin sheaths all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres which leaves axons denuded impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals zebrafish can functionally regenerate the spinal cord. Yet little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here we report that in adult zebrafish SCI results in axonal oligodendrocyte and myelin sheath loss. We find that OPCs the oligodendorocyte progenitor cells survive the injury enter a reactive state proliferate and differentiate into oligodendrocytes. Concomitantly the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly global reduction of axonal tracts and partial re myelination relative to pre injury levels persist at later stages of regeneration yet suffices for functional recovery. Taken together these findings imply that in the zebrafish spinal cord OPCs replace lost oligodendrocytes and thus re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.	parent bioproject:PRJNA679077	pubmed:33158923	SDPL.1X 01 H11	GSM4911693	source name:OPC\|age:adult\|genotype:Tgolig2:eGFP\|tissue:spinal cord\|cell type:olig2:eGFP+ OPCs\|treatment:7 dpl	SDPL.1X 01 H11	Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters: gunzip A sam t 14 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 N 0 n 1 s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters: a EnsemblGene 87.GRCz10.TR.gtf s 0 Q 1 T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID Chromosome Gene Start Gene End Gene Length then all sample counts; comments start with '#'	OPC	Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction as previously described Becker et al. 1997 . Sham lesioned fish were treated equally except that the spinal cord was left intact.	Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks’ Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r…		age:adult\|genotype:Tgolig2:eGFP\|tissue:spinal cord\|cell type:olig2:eGFP+ OPCs\|treatment:7 dpl	GSM4911693	GSM4911693: SDPL.1X 01 H11; Danio rerio; RNA Seq	GSM4911693		1	Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r…	GEO Accession:GSM4911693	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP292929		L31853_Track-65502_R1.fastq.gz	fastq	46178588.0	607613.0	GSM4911693 r1	0:76 1:0	A:12671327;C:10418553;G:10364180;T:12724067;N:461	76	0	12671327	10418553	10364180	12724067	461	SRX9521897	SRS7729104	SRA1160306	GEO	Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden	1	0.8753	0.12822	0.94217	0.49382	76	B	usable mapping rate	illumina	nextseq	full_length	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	Germany	2020-11-17	Adult	Adult	Spinal Cord	Nervous System
61905	61905	SRR13074853	SRX9521896	SRS7729103	SRP292929	PRJNA678983	Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]	GSE161642	Transcriptome Analysis	Spinal cord injury SCI results in loss of neurons oligodendrocytes and myelin sheaths all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres which leaves axons denuded impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals zebrafish can functionally regenerate the spinal cord. Yet little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here we report that in adult zebrafish SCI results in axonal oligodendrocyte and myelin sheath loss. We find that OPCs the oligodendorocyte progenitor cells survive the injury enter a reactive state proliferate and differentiate into oligodendrocytes. Concomitantly the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly global reduction of axonal tracts and partial re myelination relative to pre injury levels persist at later stages of regeneration yet suffices for functional recovery. Taken together these findings imply that in the zebrafish spinal cord OPCs replace lost oligodendrocytes and thus re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.	parent bioproject:PRJNA679077	pubmed:33158923	SDPL.1X 01 C12	GSM4911692	source name:OPC\|age:adult\|genotype:Tgolig2:eGFP\|tissue:spinal cord\|cell type:olig2:eGFP+ OPCs\|treatment:7 dpl	SDPL.1X 01 C12	Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters: gunzip A sam t 14 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 N 0 n 1 s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters: a EnsemblGene 87.GRCz10.TR.gtf s 0 Q 1 T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID Chromosome Gene Start Gene End Gene Length then all sample counts; comments start with '#'	OPC	Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction as previously described Becker et al. 1997 . Sham lesioned fish were treated equally except that the spinal cord was left intact.	Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks’ Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r…		age:adult\|genotype:Tgolig2:eGFP\|tissue:spinal cord\|cell type:olig2:eGFP+ OPCs\|treatment:7 dpl	GSM4911692	GSM4911692: SDPL.1X 01 C12; Danio rerio; RNA Seq	GSM4911692		1	Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r…	GEO Accession:GSM4911692	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP292929		L31854_Track-65529_R1.fastq.gz	fastq	44095960.0	580210.0	GSM4911692 r1	0:76 1:0	A:12115895;C:9895007;G:9925959;T:12158661;N:438	76	0	12115895	9895007	9925959	12158661	438	SRX9521896	SRS7729103	SRA1160306	GEO	Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden	1	0.87833	0.09359	0.90989	0.4896	76	B	usable mapping rate	illumina	nextseq	full_length	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	Germany	2020-11-17	Adult	Adult	Spinal Cord	Nervous System
61906	61906	SRR13074852	SRX9521895	SRS7729102	SRP292929	PRJNA678983	Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]	GSE161642	Transcriptome Analysis	Spinal cord injury SCI results in loss of neurons oligodendrocytes and myelin sheaths all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres which leaves axons denuded impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals zebrafish can functionally regenerate the spinal cord. Yet little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here we report that in adult zebrafish SCI results in axonal oligodendrocyte and myelin sheath loss. We find that OPCs the oligodendorocyte progenitor cells survive the injury enter a reactive state proliferate and differentiate into oligodendrocytes. Concomitantly the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly global reduction of axonal tracts and partial re myelination relative to pre injury levels persist at later stages of regeneration yet suffices for functional recovery. Taken together these findings imply that in the zebrafish spinal cord OPCs replace lost oligodendrocytes and thus re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.	parent bioproject:PRJNA679077	pubmed:33158923	SDPL.1X 01 G12	GSM4911691	source name:OPC\|age:adult\|genotype:Tgolig2:eGFP\|tissue:spinal cord\|cell type:olig2:eGFP+ OPCs\|treatment:7 dpl	SDPL.1X 01 G12	Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters: gunzip A sam t 14 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 N 0 n 1 s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters: a EnsemblGene 87.GRCz10.TR.gtf s 0 Q 1 T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID Chromosome Gene Start Gene End Gene Length then all sample counts; comments start with '#'	OPC	Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction as previously described Becker et al. 1997 . Sham lesioned fish were treated equally except that the spinal cord was left intact.	Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks’ Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r…		age:adult\|genotype:Tgolig2:eGFP\|tissue:spinal cord\|cell type:olig2:eGFP+ OPCs\|treatment:7 dpl	GSM4911691	GSM4911691: SDPL.1X 01 G12; Danio rerio; RNA Seq	GSM4911691		1	Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r…	GEO Accession:GSM4911691	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP292929		L31858_Track-65493_R1.fastq.gz	fastq	35644152.0	469002.0	GSM4911691 r1	0:76 1:0	A:9972531;C:7847245;G:7837313;T:9986717;N:346	76	0	9972531	7847245	7837313	9986717	346	SRX9521895	SRS7729102	SRA1160306	GEO	Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden	1	0.88663	0.13068	0.91494	0.47588	76	B	usable mapping rate	illumina	nextseq	full_length	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	Germany	2020-11-17	Adult	Adult	Spinal Cord	Nervous System
61907	61907	SRR13074851	SRX9521894	SRS7729101	SRP292929	PRJNA678983	Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]	GSE161642	Transcriptome Analysis	Spinal cord injury SCI results in loss of neurons oligodendrocytes and myelin sheaths all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres which leaves axons denuded impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals zebrafish can functionally regenerate the spinal cord. Yet little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here we report that in adult zebrafish SCI results in axonal oligodendrocyte and myelin sheath loss. We find that OPCs the oligodendorocyte progenitor cells survive the injury enter a reactive state proliferate and differentiate into oligodendrocytes. Concomitantly the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly global reduction of axonal tracts and partial re myelination relative to pre injury levels persist at later stages of regeneration yet suffices for functional recovery. Taken together these findings imply that in the zebrafish spinal cord OPCs replace lost oligodendrocytes and thus re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.	parent bioproject:PRJNA679077	pubmed:33158923	SDPL.1X 01 E12	GSM4911690	source name:OPC\|age:adult\|genotype:Tgolig2:eGFP\|tissue:spinal cord\|cell type:olig2:eGFP+ OPCs\|treatment:7 dpl	SDPL.1X 01 E12	Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters: gunzip A sam t 14 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 N 0 n 1 s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters: a EnsemblGene 87.GRCz10.TR.gtf s 0 Q 1 T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID Chromosome Gene Start Gene End Gene Length then all sample counts; comments start with '#'	OPC	Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction as previously described Becker et al. 1997 . Sham lesioned fish were treated equally except that the spinal cord was left intact.	Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks’ Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r…		age:adult\|genotype:Tgolig2:eGFP\|tissue:spinal cord\|cell type:olig2:eGFP+ OPCs\|treatment:7 dpl	GSM4911690	GSM4911690: SDPL.1X 01 E12; Danio rerio; RNA Seq	GSM4911690		1	Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r…	GEO Accession:GSM4911690	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP292929		L31856_Track-65492_R1.fastq.gz	fastq	58951680.0	775680.0	GSM4911690 r1	0:76 1:0	A:16101283;C:13495044;G:13372556;T:15982231;N:566	76	0	16101283	13495044	13372556	15982231	566	SRX9521894	SRS7729101	SRA1160306	GEO	Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden	1	0.82873	0.11796	0.91232	0.49392	76	B	usable mapping rate	illumina	nextseq	full_length	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	Germany	2020-11-17	Adult	Adult	Spinal Cord	Nervous System
61908	61908	SRR13074850	SRX9521893	SRS7729100	SRP292929	PRJNA678983	Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]	GSE161642	Transcriptome Analysis	Spinal cord injury SCI results in loss of neurons oligodendrocytes and myelin sheaths all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres which leaves axons denuded impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals zebrafish can functionally regenerate the spinal cord. Yet little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here we report that in adult zebrafish SCI results in axonal oligodendrocyte and myelin sheath loss. We find that OPCs the oligodendorocyte progenitor cells survive the injury enter a reactive state proliferate and differentiate into oligodendrocytes. Concomitantly the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly global reduction of axonal tracts and partial re myelination relative to pre injury levels persist at later stages of regeneration yet suffices for functional recovery. Taken together these findings imply that in the zebrafish spinal cord OPCs replace lost oligodendrocytes and thus re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.	parent bioproject:PRJNA679077	pubmed:33158923	SDPL.1X 01 D11	GSM4911689	source name:OPC\|age:adult\|genotype:Tgolig2:eGFP\|tissue:spinal cord\|cell type:olig2:eGFP+ OPCs\|treatment:7 dpl	SDPL.1X 01 D11	Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters: gunzip A sam t 14 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 N 0 n 1 s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters: a EnsemblGene 87.GRCz10.TR.gtf s 0 Q 1 T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID Chromosome Gene Start Gene End Gene Length then all sample counts; comments start with '#'	OPC	Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction as previously described Becker et al. 1997 . Sham lesioned fish were treated equally except that the spinal cord was left intact.	Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks’ Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r…		age:adult\|genotype:Tgolig2:eGFP\|tissue:spinal cord\|cell type:olig2:eGFP+ OPCs\|treatment:7 dpl	GSM4911689	GSM4911689: SDPL.1X 01 D11; Danio rerio; RNA Seq	GSM4911689		1	Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r…	GEO Accession:GSM4911689	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP292929		L31849_Track-65500_R1.fastq.gz	fastq	32125732.0	422707.0	GSM4911689 r1	0:76 1:0	A:9095116;C:6986874;G:7011682;T:9031744;N:316	76	0	9095116	6986874	7011682	9031744	316	SRX9521893	SRS7729100	SRA1160306	GEO	Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden	1	0.89242	0.15095	0.90078	0.48473	76	B	usable mapping rate	illumina	nextseq	full_length	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	Germany	2020-11-17	Adult	Adult	Spinal Cord	Nervous System
61909	61909	SRR13074849	SRX9521892	SRS7729099	SRP292929	PRJNA678983	Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]	GSE161642	Transcriptome Analysis	Spinal cord injury SCI results in loss of neurons oligodendrocytes and myelin sheaths all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres which leaves axons denuded impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals zebrafish can functionally regenerate the spinal cord. Yet little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here we report that in adult zebrafish SCI results in axonal oligodendrocyte and myelin sheath loss. We find that OPCs the oligodendorocyte progenitor cells survive the injury enter a reactive state proliferate and differentiate into oligodendrocytes. Concomitantly the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly global reduction of axonal tracts and partial re myelination relative to pre injury levels persist at later stages of regeneration yet suffices for functional recovery. Taken together these findings imply that in the zebrafish spinal cord OPCs replace lost oligodendrocytes and thus re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.	parent bioproject:PRJNA679077	pubmed:33158923	SDPL.1X 01 E10	GSM4911688	source name:OPC\|age:adult\|genotype:Tgolig2:eGFP\|tissue:spinal cord\|cell type:olig2:eGFP+ OPCs\|treatment:7 dpl	SDPL.1X 01 E10	Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters: gunzip A sam t 14 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 N 0 n 1 s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters: a EnsemblGene 87.GRCz10.TR.gtf s 0 Q 1 T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID Chromosome Gene Start Gene End Gene Length then all sample counts; comments start with '#'	OPC	Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction as previously described Becker et al. 1997 . Sham lesioned fish were treated equally except that the spinal cord was left intact.	Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks’ Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r…		age:adult\|genotype:Tgolig2:eGFP\|tissue:spinal cord\|cell type:olig2:eGFP+ OPCs\|treatment:7 dpl	GSM4911688	GSM4911688: SDPL.1X 01 E10; Danio rerio; RNA Seq	GSM4911688		1	Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r…	GEO Accession:GSM4911688	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP292929		L31844_Track-65806_R1.fastq.gz	fastq	68832288.0	905688.0	GSM4911688 r1	0:76 1:0	A:17893744;C:16892912;G:16924773;T:17120132;N:727	76	0	17893744	16892912	16924773	17120132	727	SRX9521892	SRS7729099	SRA1160306	GEO	Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden	1	0.74462	0.03896	0.97983	0.44767	76	B	usable mapping rate	illumina	nextseq	full_length	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	Germany	2020-11-17	Adult	Adult	Spinal Cord	Nervous System
61910	61910	SRR13074848	SRX9521891	SRS7729098	SRP292929	PRJNA678983	Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]	GSE161642	Transcriptome Analysis	Spinal cord injury SCI results in loss of neurons oligodendrocytes and myelin sheaths all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres which leaves axons denuded impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals zebrafish can functionally regenerate the spinal cord. Yet little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here we report that in adult zebrafish SCI results in axonal oligodendrocyte and myelin sheath loss. We find that OPCs the oligodendorocyte progenitor cells survive the injury enter a reactive state proliferate and differentiate into oligodendrocytes. Concomitantly the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly global reduction of axonal tracts and partial re myelination relative to pre injury levels persist at later stages of regeneration yet suffices for functional recovery. Taken together these findings imply that in the zebrafish spinal cord OPCs replace lost oligodendrocytes and thus re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.	parent bioproject:PRJNA679077	pubmed:33158923	SDPL.1X 01 C10	GSM4911687	source name:OPC\|age:adult\|genotype:Tgolig2:eGFP\|tissue:spinal cord\|cell type:olig2:eGFP+ OPCs\|treatment:7 dpl	SDPL.1X 01 C10	Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters: gunzip A sam t 14 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 N 0 n 1 s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters: a EnsemblGene 87.GRCz10.TR.gtf s 0 Q 1 T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID Chromosome Gene Start Gene End Gene Length then all sample counts; comments start with '#'	OPC	Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction as previously described Becker et al. 1997 . Sham lesioned fish were treated equally except that the spinal cord was left intact.	Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks’ Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r…		age:adult\|genotype:Tgolig2:eGFP\|tissue:spinal cord\|cell type:olig2:eGFP+ OPCs\|treatment:7 dpl	GSM4911687	GSM4911687: SDPL.1X 01 C10; Danio rerio; RNA Seq	GSM4911687		1	Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r…	GEO Accession:GSM4911687	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP292929		L31842_Track-65512_R1.fastq.gz	fastq	30740556.0	404481.0	GSM4911687 r1	0:76 1:0	A:8441463;C:6917208;G:6931159;T:8450350;N:376	76	0	8441463	6917208	6931159	8450350	376	SRX9521891	SRS7729098	SRA1160306	GEO	Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden	1	0.88369	0.11101	0.92908	0.50616	76	B	usable mapping rate	illumina	nextseq	full_length	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	Germany	2020-11-17	Adult	Adult	Spinal Cord	Nervous System
61911	61911	SRR13074847	SRX9521890	SRS7729097	SRP292929	PRJNA678983	Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]	GSE161642	Transcriptome Analysis	Spinal cord injury SCI results in loss of neurons oligodendrocytes and myelin sheaths all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres which leaves axons denuded impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals zebrafish can functionally regenerate the spinal cord. Yet little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here we report that in adult zebrafish SCI results in axonal oligodendrocyte and myelin sheath loss. We find that OPCs the oligodendorocyte progenitor cells survive the injury enter a reactive state proliferate and differentiate into oligodendrocytes. Concomitantly the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly global reduction of axonal tracts and partial re myelination relative to pre injury levels persist at later stages of regeneration yet suffices for functional recovery. Taken together these findings imply that in the zebrafish spinal cord OPCs replace lost oligodendrocytes and thus re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.	parent bioproject:PRJNA679077	pubmed:33158923	SDPL.1X 01 F09	GSM4911686	source name:OPC\|age:adult\|genotype:Tgolig2:eGFP\|tissue:spinal cord\|cell type:olig2:eGFP+ OPCs\|treatment:7 dpl	SDPL.1X 01 F09	Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters: gunzip A sam t 14 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 N 0 n 1 s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters: a EnsemblGene 87.GRCz10.TR.gtf s 0 Q 1 T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID Chromosome Gene Start Gene End Gene Length then all sample counts; comments start with '#'	OPC	Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction as previously described Becker et al. 1997 . Sham lesioned fish were treated equally except that the spinal cord was left intact.	Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks’ Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r…		age:adult\|genotype:Tgolig2:eGFP\|tissue:spinal cord\|cell type:olig2:eGFP+ OPCs\|treatment:7 dpl	GSM4911686	GSM4911686: SDPL.1X 01 F09; Danio rerio; RNA Seq	GSM4911686		1	Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at r…	GEO Accession:GSM4911686	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP292929		L31839_Track-65496_R1.fastq.gz	fastq	35958260.0	473135.0	GSM4911686 r1	0:76 1:0	A:9949741;C:8078433;G:8074393;T:9855320;N:373	76	0	9949741	8078433	8074393	9855320	373	SRX9521890	SRS7729097	SRA1160306	GEO	Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden	1	0.86855	0.13924	0.93736	0.50494	76	B	usable mapping rate	illumina	nextseq	full_length	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	Germany	2020-11-17	Adult	Adult	Spinal Cord	Nervous System

Advanced export

JSON shape: default, array, newline-delimited

CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;