metadata: run_metadata: 4,415 rows where experiment.library_layout = "SINGLE", experiment.library_source = "TRANSCRIPTOMIC" and technology = "smartseq"

4,415 rows where experiment.library_layout = "SINGLE", experiment.library_source = "TRANSCRIPTOMIC" and technology = "smartseq"

descending

Link	rowid ▼	run.accession	experiment.accession	sample.accession	study.accession	bioproject	study.title	study.alias	study.type	study.abstract	study.attributes	sample.description	sample.title	sample.alias	sample.centername	sample.attributes	experiment.title	experiment.alias	experiment.library_name	experiment.design_description	experiment.library_construction_protocol	experiment.attributes	experiment.library_strategy	experiment.library_source	experiment.library_selection	experiment.library_layout	experiment.platform	experiment.instrument_model	experiment.study_ref	run.title	run.attributes	run.filename	run.semantic_name	run.total_bases	run.total_spots	run.alias	run.read_lengths	run.base_counts	run.r1_length	run.r2_length	run.Acount	run.Ccount	run.Gcount	run.Tcount	run.Ncount	run.experiment	run.pool_member	submission.accession	submission.srasource	submission.bioprojectsource	seqdetective.n_mates	seqdetective.mapping_rate.mate1	seqdetective.nofeature_rate.mate1	seqdetective.sparsity.mate1	seqdetective.pos_strand_rate.mate1	seqdetective.readlen.mate1	seqdetective.judgement.mate1	seqdetective.judgement.reason	platform_family	instrument_generation	read_bias	selection_class	prep_kit	sc_or_bulk	tech_class	technology	submission.bioprojectsource.country	earliest_date	devstage_curation	devstage_curation_coarse	tissue_curation	tissue_curation_coarse
9651	9651	ERR3266392	ERX3293003	ERS3358386	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp positive rep2	SAMEA5556346	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556346\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 6\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp positive rep2 s	sponge tdr gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_9pos_S2_L001_R1_001.fastq.gz	fastq	603238067.0	8014716.0	E MTAB 7846:sponge tdr gfp positive rep2 lane1	0:75.27 1:0	A:164797697;C:136552121;G:141138007;T:160737152;N:13090	75	0	164797697	136552121	141138007	160737152	13090	ERX3293003	ERS3358386	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95083	0.06432	0.71532	0.50098	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9652	9652	ERR3266393	ERX3293003	ERS3358386	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp positive rep2	SAMEA5556346	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556346\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 6\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp positive rep2 s	sponge tdr gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_9pos_S2_L002_R1_001.fastq.gz	fastq	603749720.0	8021069.0	E MTAB 7846:sponge tdr gfp positive rep2 lane2	0:75.27 1:0	A:164972969;C:136661417;G:141205792;T:160896264;N:13278	75	0	164972969	136661417	141205792	160896264	13278	ERX3293003	ERS3358386	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.951	0.06542	0.71768	0.50051	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9653	9653	ERR3266394	ERX3293003	ERS3358386	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp positive rep2	SAMEA5556346	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556346\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 6\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp positive rep2 s	sponge tdr gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_9pos_S2_L003_R1_001.fastq.gz	fastq	608154053.0	8079704.0	E MTAB 7846:sponge tdr gfp positive rep2 lane3	0:75.27 1:0	A:166117918;C:137731172;G:142320339;T:161970092;N:14532	75	0	166117918	137731172	142320339	161970092	14532	ERX3293003	ERS3358386	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95155	0.0657	0.71634	0.49493	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9654	9654	ERR3266395	ERX3293003	ERS3358386	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp positive rep2	SAMEA5556346	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556346\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 6\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp positive rep2 s	sponge tdr gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_9pos_S2_L004_R1_001.fastq.gz	fastq	599143392.0	7959897.0	E MTAB 7846:sponge tdr gfp positive rep2 lane4	0:75.27 1:0	A:163706904;C:135622453;G:140192351;T:159605249;N:16435	75	0	163706904	135622453	140192351	159605249	16435	ERX3293003	ERS3358386	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95061	0.06431	0.71764	0.50166	75	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9655	9655	ERR3266388	ERX3293002	ERS3358385	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp positive rep1	SAMEA5556345	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556345\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 5\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp positive rep1 s	sponge tdr gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_6pos_S4_L001_R1_001.fastq.gz	fastq	616761505.0	8202480.0	E MTAB 7846:sponge tdr gfp positive rep1 lane1	0:75.19 1:0	A:168679238;C:139548565;G:143969797;T:164545362;N:18543	75	0	168679238	139548565	143969797	164545362	18543	ERX3293002	ERS3358385	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95019	0.06806	0.7097	0.50337	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9656	9656	ERR3266389	ERX3293002	ERS3358385	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp positive rep1	SAMEA5556345	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556345\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 5\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp positive rep1 s	sponge tdr gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_6pos_S4_L002_R1_001.fastq.gz	fastq	617529482.0	8212485.0	E MTAB 7846:sponge tdr gfp positive rep1 lane2	0:75.19 1:0	A:168925757;C:139655387;G:144096837;T:164831236;N:20265	75	0	168925757	139655387	144096837	164831236	20265	ERX3293002	ERS3358385	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.9492	0.06753	0.712	0.49881	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9657	9657	ERR3266390	ERX3293002	ERS3358385	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp positive rep1	SAMEA5556345	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556345\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 5\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp positive rep1 s	sponge tdr gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_6pos_S4_L003_R1_001.fastq.gz	fastq	624156883.0	8300861.0	E MTAB 7846:sponge tdr gfp positive rep1 lane3	0:75.19 1:0	A:170696950;C:141302376;G:145759286;T:166377781;N:20490	75	0	170696950	141302376	145759286	166377781	20490	ERX3293002	ERS3358385	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94917	0.06724	0.71291	0.50783	75	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9658	9658	ERR3266391	ERX3293002	ERS3358385	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp positive rep1	SAMEA5556345	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556345\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 5\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp positive rep1 s	sponge tdr gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_6pos_S4_L004_R1_001.fastq.gz	fastq	615013615.0	8179180.0	E MTAB 7846:sponge tdr gfp positive rep1 lane4	0:75.19 1:0	A:168237742;C:139106952;G:143535658;T:164110735;N:22528	75	0	168237742	139106952	143535658	164110735	22528	ERX3293002	ERS3358385	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94892	0.06723	0.71206	0.50775	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9659	9659	ERR3266384	ERX3293001	ERS3358384	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp negative rep2	SAMEA5556344	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556344\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 6\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp negative rep2 s	sponge tdr gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_9neg_S1_L001_R1_001.fastq.gz	fastq	659562366.0	8762947.0	E MTAB 7846:sponge tdr gfp negative rep2 lane1	0:75.27 1:0	A:178744772;C:150091912;G:155092318;T:175619332;N:14032	75	0	178744772	150091912	155092318	175619332	14032	ERX3293001	ERS3358384	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.9517	0.06908	0.70822	0.48025	73	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9660	9660	ERR3266385	ERX3293001	ERS3358384	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp negative rep2	SAMEA5556344	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556344\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 6\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp negative rep2 s	sponge tdr gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_9neg_S1_L002_R1_001.fastq.gz	fastq	658688825.0	8751176.0	E MTAB 7846:sponge tdr gfp negative rep2 lane2	0:75.27 1:0	A:178540155;C:149844100;G:154850294;T:175438757;N:15519	75	0	178540155	149844100	154850294	175438757	15519	ERX3293001	ERS3358384	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95059	0.06748	0.70806	0.48177	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9661	9661	ERR3266386	ERX3293001	ERS3358384	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp negative rep2	SAMEA5556344	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556344\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 6\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp negative rep2 s	sponge tdr gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_9neg_S1_L003_R1_001.fastq.gz	fastq	665901310.0	8846927.0	E MTAB 7846:sponge tdr gfp negative rep2 lane3	0:75.27 1:0	A:180412445;C:151589489;G:156677030;T:177206192;N:16154	75	0	180412445	151589489	156677030	177206192	16154	ERX3293001	ERS3358384	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95095	0.06855	0.7082	0.4787	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9662	9662	ERR3266387	ERX3293001	ERS3358384	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp negative rep2	SAMEA5556344	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556344\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 6\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp negative rep2 s	sponge tdr gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_9neg_S1_L004_R1_001.fastq.gz	fastq	655674573.0	8711278.0	E MTAB 7846:sponge tdr gfp negative rep2 lane4	0:75.27 1:0	A:177658097;C:149188009;G:154201531;T:174609176;N:17760	75	0	177658097	149188009	154201531	174609176	17760	ERX3293001	ERS3358384	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.9503	0.06838	0.70926	0.47475	75	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9663	9663	ERR3266380	ERX3293000	ERS3358383	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp negative rep1	SAMEA5556343	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556343\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 5\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp negative rep1 s	sponge tdr gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_6neg_S3_L001_R1_001.fastq.gz	fastq	634491637.0	8440052.0	E MTAB 7846:sponge tdr gfp negative rep1 lane1	0:75.18 1:0	A:170881257;C:145535643;G:150561786;T:167495156;N:17795	75	0	170881257	145535643	150561786	167495156	17795	ERX3293000	ERS3358383	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94996	0.05672	0.70571	0.48691	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9664	9664	ERR3266381	ERX3293000	ERS3358383	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp negative rep1	SAMEA5556343	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556343\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 5\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp negative rep1 s	sponge tdr gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_6neg_S3_L002_R1_001.fastq.gz	fastq	632900752.0	8418846.0	E MTAB 7846:sponge tdr gfp negative rep1 lane2	0:75.18 1:0	A:170454908;C:145141392;G:150172752;T:167112562;N:19138	75	0	170454908	145141392	150172752	167112562	19138	ERX3293000	ERS3358383	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94905	0.05627	0.70457	0.4865	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9665	9665	ERR3266382	ERX3293000	ERS3358383	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp negative rep1	SAMEA5556343	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556343\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 5\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp negative rep1 s	sponge tdr gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_6neg_S3_L003_R1_001.fastq.gz	fastq	638530115.0	8494045.0	E MTAB 7846:sponge tdr gfp negative rep1 lane3	0:75.17 1:0	A:171907482;C:146526309;G:151612209;T:168464163;N:19952	75	0	171907482	146526309	151612209	168464163	19952	ERX3293000	ERS3358383	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94919	0.05578	0.70849	0.48073	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9666	9666	ERR3266383	ERX3293000	ERS3358383	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp negative rep1	SAMEA5556343	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556343\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 5\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp negative rep1 s	sponge tdr gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_6neg_S3_L004_R1_001.fastq.gz	fastq	627433322.0	8346505.0	E MTAB 7846:sponge tdr gfp negative rep1 lane4	0:75.17 1:0	A:169016383;C:143886824;G:148914725;T:165593528;N:21862	75	0	169016383	143886824	148914725	165593528	21862	ERX3293000	ERS3358383	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94993	0.05721	0.7052	0.48878	75	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9667	9667	ERR3266376	ERX3292999	ERS3358382	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp positive rep2	SAMEA5556342	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556342\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 2\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp positive rep2 s	sponge isl gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_7pos_S10_L001_R1_001.fastq.gz	fastq	618672195.0	8218047.0	E MTAB 7846:sponge isl gfp positive rep2 lane1	0:75.28 1:0	A:166422886;C:142212204;G:146857539;T:163167819;N:11747	75	0	166422886	142212204	146857539	163167819	11747	ERX3292999	ERS3358382	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94979	0.08351	0.70863	0.47581	75	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9668	9668	ERR3266377	ERX3292999	ERS3358382	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp positive rep2	SAMEA5556342	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556342\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 2\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp positive rep2 s	sponge isl gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_7pos_S10_L002_R1_001.fastq.gz	fastq	618709102.0	8218295.0	E MTAB 7846:sponge isl gfp positive rep2 lane2	0:75.28 1:0	A:166470432;C:142189977;G:146819280;T:163216323;N:13090	75	0	166470432	142189977	146819280	163216323	13090	ERX3292999	ERS3358382	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94977	0.08255	0.70644	0.47228	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9669	9669	ERR3266378	ERX3292999	ERS3358382	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp positive rep2	SAMEA5556342	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556342\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 2\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp positive rep2 s	sponge isl gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_7pos_S10_L003_R1_001.fastq.gz	fastq	625353059.0	8306375.0	E MTAB 7846:sponge isl gfp positive rep2 lane3	0:75.29 1:0	A:168233274;C:143793178;G:148510556;T:164802476;N:13575	75	0	168233274	143793178	148510556	164802476	13575	ERX3292999	ERS3358382	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95014	0.08368	0.70743	0.47846	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9670	9670	ERR3266379	ERX3292999	ERS3358382	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp positive rep2	SAMEA5556342	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556342\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 2\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp positive rep2 s	sponge isl gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_7pos_S10_L004_R1_001.fastq.gz	fastq	615204990.0	8171748.0	E MTAB 7846:sponge isl gfp positive rep2 lane4	0:75.28 1:0	A:165565861;C:141380152;G:146028839;T:162214263;N:15875	75	0	165565861	141380152	146028839	162214263	15875	ERX3292999	ERS3358382	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94954	0.08233	0.70834	0.48166	75	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9671	9671	ERR3266372	ERX3292998	ERS3358381	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp positive rep1	SAMEA5556341	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556341\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 1\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp positive rep1 s	sponge isl gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_6pos_S12_L001_R1_001.fastq.gz	fastq	626474467.0	8318996.0	E MTAB 7846:sponge isl gfp positive rep1 lane1	0:75.31 1:0	A:170186220;C:142441110;G:147048643;T:166786401;N:12093	75	0	170186220	142441110	147048643	166786401	12093	ERX3292998	ERS3358381	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94907	0.08132	0.69684	0.4736	75	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9672	9672	ERR3266373	ERX3292998	ERS3358381	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp positive rep1	SAMEA5556341	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556341\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 1\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp positive rep1 s	sponge isl gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_6pos_S12_L002_R1_001.fastq.gz	fastq	626477579.0	8318750.0	E MTAB 7846:sponge isl gfp positive rep1 lane2	0:75.31 1:0	A:170185337;C:142396801;G:147032265;T:166850532;N:12644	75	0	170185337	142396801	147032265	166850532	12644	ERX3292998	ERS3358381	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94941	0.08253	0.6957	0.47554	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9673	9673	ERR3266374	ERX3292998	ERS3358381	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp positive rep1	SAMEA5556341	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556341\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 1\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp positive rep1 s	sponge isl gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_6pos_S12_L003_R1_001.fastq.gz	fastq	632098509.0	8393388.0	E MTAB 7846:sponge isl gfp positive rep1 lane3	0:75.31 1:0	A:171699353;C:143766296;G:148442110;T:168177264;N:13486	75	0	171699353	143766296	148442110	168177264	13486	ERX3292998	ERS3358381	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94866	0.08247	0.69601	0.48009	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9674	9674	ERR3266375	ERX3292998	ERS3358381	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp positive rep1	SAMEA5556341	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556341\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 1\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp positive rep1 s	sponge isl gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_6pos_S12_L004_R1_001.fastq.gz	fastq	622997479.0	8272752.0	E MTAB 7846:sponge isl gfp positive rep1 lane4	0:75.31 1:0	A:169306677;C:141586415;G:146241288;T:165847752;N:15347	75	0	169306677	141586415	146241288	165847752	15347	ERX3292998	ERS3358381	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.9483	0.08034	0.69662	0.47868	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9675	9675	ERR3266368	ERX3292997	ERS3358380	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp negative rep2	SAMEA5556340	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556340\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 2\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp negative rep2 s	sponge isl gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_7neg_S9_L001_R1_001.fastq.gz	fastq	707454819.0	9395082.0	E MTAB 7846:sponge isl gfp negative rep2 lane1	0:75.30 1:0	A:194991862;C:157927850;G:163280639;T:191241488;N:12980	75	0	194991862	157927850	163280639	191241488	12980	ERX3292997	ERS3358380	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.93871	0.08926	0.70806	0.46501	75	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9676	9676	ERR3266369	ERX3292997	ERS3358380	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp negative rep2	SAMEA5556340	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556340\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 2\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp negative rep2 s	sponge isl gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_7neg_S9_L002_R1_001.fastq.gz	fastq	704791838.0	9359668.0	E MTAB 7846:sponge isl gfp negative rep2 lane2	0:75.30 1:0	A:194317422;C:157276895;G:162624670;T:190558322;N:14529	75	0	194317422	157276895	162624670	190558322	14529	ERX3292997	ERS3358380	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.93816	0.08859	0.70999	0.4661	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9677	9677	ERR3266370	ERX3292997	ERS3358380	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp negative rep2	SAMEA5556340	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556340\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 2\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp negative rep2 s	sponge isl gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_7neg_S9_L003_R1_001.fastq.gz	fastq	715991833.0	9508323.0	E MTAB 7846:sponge isl gfp negative rep2 lane3	0:75.30 1:0	A:197297222;C:159913026;G:165363927;T:193402765;N:14893	75	0	197297222	159913026	165363927	193402765	14893	ERX3292997	ERS3358380	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.93844	0.08854	0.70828	0.46042	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9678	9678	ERR3266371	ERX3292997	ERS3358380	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp negative rep2	SAMEA5556340	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556340\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 2\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp negative rep2 s	sponge isl gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_7neg_S9_L004_R1_001.fastq.gz	fastq	703723869.0	9345669.0	E MTAB 7846:sponge isl gfp negative rep2 lane4	0:75.30 1:0	A:194029886;C:157050176;G:162432310;T:190193608;N:17889	75	0	194029886	157050176	162432310	190193608	17889	ERX3292997	ERS3358380	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.93897	0.08993	0.70863	0.45707	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9679	9679	ERR3266364	ERX3292996	ERS3358379	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp negative rep1	SAMEA5556339	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556339\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 1\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp negative rep1 s	sponge isl gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_6neg_S11_L001_R1_001.fastq.gz	fastq	676581458.0	8983758.0	E MTAB 7846:sponge isl gfp negative rep1 lane1	0:75.31 1:0	A:184297337;C:153352193;G:158268476;T:180651038;N:12414	75	0	184297337	153352193	158268476	180651038	12414	ERX3292996	ERS3358379	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94981	0.07715	0.69138	0.47243	74	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9680	9680	ERR3266365	ERX3292996	ERS3358379	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp negative rep1	SAMEA5556339	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556339\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 1\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp negative rep1 s	sponge isl gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_6neg_S11_L002_R1_001.fastq.gz	fastq	676876555.0	8987445.0	E MTAB 7846:sponge isl gfp negative rep1 lane2	0:75.31 1:0	A:184435129;C:153332402;G:158323789;T:180770978;N:14257	75	0	184435129	153332402	158323789	180770978	14257	ERX3292996	ERS3358379	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94901	0.07805	0.69179	0.47182	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9681	9681	ERR3266366	ERX3292996	ERS3358379	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp negative rep1	SAMEA5556339	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556339\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 1\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp negative rep1 s	sponge isl gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_6neg_S11_L003_R1_001.fastq.gz	fastq	681771213.0	9052615.0	E MTAB 7846:sponge isl gfp negative rep1 lane3	0:75.31 1:0	A:185717696;C:154552039;G:159567102;T:181919781;N:14595	75	0	185717696	154552039	159567102	181919781	14595	ERX3292996	ERS3358379	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94923	0.07768	0.69167	0.47219	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9682	9682	ERR3266367	ERX3292996	ERS3358379	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp negative rep1	SAMEA5556339	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556339\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 1\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp negative rep1 s	sponge isl gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_6neg_S11_L004_R1_001.fastq.gz	fastq	671169917.0	8911624.0	E MTAB 7846:sponge isl gfp negative rep1 lane4	0:75.31 1:0	A:182910490;C:152045814;G:157010053;T:179186548;N:17012	75	0	182910490	152045814	157010053	179186548	17012	ERX3292996	ERS3358379	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94941	0.07612	0.69106	0.47736	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9683	9683	ERR3266360	ERX3292995	ERS3358378	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp positive rep2	SAMEA5556338	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556338\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 4\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp positive rep2 s	sponge ccn gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_8pos_S6_L001_R1_001.fastq.gz	fastq	745666738.0	9917771.0	E MTAB 7846:sponge ccn gfp positive rep2 lane1	0:75.18 1:0	A:207714377;C:163732420;G:169037726;T:205161925;N:20290	75	0	207714377	163732420	169037726	205161925	20290	ERX3292995	ERS3358378	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94006	0.17809	0.68166	0.48912	74	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9684	9684	ERR3266361	ERX3292995	ERS3358378	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp positive rep2	SAMEA5556338	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556338\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 4\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp positive rep2 s	sponge ccn gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_8pos_S6_L002_R1_001.fastq.gz	fastq	747693645.0	9944395.0	E MTAB 7846:sponge ccn gfp positive rep2 lane2	0:75.19 1:0	A:208257288;C:164106384;G:169478025;T:205830399;N:21549	75	0	208257288	164106384	169478025	205830399	21549	ERX3292995	ERS3358378	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.93873	0.17738	0.68296	0.49656	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9685	9685	ERR3266362	ERX3292995	ERS3358378	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp positive rep2	SAMEA5556338	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556338\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 4\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp positive rep2 s	sponge ccn gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_8pos_S6_L003_R1_001.fastq.gz	fastq	756134124.0	10056818.0	E MTAB 7846:sponge ccn gfp positive rep2 lane3	0:75.19 1:0	A:210573012;C:166089133;G:171475300;T:207973232;N:23447	75	0	210573012	166089133	171475300	207973232	23447	ERX3292995	ERS3358378	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94077	0.18001	0.68004	0.49812	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9686	9686	ERR3266363	ERX3292995	ERS3358378	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp positive rep2	SAMEA5556338	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556338\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 4\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp positive rep2 s	sponge ccn gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_8pos_S6_L004_R1_001.fastq.gz	fastq	747687619.0	9944417.0	E MTAB 7846:sponge ccn gfp positive rep2 lane4	0:75.19 1:0	A:208315943;C:164104155;G:169484250;T:205757712;N:25559	75	0	208315943	164104155	169484250	205757712	25559	ERX3292995	ERS3358378	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94025	0.17965	0.68124	0.49249	75	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9687	9687	ERR3266356	ERX3292994	ERS3358377	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp positive rep1	SAMEA5556337	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556337\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 3\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp positive rep1 s	sponge ccn gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_7pos_S8_L001_R1_001.fastq.gz	fastq	600153564.0	7972767.0	E MTAB 7846:sponge ccn gfp positive rep1 lane1	0:75.28 1:0	A:165075878;C:133961511;G:138306424;T:162797903;N:11848	75	0	165075878	133961511	138306424	162797903	11848	ERX3292994	ERS3358377	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95367	0.14146	0.69154	0.46621	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9688	9688	ERR3266357	ERX3292994	ERS3358377	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp positive rep1	SAMEA5556337	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556337\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 3\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp positive rep1 s	sponge ccn gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_7pos_S8_L002_R1_001.fastq.gz	fastq	600790169.0	7981038.0	E MTAB 7846:sponge ccn gfp positive rep1 lane2	0:75.28 1:0	A:165262968;C:133988329;G:138458635;T:163066854;N:13383	75	0	165262968	133988329	138458635	163066854	13383	ERX3292994	ERS3358377	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95365	0.14116	0.69301	0.46836	75	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9689	9689	ERR3266358	ERX3292994	ERS3358377	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp positive rep1	SAMEA5556337	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556337\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 3\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp positive rep1 s	sponge ccn gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_7pos_S8_L003_R1_001.fastq.gz	fastq	608611085.0	8084904.0	E MTAB 7846:sponge ccn gfp positive rep1 lane3	0:75.28 1:0	A:167402055;C:135871708;G:140314669;T:165009252;N:13401	75	0	167402055	135871708	140314669	165009252	13401	ERX3292994	ERS3358377	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95403	0.14167	0.69311	0.4702	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9690	9690	ERR3266359	ERX3292994	ERS3358377	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp positive rep1	SAMEA5556337	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556337\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 3\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp positive rep1 s	sponge ccn gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_7pos_S8_L004_R1_001.fastq.gz	fastq	599558663.0	7964718.0	E MTAB 7846:sponge ccn gfp positive rep1 lane4	0:75.28 1:0	A:164965131;C:133749666;G:138194884;T:162633558;N:15424	75	0	164965131	133749666	138194884	162633558	15424	ERX3292994	ERS3358377	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95285	0.14085	0.69037	0.47345	75	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9691	9691	ERR3266352	ERX3292993	ERS3358376	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp negative rep2	SAMEA5556336	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556336\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 4\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp negative rep2 s	sponge ccn gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_8neg_S5_L001_R1_001.fastq.gz	fastq	599599608.0	7970460.0	E MTAB 7846:sponge ccn gfp negative rep2 lane1	0:75.23 1:0	A:162236409;C:136907675;G:141538730;T:158902520;N:14274	75	0	162236409	136907675	141538730	158902520	14274	ERX3292993	ERS3358376	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95404	0.05923	0.69737	0.48627	75	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9692	9692	ERR3266353	ERX3292993	ERS3358376	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp negative rep2	SAMEA5556336	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556336\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 4\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp negative rep2 s	sponge ccn gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_8neg_S5_L002_R1_001.fastq.gz	fastq	600057776.0	7976438.0	E MTAB 7846:sponge ccn gfp negative rep2 lane2	0:75.23 1:0	A:162367410;C:136994919;G:141577782;T:159102194;N:15471	75	0	162367410	136994919	141577782	159102194	15471	ERX3292993	ERS3358376	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.953	0.06085	0.6952	0.48868	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9693	9693	ERR3266354	ERX3292993	ERS3358376	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp negative rep2	SAMEA5556336	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556336\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 4\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp negative rep2 s	sponge ccn gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_8neg_S5_L003_R1_001.fastq.gz	fastq	607089697.0	8069901.0	E MTAB 7846:sponge ccn gfp negative rep2 lane3	0:75.23 1:0	A:164235344;C:138684000;G:143335680;T:160819270;N:15403	75	0	164235344	138684000	143335680	160819270	15403	ERX3292993	ERS3358376	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95245	0.06055	0.69589	0.48813	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9694	9694	ERR3266355	ERX3292993	ERS3358376	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp negative rep2	SAMEA5556336	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556336\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 4\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp negative rep2 s	sponge ccn gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_8neg_S5_L004_R1_001.fastq.gz	fastq	598098243.0	7950223.0	E MTAB 7846:sponge ccn gfp negative rep2 lane4	0:75.23 1:0	A:161836808;C:136564804;G:141157424;T:158521860;N:17347	75	0	161836808	136564804	141157424	158521860	17347	ERX3292993	ERS3358376	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95299	0.06032	0.69501	0.48928	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9695	9695	ERR3266348	ERX3292992	ERS3358375	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp negative rep1	SAMEA5556335	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556335\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 3\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp negative rep1 s	sponge ccn gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_7neg_S7_L001_R1_001.fastq.gz	fastq	668175990.0	8872549.0	E MTAB 7846:sponge ccn gfp negative rep1 lane1	0:75.31 1:0	A:179859350;C:153483169;G:158360605;T:176462088;N:10778	75	0	179859350	153483169	158360605	176462088	10778	ERX3292992	ERS3358375	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95955	0.07154	0.69696	0.46425	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9696	9696	ERR3266349	ERX3292992	ERS3358375	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp negative rep1	SAMEA5556335	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556335\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 3\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp negative rep1 s	sponge ccn gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_7neg_S7_L002_R1_001.fastq.gz	fastq	668154755.0	8872093.0	E MTAB 7846:sponge ccn gfp negative rep1 lane2	0:75.31 1:0	A:179811687;C:153454931;G:158314391;T:176560936;N:12810	75	0	179811687	153454931	158314391	176560936	12810	ERX3292992	ERS3358375	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.96029	0.06969	0.69684	0.46725	75	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9697	9697	ERR3266350	ERX3292992	ERS3358375	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp negative rep1	SAMEA5556335	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556335\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 3\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp negative rep1 s	sponge ccn gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_7neg_S7_L003_R1_001.fastq.gz	fastq	676984426.0	8989004.0	E MTAB 7846:sponge ccn gfp negative rep1 lane3	0:75.31 1:0	A:182159685;C:155578195;G:160511499;T:178722363;N:12684	75	0	182159685	155578195	160511499	178722363	12684	ERX3292992	ERS3358375	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.96012	0.07159	0.69554	0.46811	75	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9698	9698	ERR3266351	ERX3292992	ERS3358375	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp negative rep1	SAMEA5556335	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556335\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 3\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp negative rep1 s	sponge ccn gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_7neg_S7_L004_R1_001.fastq.gz	fastq	666031892.0	8843695.0	E MTAB 7846:sponge ccn gfp negative rep1 lane4	0:75.31 1:0	A:179243298;C:152946459;G:157873912;T:175953752;N:14471	75	0	179243298	152946459	157873912	175953752	14471	ERX3292992	ERS3358375	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.96014	0.07169	0.69493	0.47058	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
10237	10237	ERR7131169	ERX6698608	ERS8070397	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F8 Nega	SAMEA10418613	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418613\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F8 Nega\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry /GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 8\|organism part:olfactory bulb\|sample name:E MTAB 11083:F8 Nega\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F8 Nega s	F8 Nega s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry /GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F22-1_210715_D00404_0538_BCD91CANXX_TCGACGTC-CTAAGCCT_L006_R1_001.fastq.gz	fastq	658093749.0	12903799.0	E MTAB 11083:2874F22 1 210715 D00404 0538 BCD91CANXX TCGACGTC CTAAGCCT L006	0:51 1:0	A:173355262;C:152464129;G:147489024;T:184739885;N:45449	51	0	173355262	152464129	147489024	184739885	45449	ERX6698608	ERS8070397	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.78328	0.15147	0.71289	0.53671	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10238	10238	ERR7131170	ERX6698608	ERS8070397	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F8 Nega	SAMEA10418613	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418613\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F8 Nega\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry /GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 8\|organism part:olfactory bulb\|sample name:E MTAB 11083:F8 Nega\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F8 Nega s	F8 Nega s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry /GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F22-2_210715_D00404_0538_BCD91CANXX_TCGACGTC-CTAAGCCT_L007_R1_001.fastq.gz	fastq	661103769.0	12962819.0	E MTAB 11083:2874F22 2 210715 D00404 0538 BCD91CANXX TCGACGTC CTAAGCCT L007	0:51 1:0	A:174223249;C:153223284;G:148276805;T:185335092;N:45339	51	0	174223249	153223284	148276805	185335092	45339	ERX6698608	ERS8070397	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.78539	0.15054	0.70897	0.5322	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10239	10239	ERR7131167	ERX6698607	ERS8070396	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F8 mCherry GFP	SAMEA10418612	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418612\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F8 mCherry GFP\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP+\|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 8\|organism part:olfactory bulb\|sample name:E MTAB 11083:F8 mCherry GFP\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F8 mCherry GFP s	F8 mCherry GFP s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP+	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F24-1_210715_D00404_0538_BCD91CANXX_TCGACGTC-TCTCTCCG_L006_R1_001.fastq.gz	fastq	693183636.0	13591836.0	E MTAB 11083:2874F24 1 210715 D00404 0538 BCD91CANXX TCGACGTC TCTCTCCG L006	0:51 1:0	A:183977687;C:159275153;G:153149826;T:196732022;N:48948	51	0	183977687	159275153	153149826	196732022	48948	ERX6698607	ERS8070396	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.68942	0.15593	0.75828	0.51858	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10240	10240	ERR7131168	ERX6698607	ERS8070396	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F8 mCherry GFP	SAMEA10418612	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418612\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F8 mCherry GFP\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP+\|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 8\|organism part:olfactory bulb\|sample name:E MTAB 11083:F8 mCherry GFP\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F8 mCherry GFP s	F8 mCherry GFP s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP+	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F24-2_210715_D00404_0538_BCD91CANXX_TCGACGTC-TCTCTCCG_L007_R1_001.fastq.gz	fastq	696648678.0	13659778.0	E MTAB 11083:2874F24 2 210715 D00404 0538 BCD91CANXX TCGACGTC TCTCTCCG L007	0:51 1:0	A:184971832;C:160126524;G:154012023;T:197490098;N:48201	51	0	184971832	160126524	154012023	197490098	48201	ERX6698607	ERS8070396	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.6906	0.15634	0.75909	0.51346	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10241	10241	ERR7131165	ERX6698606	ERS8070395	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F8 mCherry	SAMEA10418611	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418611\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F8 mCherry\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 8\|organism part:olfactory bulb\|sample name:E MTAB 11083:F8 mCherry\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F8 mCherry s	F8 mCherry s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F23-1_210715_D00404_0538_BCD91CANXX_TCGACGTC-CGTCTAAT_L006_R1_001.fastq.gz	fastq	667760646.0	13093346.0	E MTAB 11083:2874F23 1 210715 D00404 0538 BCD91CANXX TCGACGTC CGTCTAAT L006	0:51 1:0	A:179948739;C:150541918;G:145038845;T:192184092;N:47052	51	0	179948739	150541918	145038845	192184092	47052	ERX6698606	ERS8070395	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.71661	0.19774	0.74576	0.52117	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10242	10242	ERR7131166	ERX6698606	ERS8070395	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F8 mCherry	SAMEA10418611	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418611\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F8 mCherry\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 8\|organism part:olfactory bulb\|sample name:E MTAB 11083:F8 mCherry\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F8 mCherry s	F8 mCherry s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F23-2_210715_D00404_0538_BCD91CANXX_TCGACGTC-CGTCTAAT_L007_R1_001.fastq.gz	fastq	670970484.0	13156284.0	E MTAB 11083:2874F23 2 210715 D00404 0538 BCD91CANXX TCGACGTC CGTCTAAT L007	0:51 1:0	A:180906557;C:151329492;G:145816347;T:192872804;N:45284	51	0	180906557	151329492	145816347	192872804	45284	ERX6698606	ERS8070395	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.71682	0.19902	0.74517	0.52618	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10243	10243	ERR7131163	ERX6698605	ERS8070394	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F7 Nega	SAMEA10418610	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418610\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F7 Nega\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry /GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 7\|organism part:olfactory bulb\|sample name:E MTAB 11083:F7 Nega\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F7 Nega s	F7 Nega s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry /GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F19-1_210715_D00404_0538_BCD91CANXX_TCGACGTC-GTAAGGAG_L006_R1_001.fastq.gz	fastq	652205238.0	12788338.0	E MTAB 11083:2874F19 1 210715 D00404 0538 BCD91CANXX TCGACGTC GTAAGGAG L006	0:51 1:0	A:173730405;C:149044598;G:145436777;T:183946928;N:46530	51	0	173730405	149044598	145436777	183946928	46530	ERX6698605	ERS8070394	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.80595	0.17309	0.71003	0.53696	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10244	10244	ERR7131164	ERX6698605	ERS8070394	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F7 Nega	SAMEA10418610	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418610\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F7 Nega\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry /GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 7\|organism part:olfactory bulb\|sample name:E MTAB 11083:F7 Nega\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F7 Nega s	F7 Nega s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry /GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F19-2_210715_D00404_0538_BCD91CANXX_TCGACGTC-GTAAGGAG_L007_R1_001.fastq.gz	fastq	655593423.0	12854773.0	E MTAB 11083:2874F19 2 210715 D00404 0538 BCD91CANXX TCGACGTC GTAAGGAG L007	0:51 1:0	A:174715119;C:149844974;G:146250446;T:184737535;N:45349	51	0	174715119	149844974	146250446	184737535	45349	ERX6698605	ERS8070394	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.80585	0.17497	0.71078	0.53767	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10245	10245	ERR7131161	ERX6698604	ERS8070393	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F7 mCherry GFP	SAMEA10418609	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418609\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F7 mCherry GFP\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP+\|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 7\|organism part:olfactory bulb\|sample name:E MTAB 11083:F7 mCherry GFP\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F7 mCherry GFP s	F7 mCherry GFP s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP+	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F21-1_210715_D00404_0538_BCD91CANXX_TCGACGTC-AAGGAGTA_L006_R1_001.fastq.gz	fastq	661067151.0	12962101.0	E MTAB 11083:2874F21 1 210715 D00404 0538 BCD91CANXX TCGACGTC AAGGAGTA L006	0:51 1:0	A:168281419;C:157701209;G:153487197;T:181550252;N:47074	51	0	168281419	157701209	153487197	181550252	47074	ERX6698604	ERS8070393	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.39074	0.11592	0.82615	0.5252	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10246	10246	ERR7131162	ERX6698604	ERS8070393	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F7 mCherry GFP	SAMEA10418609	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418609\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F7 mCherry GFP\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP+\|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 7\|organism part:olfactory bulb\|sample name:E MTAB 11083:F7 mCherry GFP\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F7 mCherry GFP s	F7 mCherry GFP s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP+	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F21-2_210715_D00404_0538_BCD91CANXX_TCGACGTC-AAGGAGTA_L007_R1_001.fastq.gz	fastq	665709018.0	13053118.0	E MTAB 11083:2874F21 2 210715 D00404 0538 BCD91CANXX TCGACGTC AAGGAGTA L007	0:51 1:0	A:169539998;C:158884603;G:154624803;T:182614264;N:45350	51	0	169539998	158884603	154624803	182614264	45350	ERX6698604	ERS8070393	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.38966	0.1152	0.8258	0.53305	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10247	10247	ERR7131159	ERX6698603	ERS8070392	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F7 mCherry	SAMEA10418608	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418608\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F7 mCherry\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 7\|organism part:olfactory bulb\|sample name:E MTAB 11083:F7 mCherry\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F7 mCherry s	F7 mCherry s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F20-1_210715_D00404_0538_BCD91CANXX_TCGACGTC-ACTGCATA_L006_R1_001.fastq.gz	fastq	657813402.0	12898302.0	E MTAB 11083:2874F20 1 210715 D00404 0538 BCD91CANXX TCGACGTC ACTGCATA L006	0:51 1:0	A:175873489;C:149476129;G:143987770;T:188429588;N:46426	51	0	175873489	149476129	143987770	188429588	46426	ERX6698603	ERS8070392	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.70507	0.2048	0.75923	0.52828	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10248	10248	ERR7131160	ERX6698603	ERS8070392	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F7 mCherry	SAMEA10418608	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418608\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F7 mCherry\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 7\|organism part:olfactory bulb\|sample name:E MTAB 11083:F7 mCherry\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F7 mCherry s	F7 mCherry s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F20-2_210715_D00404_0538_BCD91CANXX_TCGACGTC-ACTGCATA_L007_R1_001.fastq.gz	fastq	660303426.0	12947126.0	E MTAB 11083:2874F20 2 210715 D00404 0538 BCD91CANXX TCGACGTC ACTGCATA L007	0:51 1:0	A:176607119;C:150065781;G:144613110;T:188972809;N:44607	51	0	176607119	150065781	144613110	188972809	44607	ERX6698603	ERS8070392	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.70705	0.20314	0.75852	0.52949	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10249	10249	ERR7131157	ERX6698602	ERS8070391	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F6 Nega	SAMEA10418607	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418607\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F6 Nega\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry /GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 6\|organism part:olfactory bulb\|sample name:E MTAB 11083:F6 Nega\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F6 Nega s	F6 Nega s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry /GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F16-1_210715_D00404_0538_BCD91CANXX_TGCAGCTA-TCTCTCCG_L006_R1_001.fastq.gz	fastq	669627450.0	13129950.0	E MTAB 11083:2874F16 1 210715 D00404 0538 BCD91CANXX TGCAGCTA TCTCTCCG L006	0:51 1:0	A:177483937;C:154097051;G:148063012;T:189935690;N:47760	51	0	177483937	154097051	148063012	189935690	47760	ERX6698602	ERS8070391	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.77183	0.16001	0.71467	0.53352	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10250	10250	ERR7131158	ERX6698602	ERS8070391	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F6 Nega	SAMEA10418607	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418607\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F6 Nega\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry /GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 6\|organism part:olfactory bulb\|sample name:E MTAB 11083:F6 Nega\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F6 Nega s	F6 Nega s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry /GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F16-2_210715_D00404_0538_BCD91CANXX_TGCAGCTA-TCTCTCCG_L007_R1_001.fastq.gz	fastq	671615073.0	13168923.0	E MTAB 11083:2874F16 2 210715 D00404 0538 BCD91CANXX TGCAGCTA TCTCTCCG L007	0:51 1:0	A:178109157;C:154619024;G:148595207;T:190246469;N:45216	51	0	178109157	154619024	148595207	190246469	45216	ERX6698602	ERS8070391	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.77284	0.15963	0.71569	0.53038	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10251	10251	ERR7131155	ERX6698601	ERS8070390	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F6 mCherry GFP	SAMEA10418606	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418606\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F6 mCherry GFP\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP+\|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 6\|organism part:olfactory bulb\|sample name:E MTAB 11083:F6 mCherry GFP\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F6 mCherry GFP s	F6 mCherry GFP s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP+	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F18-1_210715_D00404_0538_BCD91CANXX_TCGACGTC-TATCCTCT_L006_R1_001.fastq.gz	fastq	667663542.0	13091442.0	E MTAB 11083:2874F18 1 210715 D00404 0538 BCD91CANXX TCGACGTC TATCCTCT L006	0:51 1:0	A:177646483;C:152747528;G:146388226;T:190833951;N:47354	51	0	177646483	152747528	146388226	190833951	47354	ERX6698601	ERS8070390	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.67964	0.18123	0.77193	0.53313	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10252	10252	ERR7131156	ERX6698601	ERS8070390	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F6 mCherry GFP	SAMEA10418606	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418606\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F6 mCherry GFP\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP+\|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 6\|organism part:olfactory bulb\|sample name:E MTAB 11083:F6 mCherry GFP\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F6 mCherry GFP s	F6 mCherry GFP s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP+	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F18-2_210715_D00404_0538_BCD91CANXX_TCGACGTC-TATCCTCT_L007_R1_001.fastq.gz	fastq	670170141.0	13140591.0	E MTAB 11083:2874F18 2 210715 D00404 0538 BCD91CANXX TCGACGTC TATCCTCT L007	0:51 1:0	A:178425395;C:153363855;G:147033779;T:191300976;N:46136	51	0	178425395	153363855	147033779	191300976	46136	ERX6698601	ERS8070390	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.67922	0.18101	0.77141	0.53601	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10253	10253	ERR7131153	ERX6698600	ERS8070389	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F6 mCherry	SAMEA10418605	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418605\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F6 mCherry\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 6\|organism part:olfactory bulb\|sample name:E MTAB 11083:F6 mCherry\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F6 mCherry s	F6 mCherry s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F17-1_210715_D00404_0538_BCD91CANXX_TCGACGTC-CTCTCTAT_L006_R1_001.fastq.gz	fastq	677617008.0	13286608.0	E MTAB 11083:2874F17 1 210715 D00404 0538 BCD91CANXX TCGACGTC CTCTCTAT L006	0:51 1:0	A:181785899;C:152797687;G:147070676;T:195914808;N:47938	51	0	181785899	152797687	147070676	195914808	47938	ERX6698600	ERS8070389	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.68298	0.1953	0.76292	0.5395	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10254	10254	ERR7131154	ERX6698600	ERS8070389	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F6 mCherry	SAMEA10418605	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418605\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F6 mCherry\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 6\|organism part:olfactory bulb\|sample name:E MTAB 11083:F6 mCherry\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F6 mCherry s	F6 mCherry s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F17-2_210715_D00404_0538_BCD91CANXX_TCGACGTC-CTCTCTAT_L007_R1_001.fastq.gz	fastq	679922973.0	13331823.0	E MTAB 11083:2874F17 2 210715 D00404 0538 BCD91CANXX TCGACGTC CTCTCTAT L007	0:51 1:0	A:182567819;C:153380607;G:147589890;T:196337722;N:46935	51	0	182567819	153380607	147589890	196337722	46935	ERX6698600	ERS8070389	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.68391	0.19726	0.76299	0.54099	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10255	10255	ERR7131151	ERX6698599	ERS8070388	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F5 Nega	SAMEA10418604	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418604\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F5 Nega\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry /GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 5\|organism part:olfactory bulb\|sample name:E MTAB 11083:F5 Nega\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F5 Nega s	F5 Nega s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry /GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F13-1_210715_D00404_0538_BCD91CANXX_TGCAGCTA-AAGGAGTA_L006_R1_001.fastq.gz	fastq	620316315.0	12163065.0	E MTAB 11083:2874F13 1 210715 D00404 0538 BCD91CANXX TGCAGCTA AAGGAGTA L006	0:51 1:0	A:165967355;C:141072216;G:136931219;T:176301963;N:43562	51	0	165967355	141072216	136931219	176301963	43562	ERX6698599	ERS8070388	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.78924	0.17457	0.71934	0.53563	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10256	10256	ERR7131152	ERX6698599	ERS8070388	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F5 Nega	SAMEA10418604	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418604\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F5 Nega\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry /GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 5\|organism part:olfactory bulb\|sample name:E MTAB 11083:F5 Nega\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F5 Nega s	F5 Nega s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry /GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F13-2_210715_D00404_0538_BCD91CANXX_TGCAGCTA-AAGGAGTA_L007_R1_001.fastq.gz	fastq	623905338.0	12233438.0	E MTAB 11083:2874F13 2 210715 D00404 0538 BCD91CANXX TGCAGCTA AAGGAGTA L007	0:51 1:0	A:166996253;C:141937637;G:137825206;T:177103504;N:42738	51	0	166996253	141937637	137825206	177103504	42738	ERX6698599	ERS8070388	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.78975	0.17387	0.72153	0.54149	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10257	10257	ERR7131149	ERX6698598	ERS8070387	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F5 mCherry GFP	SAMEA10418603	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418603\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F5 mCherry GFP\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP+\|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 5\|organism part:olfactory bulb\|sample name:E MTAB 11083:F5 mCherry GFP\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F5 mCherry GFP s	F5 mCherry GFP s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP+	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F15-1_210715_D00404_0538_BCD91CANXX_TGCAGCTA-CGTCTAAT_L006_R1_001.fastq.gz	fastq	670154841.0	13140291.0	E MTAB 11083:2874F15 1 210715 D00404 0538 BCD91CANXX TGCAGCTA CGTCTAAT L006	0:51 1:0	A:182457480;C:149175456;G:144548173;T:193927470;N:46262	51	0	182457480	149175456	144548173	193927470	46262	ERX6698598	ERS8070387	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.71875	0.18671	0.76047	0.52398	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10258	10258	ERR7131150	ERX6698598	ERS8070387	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F5 mCherry GFP	SAMEA10418603	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418603\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F5 mCherry GFP\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP+\|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 5\|organism part:olfactory bulb\|sample name:E MTAB 11083:F5 mCherry GFP\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F5 mCherry GFP s	F5 mCherry GFP s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP+	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F15-2_210715_D00404_0538_BCD91CANXX_TGCAGCTA-CGTCTAAT_L007_R1_001.fastq.gz	fastq	674202048.0	13219648.0	E MTAB 11083:2874F15 2 210715 D00404 0538 BCD91CANXX TGCAGCTA CGTCTAAT L007	0:51 1:0	A:183639511;C:150168226;G:145502071;T:194847755;N:44485	51	0	183639511	150168226	145502071	194847755	44485	ERX6698598	ERS8070387	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.72111	0.18813	0.76378	0.5258	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10259	10259	ERR7131147	ERX6698597	ERS8070386	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F5 mCherry	SAMEA10418602	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418602\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F5 mCherry\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 5\|organism part:olfactory bulb\|sample name:E MTAB 11083:F5 mCherry\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F5 mCherry s	F5 mCherry s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F14-1_210715_D00404_0538_BCD91CANXX_TGCAGCTA-CTAAGCCT_L006_R1_001.fastq.gz	fastq	615458259.0	12067809.0	E MTAB 11083:2874F14 1 210715 D00404 0538 BCD91CANXX TGCAGCTA CTAAGCCT L006	0:51 1:0	A:165108582;C:139178883;G:134070672;T:177059757;N:40365	51	0	165108582	139178883	134070672	177059757	40365	ERX6698597	ERS8070386	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.69017	0.1977	0.77193	0.53352	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10260	10260	ERR7131148	ERX6698597	ERS8070386	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F5 mCherry	SAMEA10418602	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418602\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F5 mCherry\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 5\|organism part:olfactory bulb\|sample name:E MTAB 11083:F5 mCherry\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F5 mCherry s	F5 mCherry s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F14-2_210715_D00404_0538_BCD91CANXX_TGCAGCTA-CTAAGCCT_L007_R1_001.fastq.gz	fastq	619061613.0	12138463.0	E MTAB 11083:2874F14 2 210715 D00404 0538 BCD91CANXX TGCAGCTA CTAAGCCT L007	0:51 1:0	A:166167516;C:140058774;G:134972850;T:177822733;N:39740	51	0	166167516	140058774	134972850	177822733	39740	ERX6698597	ERS8070386	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.69118	0.20019	0.7707	0.52174	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10261	10261	ERR7131145	ERX6698596	ERS8070385	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F4 Nega	SAMEA10418601	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418601\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F4 Nega\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry /GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 4\|organism part:olfactory bulb\|sample name:E MTAB 11083:F4 Nega\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F4 Nega s	F4 Nega s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry /GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F10-1_210715_D00404_0538_BCD91CANXX_TGCAGCTA-TATCCTCT_L006_R1_001.fastq.gz	fastq	652536687.0	12794837.0	E MTAB 11083:2874F10 1 210715 D00404 0538 BCD91CANXX TGCAGCTA TATCCTCT L006	0:51 1:0	A:178033231;C:144661707;G:139876661;T:189921085;N:44003	51	0	178033231	144661707	139876661	189921085	44003	ERX6698596	ERS8070385	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.76201	0.2508	0.71299	0.53379	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10262	10262	ERR7131146	ERX6698596	ERS8070385	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F4 Nega	SAMEA10418601	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418601\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F4 Nega\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry /GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 4\|organism part:olfactory bulb\|sample name:E MTAB 11083:F4 Nega\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F4 Nega s	F4 Nega s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry /GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F10-2_210715_D00404_0538_BCD91CANXX_TGCAGCTA-TATCCTCT_L007_R1_001.fastq.gz	fastq	655278957.0	12848607.0	E MTAB 11083:2874F10 2 210715 D00404 0538 BCD91CANXX TGCAGCTA TATCCTCT L007	0:51 1:0	A:178938002;C:145332613;G:140527756;T:190437189;N:43397	51	0	178938002	145332613	140527756	190437189	43397	ERX6698596	ERS8070385	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.76188	0.25356	0.71344	0.53081	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10263	10263	ERR7131143	ERX6698595	ERS8070384	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F4 mCherry GFP	SAMEA10418600	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418600\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F4 mCherry GFP\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP+\|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 4\|organism part:olfactory bulb\|sample name:E MTAB 11083:F4 mCherry GFP\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F4 mCherry GFP s	F4 mCherry GFP s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP+	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F12-1_210715_D00404_0538_BCD91CANXX_TGCAGCTA-ACTGCATA_L006_R1_001.fastq.gz	fastq	297921855.0	5841605.0	E MTAB 11083:2874F12 1 210715 D00404 0538 BCD91CANXX TGCAGCTA ACTGCATA L006	0:51 1:0	A:82400724;C:65517496;G:64603058;T:85384480;N:16097	51	0	82400724	65517496	64603058	85384480	16097	ERX6698595	ERS8070384	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.72496	0.20794	0.81223	0.52529	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10264	10264	ERR7131144	ERX6698595	ERS8070384	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F4 mCherry GFP	SAMEA10418600	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418600\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F4 mCherry GFP\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP+\|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 4\|organism part:olfactory bulb\|sample name:E MTAB 11083:F4 mCherry GFP\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F4 mCherry GFP s	F4 mCherry GFP s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP+	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F12-2_210715_D00404_0538_BCD91CANXX_TGCAGCTA-ACTGCATA_L007_R1_001.fastq.gz	fastq	309412971.0	6066921.0	E MTAB 11083:2874F12 2 210715 D00404 0538 BCD91CANXX TGCAGCTA ACTGCATA L007	0:51 1:0	A:85531271;C:68164437;G:67129209;T:88573210;N:14844	51	0	85531271	68164437	67129209	88573210	14844	ERX6698595	ERS8070384	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.7245	0.20724	0.80468	0.52791	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10265	10265	ERR7131141	ERX6698594	ERS8070383	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F4 mCherry	SAMEA10418599	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418599\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F4 mCherry\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 4\|organism part:olfactory bulb\|sample name:E MTAB 11083:F4 mCherry\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F4 mCherry s	F4 mCherry s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F11-1_210715_D00404_0538_BCD91CANXX_TGCAGCTA-GTAAGGAG_L006_R1_001.fastq.gz	fastq	672319791.0	13182741.0	E MTAB 11083:2874F11 1 210715 D00404 0538 BCD91CANXX TGCAGCTA GTAAGGAG L006	0:51 1:0	A:181508034;C:150928549;G:146124085;T:193711358;N:47765	51	0	181508034	150928549	146124085	193711358	47765	ERX6698594	ERS8070383	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.71726	0.19842	0.74986	0.53363	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10266	10266	ERR7131142	ERX6698594	ERS8070383	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F4 mCherry	SAMEA10418599	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418599\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F4 mCherry\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 4\|organism part:olfactory bulb\|sample name:E MTAB 11083:F4 mCherry\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F4 mCherry s	F4 mCherry s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F11-2_210715_D00404_0538_BCD91CANXX_TGCAGCTA-GTAAGGAG_L007_R1_001.fastq.gz	fastq	675486075.0	13244825.0	E MTAB 11083:2874F11 2 210715 D00404 0538 BCD91CANXX TGCAGCTA GTAAGGAG L007	0:51 1:0	A:182462261;C:151688554;G:146902713;T:194385945;N:46602	51	0	182462261	151688554	146902713	194385945	46602	ERX6698594	ERS8070383	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.71745	0.19727	0.74805	0.53092	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10267	10267	ERR7131139	ERX6698593	ERS8070382	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F3 Nega	SAMEA10418598	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418598\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F3 Nega\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry /GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 3\|organism part:olfactory bulb\|sample name:E MTAB 11083:F3 Nega\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F3 Nega s	F3 Nega s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry /GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F7-1_210715_D00404_0538_BCD91CANXX_CGATCAGT-CGTCTAAT_L006_R1_001.fastq.gz	fastq	630093627.0	12354777.0	E MTAB 11083:2874F7 1 210715 D00404 0538 BCD91CANXX CGATCAGT CGTCTAAT L006	0:51 1:0	A:165132739;C:146179836;G:142796880;T:175940613;N:43559	51	0	165132739	146179836	142796880	175940613	43559	ERX6698593	ERS8070382	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.81672	0.15219	0.71277	0.52461	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10268	10268	ERR7131140	ERX6698593	ERS8070382	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F3 Nega	SAMEA10418598	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418598\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F3 Nega\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry /GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 3\|organism part:olfactory bulb\|sample name:E MTAB 11083:F3 Nega\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F3 Nega s	F3 Nega s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry /GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F7-2_210715_D00404_0538_BCD91CANXX_CGATCAGT-CGTCTAAT_L007_R1_001.fastq.gz	fastq	632305242.0	12398142.0	E MTAB 11083:2874F7 2 210715 D00404 0538 BCD91CANXX CGATCAGT CGTCTAAT L007	0:51 1:0	A:165832174;C:146751895;G:143384539;T:176293313;N:43321	51	0	165832174	146751895	143384539	176293313	43321	ERX6698593	ERS8070382	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.81791	0.15444	0.7151	0.52585	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10269	10269	ERR7131137	ERX6698592	ERS8070381	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F3 mCherry GFP	SAMEA10418597	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418597\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F3 mCherry GFP\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP+\|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 3\|organism part:olfactory bulb\|sample name:E MTAB 11083:F3 mCherry GFP\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F3 mCherry GFP s	F3 mCherry GFP s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP+	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F9-1_210715_D00404_0538_BCD91CANXX_TGCAGCTA-CTCTCTAT_L006_R1_001.fastq.gz	fastq	660379620.0	12948620.0	E MTAB 11083:2874F9 1 210715 D00404 0538 BCD91CANXX TGCAGCTA CTCTCTAT L006	0:51 1:0	A:178482695;C:147417787;G:143797476;T:190635173;N:46489	51	0	178482695	147417787	143797476	190635173	46489	ERX6698592	ERS8070381	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.65635	0.17778	0.76899	0.52957	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10270	10270	ERR7131138	ERX6698592	ERS8070381	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F3 mCherry GFP	SAMEA10418597	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418597\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F3 mCherry GFP\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP+\|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 3\|organism part:olfactory bulb\|sample name:E MTAB 11083:F3 mCherry GFP\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F3 mCherry GFP s	F3 mCherry GFP s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP+	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F9-2_210715_D00404_0538_BCD91CANXX_TGCAGCTA-CTCTCTAT_L007_R1_001.fastq.gz	fastq	662411307.0	12988457.0	E MTAB 11083:2874F9 2 210715 D00404 0538 BCD91CANXX TGCAGCTA CTCTCTAT L007	0:51 1:0	A:179158323;C:147942300;G:144319925;T:190945370;N:45389	51	0	179158323	147942300	144319925	190945370	45389	ERX6698592	ERS8070381	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.65813	0.17896	0.77076	0.52835	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10271	10271	ERR7131135	ERX6698591	ERS8070380	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F3 mCherry	SAMEA10418596	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418596\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F3 mCherry\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 3\|organism part:olfactory bulb\|sample name:E MTAB 11083:F3 mCherry\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F3 mCherry s	F3 mCherry s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F8-1_210715_D00404_0538_BCD91CANXX_CGATCAGT-TCTCTCCG_L006_R1_001.fastq.gz	fastq	698608353.0	13698203.0	E MTAB 11083:2874F8 1 210715 D00404 0538 BCD91CANXX CGATCAGT TCTCTCCG L006	0:51 1:0	A:188718612;C:156814081;G:151125083;T:201901570;N:49007	51	0	188718612	156814081	151125083	201901570	49007	ERX6698591	ERS8070380	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.70185	0.21547	0.75588	0.53853	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10272	10272	ERR7131136	ERX6698591	ERS8070380	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F3 mCherry	SAMEA10418596	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418596\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F3 mCherry\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 3\|organism part:olfactory bulb\|sample name:E MTAB 11083:F3 mCherry\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F3 mCherry s	F3 mCherry s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F8-2_210715_D00404_0538_BCD91CANXX_CGATCAGT-TCTCTCCG_L007_R1_001.fastq.gz	fastq	699869175.0	13722925.0	E MTAB 11083:2874F8 2 210715 D00404 0538 BCD91CANXX CGATCAGT TCTCTCCG L007	0:51 1:0	A:189192315;C:157176897;G:151498983;T:201952867;N:48113	51	0	189192315	157176897	151498983	201952867	48113	ERX6698591	ERS8070380	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.70221	0.21684	0.75621	0.53787	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10273	10273	ERR7131133	ERX6698590	ERS8070379	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F2 Nega	SAMEA10418595	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418595\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F2 Nega\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry /GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 2\|organism part:olfactory bulb\|sample name:E MTAB 11083:F2 Nega\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F2 Nega s	F2 Nega s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry /GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F4-1_210715_D00404_0538_BCD91CANXX_CGATCAGT-ACTGCATA_L006_R1_001.fastq.gz	fastq	573812985.0	11251235.0	E MTAB 11083:2874F4 1 210715 D00404 0538 BCD91CANXX CGATCAGT ACTGCATA L006	0:51 1:0	A:150716404;C:132203167;G:129732968;T:161120057;N:40389	51	0	150716404	132203167	129732968	161120057	40389	ERX6698590	ERS8070379	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.81899	0.17302	0.72281	0.54315	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10274	10274	ERR7131134	ERX6698590	ERS8070379	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F2 Nega	SAMEA10418595	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418595\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F2 Nega\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry /GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 2\|organism part:olfactory bulb\|sample name:E MTAB 11083:F2 Nega\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F2 Nega s	F2 Nega s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry /GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F4-2_210715_D00404_0538_BCD91CANXX_CGATCAGT-ACTGCATA_L007_R1_001.fastq.gz	fastq	576184587.0	11297737.0	E MTAB 11083:2874F4 2 210715 D00404 0538 BCD91CANXX CGATCAGT ACTGCATA L007	0:51 1:0	A:151387408;C:132788210;G:130392043;T:161577529;N:39397	51	0	151387408	132788210	130392043	161577529	39397	ERX6698590	ERS8070379	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.81999	0.17082	0.72196	0.54505	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10275	10275	ERR7131131	ERX6698589	ERS8070378	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F2 mCherry GFP	SAMEA10418594	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418594\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F2 mCherry GFP\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP+\|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 2\|organism part:olfactory bulb\|sample name:E MTAB 11083:F2 mCherry GFP\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F2 mCherry GFP s	F2 mCherry GFP s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP+	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F6-1_210715_D00404_0538_BCD91CANXX_CGATCAGT-CTAAGCCT_L006_R1_001.fastq.gz	fastq	654811032.0	12839432.0	E MTAB 11083:2874F6 1 210715 D00404 0538 BCD91CANXX CGATCAGT CTAAGCCT L006	0:51 1:0	A:177403486;C:146202733;G:142207545;T:188951373;N:45895	51	0	177403486	146202733	142207545	188951373	45895	ERX6698589	ERS8070378	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.67854	0.21407	0.76104	0.52713	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10276	10276	ERR7131132	ERX6698589	ERS8070378	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F2 mCherry GFP	SAMEA10418594	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418594\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F2 mCherry GFP\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP+\|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 2\|organism part:olfactory bulb\|sample name:E MTAB 11083:F2 mCherry GFP\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F2 mCherry GFP s	F2 mCherry GFP s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP+	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F6-2_210715_D00404_0538_BCD91CANXX_CGATCAGT-CTAAGCCT_L007_R1_001.fastq.gz	fastq	656911926.0	12880626.0	E MTAB 11083:2874F6 2 210715 D00404 0538 BCD91CANXX CGATCAGT CTAAGCCT L007	0:51 1:0	A:178119212;C:146730132;G:142725348;T:189293212;N:44022	51	0	178119212	146730132	142725348	189293212	44022	ERX6698589	ERS8070378	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.68162	0.21431	0.761	0.5071	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10277	10277	ERR7131129	ERX6698588	ERS8070377	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F2 mCherry	SAMEA10418593	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418593\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F2 mCherry\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 2\|organism part:olfactory bulb\|sample name:E MTAB 11083:F2 mCherry\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F2 mCherry s	F2 mCherry s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F5-1_210715_D00404_0538_BCD91CANXX_CGATCAGT-AAGGAGTA_L006_R1_001.fastq.gz	fastq	607851558.0	11918658.0	E MTAB 11083:2874F5 1 210715 D00404 0538 BCD91CANXX CGATCAGT AAGGAGTA L006	0:51 1:0	A:164814138;C:136071648;G:132945950;T:173976881;N:42941	51	0	164814138	136071648	132945950	173976881	42941	ERX6698588	ERS8070377	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.78967	0.18905	0.73241	0.52347	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10278	10278	ERR7131130	ERX6698588	ERS8070377	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F2 mCherry	SAMEA10418593	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418593\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F2 mCherry\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 2\|organism part:olfactory bulb\|sample name:E MTAB 11083:F2 mCherry\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F2 mCherry s	F2 mCherry s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F5-2_210715_D00404_0538_BCD91CANXX_CGATCAGT-AAGGAGTA_L007_R1_001.fastq.gz	fastq	610931805.0	11979055.0	E MTAB 11083:2874F5 2 210715 D00404 0538 BCD91CANXX CGATCAGT AAGGAGTA L007	0:51 1:0	A:165714775;C:136822925;G:133684294;T:174667814;N:41997	51	0	165714775	136822925	133684294	174667814	41997	ERX6698588	ERS8070377	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.78869	0.18885	0.73156	0.51691	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10279	10279	ERR7131127	ERX6698587	ERS8070376	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F1 Nega	SAMEA10418592	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418592\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F1 Nega\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry /GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 1\|organism part:olfactory bulb\|sample name:E MTAB 11083:F1 Nega\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F1 Nega s	F1 Nega s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry /GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F1-1_210715_D00404_0538_BCD91CANXX_CGATCAGT-CTCTCTAT_L006_R1_001.fastq.gz	fastq	619561872.0	12148272.0	E MTAB 11083:2874F1 1 210715 D00404 0538 BCD91CANXX CGATCAGT CTCTCTAT L006	0:51 1:0	A:164385545;C:141746313;G:138163219;T:175223323;N:43472	51	0	164385545	141746313	138163219	175223323	43472	ERX6698587	ERS8070376	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.80258	0.17703	0.72614	0.53483	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10280	10280	ERR7131128	ERX6698587	ERS8070376	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F1 Nega	SAMEA10418592	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418592\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F1 Nega\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry /GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 1\|organism part:olfactory bulb\|sample name:E MTAB 11083:F1 Nega\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F1 Nega s	F1 Nega s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry /GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F1-2_210715_D00404_0538_BCD91CANXX_CGATCAGT-CTCTCTAT_L007_R1_001.fastq.gz	fastq	621481971.0	12185921.0	E MTAB 11083:2874F1 2 210715 D00404 0538 BCD91CANXX CGATCAGT CTCTCTAT L007	0:51 1:0	A:165030774;C:142231469;G:138651078;T:175527080;N:41570	51	0	165030774	142231469	138651078	175527080	41570	ERX6698587	ERS8070376	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.80248	0.17699	0.726	0.53711	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10281	10281	ERR7131125	ERX6698586	ERS8070375	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F1 mCherry GFP	SAMEA10418591	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418591\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F1 mCherry GFP\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP+\|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 1\|organism part:olfactory bulb\|sample name:E MTAB 11083:F1 mCherry GFP\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F1 mCherry GFP s	F1 mCherry GFP s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP+	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F3-1_210715_D00404_0538_BCD91CANXX_CGATCAGT-GTAAGGAG_L006_R1_001.fastq.gz	fastq	651189369.0	12768419.0	E MTAB 11083:2874F3 1 210715 D00404 0538 BCD91CANXX CGATCAGT GTAAGGAG L006	0:51 1:0	A:176398415;C:145659111;G:142137610;T:186948280;N:45953	51	0	176398415	145659111	142137610	186948280	45953	ERX6698586	ERS8070375	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.69561	0.18489	0.75345	0.52316	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10282	10282	ERR7131126	ERX6698586	ERS8070375	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F1 mCherry GFP	SAMEA10418591	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418591\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F1 mCherry GFP\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP+\|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 1\|organism part:olfactory bulb\|sample name:E MTAB 11083:F1 mCherry GFP\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F1 mCherry GFP s	F1 mCherry GFP s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP+	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F3-2_210715_D00404_0538_BCD91CANXX_CGATCAGT-GTAAGGAG_L007_R1_001.fastq.gz	fastq	653398944.0	12811744.0	E MTAB 11083:2874F3 2 210715 D00404 0538 BCD91CANXX CGATCAGT GTAAGGAG L007	0:51 1:0	A:177139734;C:146171766;G:142707146;T:187335475;N:44823	51	0	177139734	146171766	142707146	187335475	44823	ERX6698586	ERS8070375	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.69496	0.18414	0.75375	0.52317	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10283	10283	ERR7131123	ERX6698585	ERS8070374	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F1 mCherry	SAMEA10418590	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418590\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F1 mCherry\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 1\|organism part:olfactory bulb\|sample name:E MTAB 11083:F1 mCherry\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F1 mCherry s	F1 mCherry s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F2-1_210715_D00404_0538_BCD91CANXX_CGATCAGT-TATCCTCT_L006_R1_001.fastq.gz	fastq	613574319.0	12030869.0	E MTAB 11083:2874F2 1 210715 D00404 0538 BCD91CANXX CGATCAGT TATCCTCT L006	0:51 1:0	A:164891629;C:138401759;G:135818073;T:174419828;N:43030	51	0	164891629	138401759	135818073	174419828	43030	ERX6698585	ERS8070374	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.79499	0.21674	0.73359	0.52207	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
10284	10284	ERR7131124	ERX6698585	ERS8070374	ERP132560	PRJEB48218	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E-MTAB-11083	Transcriptome Analysis	To investigate the effects of rabies infection on neuronal gene expression we compared gene profiles of rabies infected and non infected GABAergic neurons in the Zebrafish olfactory bulb.	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	Protocols: EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	F1 mCherry	SAMEA10418590	Friedrich Miescher Institute for Biomedical Research	ENA first public:2021 12 01\|ENA last update:2021 12 01\|External Id:SAMEA10418590\|INSDC center alias:Friedrich Miescher Institute for Biomedical Research\|INSDC center name:Friedrich Miescher Institute for Biomedical Research\|INSDC first public:2021 12 01T00:23:59Z\|INSDC last update:2021 12 01T00:23:59Z\|INSDC status:public\|Submitter Id:E MTAB 11083:F1 mCherry\|age:9\|broker name:ArrayExpress\|cell type:GABAergic neuron\|common name:zebrafish\|developmental stage:adult\|fraction:mCherry+/GFP \|genotype:Tg[gad1b:Gal4 UAS:TVA mCherry]\|individual:pool 1\|organism part:olfactory bulb\|sample name:E MTAB 11083:F1 mCherry\|sex:mixed\|stimulus:injected with EnvA RV GFP\|strain:Ab x Tu x TL x WIK	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	E MTAB 11083:F1 mCherry s	F1 mCherry s	Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	EnvA RV GFP was injected to olfactory bulb in Tg[gad1b:Gal4 UAS:TVA mCherry] fish. Fish were kept in the standard fish system at 36 degree for 3 4 days. postwards olfactory bulbs were extracted from 3 5 fish and the samples were pooled. post standard dissociation processes cells were sorted by their fluorescent markers using LSRII. Batch 1 pool 1 to 3 was done 7 days before batch 2 pool 4 to 8. RNA was purified using single cell RNA purification Kit Norgen cat. 51800 mRNA seq libraries were generated using the SmartSeq2 approach Picelli et al Nature protocol 2014 with the following modifications: For cDNA pre amplification up to 10ng of RNA was used as input typically 1 3ng and Reverse Transcription was performed using Superscript IV Thermo Fisher Scientific 50C for 10min 80C for 10min. Amplified cDNA 1ng were converted to indexed sequencing libraries by tagmentation using in house purified Tn5 Picelli et al Genome Research 2014 and Illumina Nextera primers.	Experimental Factor: fraction:mCherry+/GFP	RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	SINGLE	ILLUMINA	Illumina HiSeq 2500	ERP132560	Illumina HiSeq 2500 sequencing; Effect of rabies virus infection on gene expression in GABAergic neurons in the Zebrafish olfactory bulb	ENA FIRST PUBLIC:2022 07 07\|ENA LAST UPDATE:2022 07 07	2874F2-2_210715_D00404_0538_BCD91CANXX_CGATCAGT-TATCCTCT_L007_R1_001.fastq.gz	fastq	615666798.0	12071898.0	E MTAB 11083:2874F2 2 210715 D00404 0538 BCD91CANXX CGATCAGT TATCCTCT L007	0:51 1:0	A:165536502;C:138952758;G:136375193;T:174760659;N:41686	51	0	165536502	138952758	136375193	174760659	41686	ERX6698585	ERS8070374	ERA6757553	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	Friedrich Miescher Institute for Biomedical Research\|European Nucleotide Archive	1	0.7941	0.21645	0.73494	0.50761	51	B	usable mapping rate	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Switzerland	2021-12-01	Adult	Adult	Brain	Nervous System
19087	19087	ERR13834862	ERX13237628	ERS21098715	ERP164534	PRJEB80557	RNAseq of Danio Rerio Photoreceptors Amacrine and Horizontal cells collected 38 48 and 58 hpf	e09e99a9-eabd-4a7d-8f92-2c4cf9f384ed	Other	This analysis was conducted to elucidate potential guidance of retinal horizontal cells HCs by photoreceptors PRs and/or amacrine cells ACs during the retinal lamination. We dissected retinae from three different developmental stages corresponding to different stages in HCs lamination process and separated HCs PRs and HCs based on their differential GFP and DsRed expression in the Lhx1:GFP; ptf1a:DsRed zebrafish transgenic line. Four replicates of each sample were lysed converted to cDNA sequenced using the SMART SEQ2 protocol.	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01	retinal neurons	48HC1 S20 R1 001.fastq.gz	SAMEA116100635	GIMM	ENA first public:2024 01 01\|INSDC center name:GIMM\|INSDC status:public\|Submitter Id:48 HC1\|collected by:Jaakko Lehtimaki\|collection date:2021 11 24\|common name:zebrafish\|dev stage:48 hpf location country and/or sea:Portugal\|lab host:Tg 5.5ptf1a:DsRed; Tglhx1a:EGFP\|sample name:48 HC1\|scientific name:Danio rerio\|tissue type:retina	Raw reads: 48 HC1	webin reads 48 HC1					RNA-Seq	TRANSCRIPTOMIC	RANDOM	SINGLE	ILLUMINA	Illumina HiSeq X	ERP164534	Raw reads: 48 HC1	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01	48HC1_S20_R1_001.fastq.gz	fastq	3768442091.0	38065677.0	webin reads 48 HC1	0:99.00	A:1055463738;C:792073627;G:817607736;T:1103223790;N:73200	99		1055463738	792073627	817607736	1103223790	73200	ERX13237628	ERS21098715	ERA30883416	Gulbenkian Institute for Molecular Medicine\|European Nucleotide Archive	Gulbenkian Institute for Molecular Medicine							B	usable mapping rate	illumina	hiseq_era	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	Belgium	2024-01-01	Hatching	Embryo	Eye	Sensory System
19088	19088	ERR13834951	ERX13237717	ERS21098721	ERP164534	PRJEB80557	RNAseq of Danio Rerio Photoreceptors Amacrine and Horizontal cells collected 38 48 and 58 hpf	e09e99a9-eabd-4a7d-8f92-2c4cf9f384ed	Other	This analysis was conducted to elucidate potential guidance of retinal horizontal cells HCs by photoreceptors PRs and/or amacrine cells ACs during the retinal lamination. We dissected retinae from three different developmental stages corresponding to different stages in HCs lamination process and separated HCs PRs and HCs based on their differential GFP and DsRed expression in the Lhx1:GFP; ptf1a:DsRed zebrafish transgenic line. Four replicates of each sample were lysed converted to cDNA sequenced using the SMART SEQ2 protocol.	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01	retinal neurons	58PR3 S26 R1 001.fastq.gz	58 PR3		organism:Danio rerio\|collection date:2021 12 02\|scientific name:Danio rerio\|collected by:Jaakko Lehtimaki\|common name:zebrafish\|lab host:Tg 5.5ptf1a:DsRed; Tglhx1a:EGFP\|dev stage:58 hpf type:retina\|geographic location country and/or sea:Portugal	Raw reads: 58 PR3	webin reads 58 PR3					RNA-Seq	TRANSCRIPTOMIC	RANDOM	SINGLE	ILLUMINA	Illumina HiSeq X	ERP164534	Raw reads: 58 PR3	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01	58PR3_S26_R1_001.fastq.gz	fastq	3869469736.0	38850717.0	webin reads 58 PR3	0:99.60	A:1103909449;C:804146524;G:827344036;T:1134036010;N:33717	99		1103909449	804146524	827344036	1134036010	33717	ERX13237717	ERS21098721	ERA30883529	Gulbenkian Institute for Molecular Medicine\|European Nucleotide Archive	Gulbenkian Institute for Molecular Medicine							B	usable mapping rate	illumina	hiseq_era	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	Belgium	2025-01-01	Hatching	Embryo	Eye	Sensory System
19089	19089	ERR13835010	ERX13237776	ERS21098726	ERP164534	PRJEB80557	RNAseq of Danio Rerio Photoreceptors Amacrine and Horizontal cells collected 38 48 and 58 hpf	e09e99a9-eabd-4a7d-8f92-2c4cf9f384ed	Other	This analysis was conducted to elucidate potential guidance of retinal horizontal cells HCs by photoreceptors PRs and/or amacrine cells ACs during the retinal lamination. We dissected retinae from three different developmental stages corresponding to different stages in HCs lamination process and separated HCs PRs and HCs based on their differential GFP and DsRed expression in the Lhx1:GFP; ptf1a:DsRed zebrafish transgenic line. Four replicates of each sample were lysed converted to cDNA sequenced using the SMART SEQ2 protocol.	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01	retinal neurons	58AC4 S31 R1 001.fastq.gz	SAMEA116100646	GIMM	ENA first public:2024 01 01\|INSDC center name:GIMM\|INSDC status:public\|Submitter Id:58 AC4\|collected by:Jaakko Lehtimaki\|collection date:2021 12 02\|common name:zebrafish\|dev stage:58 hpf location country and/or sea:Portugal\|lab host:Tg 5.5ptf1a:DsRed; Tglhx1a:EGFP\|sample name:58 AC4\|scientific name:Danio rerio\|tissue type:retina	Raw reads: 58 AC4	webin reads 58 AC4					RNA-Seq	TRANSCRIPTOMIC	RANDOM	SINGLE	ILLUMINA	Illumina HiSeq X	ERP164534	Raw reads: 58 AC4	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01	58AC4_S31_R1_001.fastq.gz	fastq	3607648651.0	36331933.0	webin reads 58 AC4	0:99.30	A:1038047870;C:736262498;G:759315202;T:1073962987;N:60094	99		1038047870	736262498	759315202	1073962987	60094	ERX13237776	ERS21098726	ERA30883721	Gulbenkian Institute for Molecular Medicine\|European Nucleotide Archive	Gulbenkian Institute for Molecular Medicine							B	usable mapping rate	illumina	hiseq_era	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	Belgium	2024-01-01	Hatching	Embryo	Eye	Sensory System
19090	19090	ERR13822794	ERX13225546	ERS21098708	ERP164534	PRJEB80557	RNAseq of Danio Rerio Photoreceptors Amacrine and Horizontal cells collected 38 48 and 58 hpf	e09e99a9-eabd-4a7d-8f92-2c4cf9f384ed	Other	This analysis was conducted to elucidate potential guidance of retinal horizontal cells HCs by photoreceptors PRs and/or amacrine cells ACs during the retinal lamination. We dissected retinae from three different developmental stages corresponding to different stages in HCs lamination process and separated HCs PRs and HCs based on their differential GFP and DsRed expression in the Lhx1:GFP; ptf1a:DsRed zebrafish transgenic line. Four replicates of each sample were lysed converted to cDNA sequenced using the SMART SEQ2 protocol.	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01	retinal neurons	48PR2 S13 R1 001.fastq.gz	48 PR2		organism:Danio rerio\|collection date:2021 11 24\|scientific name:Danio rerio\|collected by:Jaakko Lehtimaki\|common name:zebrafish\|lab host:Tg 5.5ptf1a:DsRed; Tglhx1a:EGFP\|dev stage:48 hpf type:retina\|geographic location country and/or sea:Portugal	Raw reads: 48 PR2	webin reads 48 PR2					RNA-Seq	TRANSCRIPTOMIC	RANDOM	SINGLE	ILLUMINA	Illumina HiSeq X	ERP164534	Raw reads: 48 PR2	ENA FIRST PUBLIC:2025 01 01\|ENA LAST UPDATE:2025 01 01	48PR2_S13_R1_001.fastq.gz	fastq	3809299607.0	38404185.0	webin reads 48 PR2	0:99.19	A:1067728192;C:802585802;G:828435932;T:1110435904;N:113777	99		1067728192	802585802	828435932	1110435904	113777	ERX13225546	ERS21098708	ERA30879682	Gulbenkian Institute for Molecular Medicine\|European Nucleotide Archive	Gulbenkian Institute for Molecular Medicine							B	usable mapping rate	illumina	hiseq_era	unknown	random_priming	unknown	sc	single_cell_plate	smartseq	Belgium	2025-01-01	Hatching	Embryo	Eye	Sensory System

Advanced export

JSON shape: default, array, newline-delimited

CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;